scholarly journals Targeting Metabolic Vulnerabilities in Primary Effusion Lymphoma Using the Novel Nucleoside Analog 6-Eti

Blood ◽  
2021 ◽  
Vol 138 (Supplement 1) ◽  
pp. 1188-1188
Author(s):  
Jouliana Sadek ◽  
Jan Krumsiek ◽  
Tuo Zhang ◽  
Barbara Coan ◽  
Maite Ibañez de Garayo ◽  
...  
Keyword(s):  
Dna Synthesis ◽  
Cell Lines ◽  
De Novo ◽  
Primary Effusion Lymphoma ◽  
Nucleoside Analog ◽  
Nucleoside Analogues ◽  
Knock Out ◽  
Resistant Cells

Abstract Although nucleoside analogues have been used effectively in the clinic for the treatment of a wide range of hematological malignancies, lack of response to currently available nucleoside analogues and drug resistance limit their utility. A rare but highly aggressive cancer is primary effusion lymphoma (PEL). Through high throughput screening, we have discovered a novel nucleoside analog, called 6-ethylthioinosine (6-ETI) as a potent and selective inhibitor of PEL, with little activity in other lymphomas tested. PEL is a rare B-cell non-Hodgkin's lymphoma characterized by lymphomatous effusions in body cavities. It is associated with Kaposi's sarcoma herpesvirus (KSHV/HHV-8) infection and occurs mainly in immunocompromised patients. PEL is known to frequently be resistant to conventional chemotherapy (CHOP and EPOCH) resulting in poor prognosis and a rather incurable disease. Our studies demonstrated that 6-ETI is a pro-drug activated by adenosine kinase (ADK), an enzyme that is overexpressed in PEL cell lines and primary PEL specimens, as well as other plasma cell malignancies, including plasmablastic lymphoma (PBL) and multiple myeloma (MM). The latter is also responsive to 6-ETI in vitro and in mouse models. 6-ETI induces S phase arrest and inhibits DNA synthesis. RNA sequencing of in vitro generated PEL resistant clones and CRISPR knock out of ADK (ADK KO), respectively, indicated that mutations or loss of expression of ADK renders cells resistant to treatment. This data demonstrates that ADK expression can be used as a predictive biomarker of response to 6-ETI, which can help identify which patients are more likely to respond to this treatment. We investigated which pathways are differentially regulated in sensitive and resistant cells to better delineate the mechanism of action of 6-ETI and to design effective combinatorial regimens and prevent resistance. We found that drug sensitivity was associated with AMPK activation and inhibition of PI3K/mTOR/p70S6K signaling. Little is known about the function of ADK in plasma cell neoplasms. Knock-out of this protein in PEL, or use of ADK chemical inhibitors, do not affect their viability. Thus, we used ADK KO cell lines to examine the role of ADK in these tumors and to determine if cells undergo adaptations that may contribute to 6-ETI resistance and represent potential vulnerabilities to combat it. We performed metabolic and transcriptomic profiling of wild type (WT) (6-ETI sensitive) and ADK KO (6-ETI resistant) cells to achieve a comprehensive assessment of all the metabolic perturbations and gene expression changes induced by knocking out ADK. We also treated these cells with 6-ETI to examine the effects in sensitive and resistant cells. This integrated analysis revealed that 6-ETI depletes sensitive PEL cells of their nucleotide pools accompanied by the downregulation of several genes in purine and pyrimidine biosynthesis pathways. We found that adenine supplementation rescues sensitive PEL cells from 6-ETI induced cytotoxicity, reverses p70S6K inhibition and restores DNA synthesis suggesting that purine metabolism is a critical mediator of 6-ETI induced cytotoxicity. Using seahorse bioenergetic assay, we show that ADK KO resistant cells have impaired mitochondrial respiration indicating that ADK plays a critical role in mitochondrial bioenergetics. Metabolic profiling of these ADK KO resistant cells showed that these cells have elevated levels of de novo pyrimidine metabolic intermediates. Metabolic flux through de novo pyrimidine is controlled by the rate limiting enzyme CAD. The activity of CAD is regulated by ribosomal protein S6 Kinase 1(S6K1) by phosphorylation at its (Ser1859) site. Using western blotting, we observed a striking increase of phosphorylation of CAD at its S6K1 site (Ser1859) in ADK KO cells compared to WT cells. This is the first to date study that characterizes the role of ADK in lymphomas. Our data indicates that ADK KO cells have undergone metabolic reprogramming to upregulate de novo pyrimidine biosynthesis and p70S6K signaling. Moreover, we found that 6-ETI synergizes with the pan PI3K inhibitor BKM120 highlighting nucleotide metabolism and PI3K/mTOR signaling as key therapeutic vulnerabilities targeted by this novel nucleoside analog. Disclosures No relevant conflicts of interest to declare.

