Phylogenetic analysis of