Bcr-Abl Directly Activates Stat5 Independent of Jak2

Blood ◽  
2010 ◽  
Vol 116 (21) ◽  
pp. 511-511
Author(s):  
Oliver D. Hantschel ◽  
Eva Eckelhart ◽  
Ines Kaupe ◽  
Florian Grebien ◽  
Kay-Uwe Wagner ◽  
...  
Keyword(s):  
Tyrosine Kinase ◽  
Cell Lines ◽  
Tyrosine Kinases ◽  
Functional Role ◽  
Kinase Inhibitors ◽  
Knock Out ◽  
Kinase Substrate ◽  
Knock Out Mice

Abstract Abstract 511 Persistent activation of the transcription factor Stat5 is a signaling hallmark of Chronic Myelogenous Leukemia (CML). In mouse models, Stat5 was required for initial myeloid and lymphoid transformation (by Bcr-Abl p210 or p185 and v-Abl). Most importantly, we and others recently showed that Stat5 was also required for maintenance of Bcr-Abl-dependent leukemia in vivo and for engraftment and reconstitution of Bcr-Abl p210-positive leukemia in secondary recipients. Therefore, Stat5 is of central functional importance in the Bcr-Abl signaling network and represents a possible critical vulnerable node in CML. In contrast to the well-studied functional role of Stat5 in disease models, the molecular mechanism of Bcr-Abl dependent Stat5 activation, including the tyrosine kinase(s) that phosphorylate and activate Stat5, remain only partially understood. In particular, conflicting views on the involvement of the Jak2 kinase and its potential role as a drug target in CML exist. We used conditional Jak2 knock-out mice to study the contribution of Jak2 in Bcr-Abl-dependent transformation and leukemogenicity. Jak2 ablation did not compromise the Bcr-Abl p210-mediated transforming capability in primary murine bone marrow- or fetal liver-derived hematopoietic cells in vitro. In contrast, initial lymphoid transformation by v-abl and Bcr-Abl p185 was abolished in Jak2 knock-out mice. Jak2 deletion did not have an effect on maintenance of lymphoid leukemia cells in vitro, whereas deletion of Stat5 induced a G1 arrest and subsequent apoptosis. In line with this, ablation of Jak2 expression after leukemia induction did not alter disease latency or disease phenotype. Consistently, we did not observe a decrease in Stat5 activation upon siRNA-mediated knock-down of Jak2 alone or all four Jak kinases (Jak1, Jak2, Jak3 and Tyk2) in CML cell lines. Using a panel of pharmacological inhibitors, we found that neither Jak2-selective, nor pan-Jak kinase inhibitors or Src family kinase-selective inhibitors led to a decrease in Stat5 phosphorylation, while the highly selective Bcr-Abl inhibitor nilotinib completely abrogated Stat5 phosphorylation. To study possible contributions of other tyrosine kinases in the Bcr-Abl dependent activation of Stat5, we used Ba/F3 cells expressing the TKI-resistant Bcr-Abl mutant T315I in combination with different broad-specificity tyrosine kinase inhibitors, like dasatinib. At dasatinib concentrations that inhibited several dozens of tyrosine kinases, Stat5 phosphorylation in Ba/F3 Bcr-Abl T315I cells was unaffected, excluding a role for most tyrosine kinases other than Bcr-Abl in Stat5 activation and pointing towards a direct phosphorylation of Stat5 by Bcr-Abl. Together, this data excludes a role of Jak and Src kinases in the activation of Stat5 in Bcr-Abl positive cell lines. Finally, in comprehensive enzyme kinetic analysis experiments using recombinant kinase, Stat5 had a similar KM value for Bcr-Abl as the canonical direct Bcr-Abl substrate CrkL and displayed only mildly lower kinase substrate parameters (vmax, kcat) than CrkL, fully compatible with direct phosphorylation of Stat5 by Bcr-Abl. Together with our earlier data on the pivotal role of Stat5 in the transcriptional and signaling network of Bcr-Abl, we propose a hypersensitive switch-like behavior of the Bcr-Abl-Stat5 kinase substrate pair that mechanistically rationalizes the central functional role of Stat5 in the signaling of CML cells. In summary, we provide compelling evidence that activation of Stat5 by Bcr-Abl is likely to be direct and that targeting of Jak2 in CML may not be of therapeutic benefit, as Jak2 is not required for CML initiation or maintenance. Disclosures: Hantschel: Novartis: Honoraria; Bristol-Myers Squibb: Honoraria.

Cereblon Splicing of Exon 10 Mediates IMiDs Resistance in Multiple Myeloma: Clinical Validation in the CoMMpass Trial

Blood ◽  
2016 ◽  
Vol 128 (22) ◽  
pp. 120-120 ◽  
Author(s):  
Paola Neri ◽  
Ranjan Maity ◽  
Jonathan J Keats ◽  
Ines Tagoug ◽  
Justin Simms ◽  
...  
Keyword(s):  
Cell Lines ◽  
Research Funding ◽  
Full Length ◽  
Stable Expression ◽  
Current Work ◽  
Myeloma Cells ◽  
Knock Out ◽  
Exon 10

Abstract Background: IMiDs neomorphe the substrates binding of CRL4_DDB1_ROC1 E3 ligase through their interaction with the adaptor protein Cereblon (CRBN) triggering the proteasomal degradation of IKZF1/IKZF3. This binding results from hydrogen bonds forming between the carbonyl residues of the IMiDs' glutarimide moiety and several amino acids within a hydrophobic pocket on the surface of CRBN. This pocket is formed by three tryptophan residues (W380, W386 and W400) mapping to CRBN c-terminus exons 10-11. Others and us, have previously shown that in vitro silencing or knock-out of CRBN is clearly associated with resistance to IMiDs, however CRBN mutations mapping to its thalidomide binding domain are rarely seen. We have previously identified through paired sequencing of the transcriptome of primary myeloma cells (pre- and post IMiDs) the expression of a CRBN mRNA splice variant (CRBN-005 or ENST00000424814) lacking exon 10. We also demonstrated that this isoform is translated into a stable protein that retains its binding to DDB1/Cul4a ligase but was no longer capable of interacting with IMiDs. Functionally, in HEK293 we have also shown that stable expression of CRBN-005 at higher levels relative to the full-length variant (CRBN-004 or ENST00000231948) abrogated IMiDs-induced degradation of Ikaros. In the current work, we validated in myeloma cell lines in vitro that the splicing of CRBN exon 10 was sufficient to reverse the cytotoxicity of lenalidomide. We also interrogated the longitudinal CoMMpass trial for the expression of CRBN-005 transcripts and its impact on survival. Methods and Results: We initially confirmed that lentiviral CRISPR mediated stable knock-out of CRBN using gRNA targeting exon 2 in the MM1S and OPM2 lenalidomide sensitive cell lines, resulted in complete resistance to IMiDs. In order to examine the role of CRBN exon 10 splicing in IMiDs resistance, we next cloned spliced CRBN-005 isoform (Δ10-CRBN) or full length CRBN (WT-CRBN) into lentiviral plasmid pLX304 and stably transduced JJN3 and KMS28BM myeloma cells. The Δ10-CRBN plasmid expressed a ~ 45 kDa proteins detectable by western blotting with CRBN65 antibody (Celgene, binds aa 65-76). Stable expression of Δ10-CRBN in JJN3 and KMS28BM cells significantly reduced Aiolos and Ikaros degradation in response to lenalidomide treatment and partially reversed (~ 30%) KMS28BM cell death (JJN3 are resistant to lenalidomide despite IKZF1 degradation). Consistent with our previous studies in HEK293 cells, high expression of Δ10-CRBN relative to endogenous WT-CRBN was required for the reversal of lenalidomide effects. Furthermore, we used the CRIPSR technology to induce splicing of endogenous CRBN exon 10 using two lentiviral gRNAs targeting intron9-exon10 (TTTATCCTTATGTGGGCCGA) and exon10-intron10 junctions (CAGAACACAGCTGGTTTCCT) in lenalidomide-sensitive MM1S and OPM2 cells stably engineered to express Cas9. Single cell clones expressing the exon 10 spliced CRBN were identified by cDNA cloning and sanger sequencing. The viability of the clones in response to lenalidomide as well as Ikaors degradation were nearly fully reversed in comparison to Cas9 only expressing MM1S and OPM2 cells. Lastly, in order to clinically validate the role of Δ10-CRBN in IMiDs resistance we interrogated the transcriptome of patients enrolled in the CoMMpass trial where in addition to genomic profiling (shallow genome long-insert sequencing, WES, RNAseq) clinical data and outcomes are captured. In the CoMMpass IA8, clinical and molecular data is available on 549 subjects, of which 486 were identified as ever receiving IMiDs-based regimen. We analyzed the survival of these patients based on the ratio of transcript levels (TPM) of spliced CRBN (ENST00000424814) to that of full-length CRBN. Using a cut-off ratio of 0.75, the survival of patients treated with IMiDs based regimen and high levels of spliced CRBN was significantly worse (Figure). Importantly, in 20 patients were RNA was available pre- and post IMiDs, we show that the levels of the CRBN spliced variants were significantly increased at the time of disease progression (Figure boxplot). Conclusions: In the current work, we have confirmed the role CRBN exon 10 splicing in IMiDs resistance using functional in vitro validation studies and demonstrated its predictive effects on IMiDs activity in the CoMMpass clinical dataset. Figure Figure. Disclosures Neri: Celgene and Jannsen: Consultancy, Honoraria. Lonial:Celgene: Consultancy; Novartis: Consultancy; Janssen: Consultancy; Janssen: Consultancy; Celgene: Consultancy; Millenium: Consultancy; BMS: Consultancy; Novartis: Consultancy; BMS: Consultancy; Merck: Consultancy; Onyx: Consultancy; Onyx: Consultancy. Bahlis:Janssen: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; Onyx: Consultancy, Honoraria; Celgene: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; BMS: Honoraria; Amgen: Consultancy, Honoraria.

scholarly journals Hsa_circ_0005273 facilitates breast cancer tumorigenesis by regulating YAP1-hippo signaling pathway

2021 ◽  
Vol 40 (1) ◽  
Author(s):  
Xuehui Wang ◽  
Changle Ji ◽  
Jiashu Hu ◽  
Xiaochong Deng ◽  
Wenfang Zheng ◽  
...  
Keyword(s):  
Breast Cancer ◽  
Signaling Pathway ◽  
Cell Lines ◽  
Luciferase Reporter ◽  
Circular Rnas ◽  
Hippo Signaling ◽  
Hippo Signaling Pathway ◽  
Potential Biomarker

Abstract Background Circular RNAs (circRNAs), a novel class of endogenous RNAs, have shown to participate in the development of breast cancer (BC). Hsa_circ_0005273 is a circRNA generated from several exons of PTK2. However, the potential functional role of hsa_circ_0005273 in BC remains largely unknown. Here we aim to evaluate the role of hsa_circ_0005273 in BC. Methods The expression level of hsa_circ_0005273 and miR-200a-3p were examined by RT-qPCR in BC tissues and cell lines. The effect of knocking down hsa_circ_0005273 in BC cell lines were evaluated by examinations of cell proliferation, migration and cell cycle. In addition, xenografts experiment in nude mice were performed to evaluate the effect of hsa_circ_0005273 in BC. RNA immunoprecipitation assay, RNA probe pull-down assay, luciferase reporter assay and fluorescence in situ hybridization were conducted to confirm the relationship between hsa_circ_0005273, miR-200a-3p and YAP1. Results Hsa_circ_0005273 is over-expressed in BC tissues and cell lines, whereas miR-200a-3p expression is repressed. Depletion of hsa_circ_0005273 inhibited the progression of BC cells in vitro and in vivo, while overexpression of hsa_circ_0005273 exhibited the opposite effect. Importantly, hsa_circ_0005273 upregulated YAP1 expression and inactivated Hippo pathway via sponging miR-200a-3p to promote BC progression. Conclusions Hsa_circ_0005273 regulates the miR-200a-3p/YAP1 axis and inactivates Hippo signaling pathway to promote BC progression, which may become a potential biomarker and therapeutic target.

scholarly journals Progression and Differentiation of Alveolar Rhabdomyosarcoma Is Regulated by PAX7 Transcription Factor—Significance of Tumor Subclones

Cells ◽  
2021 ◽  
Vol 10 (8) ◽  
pp. 1870
Author(s):  
Klaudia Skrzypek ◽  
Grażyna Adamek ◽  
Marta Kot ◽  
Bogna Badyra ◽  
Marcin Majka
Keyword(s):  
Transcription Factor ◽  
Cell Lines ◽  
Migration Activity ◽  
Id Proteins ◽  
Rh30 Cell ◽  
Str Profile ◽  
And Migration

Rhabdomyosarcoma (RMS), is the most frequent soft tissue tumor in children that originates from disturbances in differentiation process. Mechanisms leading to the development of RMS are still poorly understood. Therefore, by analysis of two RMS RH30 cell line subclones, one subclone PAX7 negative, while the second one PAX7 positive, and comparison with other RMS cell lines we aimed at identifying new mechanisms crucial for RMS progression. RH30 subclones were characterized by the same STR profile, but different morphology, rate of proliferation, migration activity and chemotactic abilities in vitro, as well as differences in tumor morphology and growth in vivo. Our analysis indicated a different level of expression of adhesion molecules (e.g., from VLA and ICAM families), myogenic microRNAs, such as miR-206 and transcription factors, such as MYOD, MYOG, SIX1, and ID. Silencing of PAX7 transcription factor with siRNA confirmed the crucial role of PAX7 transcription factor in proliferation, differentiation and migration of RMS cells. To conclude, our results suggest that tumor cell lines with the same STR profile can produce subclones that differ in many features and indicate crucial roles of PAX7 and ID proteins in the development of RMS.

scholarly journals The Extracellular Small Leucine-Rich Proteoglycan Biglycan Is a Key Player in Gastric Cancer Aggressiveness

Cancers ◽  
2021 ◽  
Vol 13 (6) ◽  
pp. 1330
Author(s):  
Filipe Pinto ◽  
Liliana Santos-Ferreira ◽  
Marta T. Pinto ◽  
Catarina Gomes ◽  
Celso A. Reis
Keyword(s):  
Clinical Value ◽  
Knock Out ◽  
Angiogenic Potential ◽  
In Vivo Experiments ◽  
Cancer Aggressiveness ◽  
Advanced Stages ◽  
Oncogenic Gene

Biglycan (BGN gene), an extracellular proteoglycan, has been described to be associated with cancer aggressiveness. The purpose of this study was to clarify the clinical value of biglycan as a biomarker in multiple independent GC cohorts and determine the in vitro and in vivo role of biglycan in GC malignant features. We found that BGN is commonly over-expressed in all analyzed cohorts, being associated with disease relapse and poor prognosis in patients with advanced stages of disease. In vitro and in vivo experiments demonstrated that biglycan knock-out GC cells display major phenotypic changes with a lower cell survival, migration, and angiogenic potential when compared with biglycan expressing cells. Biglycan KO GC cells present increased levels of PARP1 and caspase-3 cleavage and a decreased expression of mesenchymal markers. Importantly, biglycan deficient GC cells that were supplemented with exogenous biglycan were able to restore biological features, such as survival, clonogenic and migratory capacities. Our in vitro and in vivo findings were validated in human GC samples, where BGN expression was associated with several oncogenic gene signatures that were associated with apoptosis, cell migration, invasion, and angiogenesis. This study provided new insights on biglycan role in GC that should be taken in consideration as a key cellular regulator with major impact in tumor progression and patients’ clinical outcome.

Steroid Formation in Osteoblast-Like Cells

1998 ◽  
Vol 26 (1) ◽  
pp. 1-12 ◽  
Author(s):  
H Saito ◽  
T Yanaihara
Keyword(s):  
Cell Lines ◽  
Messenger Ribonucleic Acid ◽  
Steroid Sulphatase ◽  
Menopausal Women ◽  
Hormonal Action ◽  
Polymerase Chain ◽  
Post Menopausal ◽  
Receptor Mrnas

For preventing the reduction of bone mass in post-menopausal women, oestrogen replacement is known to be useful and the importance of sex steroids in bone metabolism in both sexes is well established. The presence of steroid-converting-enzyme activities in various osteoblast and osteoblast-like cells has been demonstrated using in vitro culture systems. In the present study, we assessed the expression of messenger ribonucleic acid (mRNA) for aromatase, steroid sulphatase, 5α-reductase, 17β-hydroxysteroid dehydrogenase (17β-HSD) and 3β-HSD by reverse transcription-polymerase chain reaction in the human osteoblast-like cell lines, MG 63 and HOS. Oestrogen, androgen and progesterone receptor mRNAs were also measured. Expression of mRNA for these enzymes and receptors was found in both cell lines without induction. From these and previous findings, we conclude that osteoblast-like cells have the capacity to form biologically potent oestrogens and androgens from peripheral circulating steroids. This may indicate an important role of bone in facilitating hormonal action.

TAMI-37. STEAROYL-COA DESATURASE 1 IS ESSENTIAL FOR THE GROWTH OF IDH MUTANT GLIOMA

2021 ◽  
Vol 23 (Supplement_6) ◽  
pp. vi206-vi206
Author(s):  
Tomohiro Yamasaki ◽  
Lumin Zhang ◽  
Tyrone Dowdy ◽  
Adrian Lita ◽  
Mark Gilbert ◽  
...  
Keyword(s):  
Glioma Cell ◽  
De Novo ◽  
Glioma Cells ◽  
Model Systems ◽  
De Novo Lipogenesis ◽  
Wild Type ◽  
Knock Out ◽  
Stearoyl Coa Desaturase ◽  
Scd1 Expression

Abstract BACKGROUND Increased de novo lipogenesis is a hallmark of cancer metabolism. In this study, we interrogated the role of de novo lipogenesis in IDH1 mutated glioma’s growth and identified the key enzyme, Stearoyl-CoA desaturase 1 (SCD1) that provides this growth advantage. MATERIALS ANDMETHODS We prepared genetically engineered glioma cell lines (U251 wild-type: U251WT and U251 IDHR132H mutant: U251RH) and normal human astrocytes (empty vector induced-NHA: NHAEV and IDHR132H mutant: NHARH). Lipid metabolic analysis was conducted by using LC-MS and Raman imaging microscopy. SCD1 expression was investigated by The Cancer Genome Atlas (TCGA) data analysis and Western-blotting method. Knock-out of SCD1 was conducted by using CRISPR/Cas9 and shRNA. RESULTS Previously, we showed that IDH1 mut glioma cells have increased monounsaturated fatty acids (MUFAs). TCGA data revealed IDH mut glioma shows significantly higher SCD1 mRNA expression than wild-type glioma. Our model systems of IDH1 mut (U251RH, NHARH) showed increased expression of this enzyme compared with their wild-type counterpart. Moreover, addition of D-2HG to U251WT increased SCD1 expression. Herein, we showed that inhibition of SCD1 with CAY10566 decreased relative cell number and sphere forming capacity in a dose-dependent manner. Furthermore, addition of MUFAs were able to rescue the SCD1 inhibitor induced-cell death and sphere forming capacity. Knock out of SCD1 revealed decreased cell proliferation and sphere forming ability. Decreasing lipid content from the media did not alter the growth of these cells, suggesting that glioma cells rely on de novo lipid synthesis rather than scavenging them from the microenvironment. CONCLUSION Overexpression of IDH mutant gene altered lipid composition in U251 cells to enrich MUFA levels and we confirmed that D-2HG caused SCD1 upregulation in U251WT. We demonstrated the glioma cell growth requires SCD1 expression and the results of the present study may provide novel insights into the role of SCD1 in IDH mut gliomas growth.

scholarly journals Impact of extracellular matrix properties on neuroblastoma genomic heterogeneity

2020 ◽  
Author(s):  
Amparo López-Carrasco ◽  
Susana Martín-Vañó ◽  
Rebeca Burgos-Panadero ◽  
Ezequiel Monferrer ◽  
Ana P Berbegall ◽  
...  
Keyword(s):  
Extracellular Matrix ◽  
High Risk ◽  
Cell Lines ◽  
Neuroblastoma Cell ◽  
Chromosome 9 ◽  
Future Research ◽  
Knock Out ◽  
Specific Distribution

Abstract Background Increased tissue stiffness is a common feature of malignant solid tumors, often associated with metastasis and poor patient outcomes. Vitronectin, as an extracellular matrix anchorage glycoprotein related to a stiff matrix, is present in a particularly increased quantity and specific distribution in high-risk neuroblastoma. Furthermore, as cells can sense and transform the proprieties of the extracellular matrix into chemical signals through mechanotransduction, genotypic changes related to stiffness are possible. Methods We have applied high density SNPa and NGS techniques to in vivo and in vitro models (orthotropic xenograft vitronectin knock-out mice and 3D bioprinted hydrogels with different stiffness) using two representative neuroblastoma cell lines (the MYCN amplified SK-N-BE(2) and the ALK mutated SH-SY5Y), to discern how tumor genomics patterns and clonal heterogeneity of both cell lines are affected. Results We describe a remarkable subclonal selection of some genomic aberrations in SK-N-BE(2) cells grown in knock-out vitronectin xenograft mice that also emerged when cultured for long times in stiff hydrogels. Specially, we detected an enlarged subclonal cell population with chromosome 9 aberrations in both models. Similar abnormalities were found in human high-risk neuroblastoma with MYCN amplification. Genomics of the SH-SY5Y cell line remained stable when cultured in both models. Conclusions Focus on heterogeneous intratumor segmental chromosome aberrations and mutations, as a mirror image of tumor microenvironment, is a vital area of future research.

scholarly journals Cytoplasmic Expression of the ALS/FTD-Related Protein TDP-43 Decreases Global Translation Both in vitro and in vivo

2020 ◽  
Vol 14 ◽  
Author(s):  
Santiago E. Charif ◽  
Luciana Luchelli ◽  
Antonella Vila ◽  
Matías Blaustein ◽  
Lionel M. Igaz
Keyword(s):  
De Novo ◽  
Brain Slices ◽  
Mrna Translation ◽  
Hek293 Cells ◽  
Cytoplasmic Inclusions ◽  
Cytoplasmic Expression ◽  
Global Translation

TDP-43 is a major component of cytoplasmic inclusions observed in neurodegenerative diseases like frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS). To further understand the role of TDP-43 in mRNA/protein metabolism and proteostasis, we used a combined approach with cellular and animal models overexpressing a cytoplasmic form of human TDP-43 (TDP-43-ΔNLS), recapitulating ALS/FTD features. We applied in HEK293 cells a method for labeling de novo translation, surface sensing of translation (SUnSET), based on puromycin (PURO) incorporation. While control cells displayed robust puromycilation, TDP-43-ΔNLS transfected cells exhibited reduced ongoing protein synthesis. Next, by using a transgenic mouse overexpressing cytoplasmic TDP-43 in the forebrain (TDP-43-ΔNLS mice) we assessed whether cytoplasmic TDP-43 regulates global translation in vivo. Polysome profiling of brain cortices from transgenic mice showed a shift toward non-polysomal fractions as compared to wild-type littermates, indicating a decrease in global translation. Lastly, cellular level translational assessment by SUNSET was performed in TDP-43-ΔNLS mice brain slices. Control mice slices incubated with PURO exhibited robust cytoplasmic PURO signal in layer 5 neurons from motor cortex, and normal nuclear TDP-43 staining. Neurons in TDP-43-ΔNLS mice slices incubated with PURO exhibited high cytoplasmic expression of TDP-43 and reduced puromycilation respect to control mice. These in vitro and in vivo results indicate that cytoplasmic TDP-43 decreases global translation and potentially cause functional/cytotoxic effects as observed in ALS/FTD. Our study provide in vivo evidence (by two independent and complementary methods) for a role of mislocalized TDP-43 in the regulation of global mRNA translation, with implications for TDP-43 proteinopathies.

Sign in / Sign up

Export Citation Format

Share Document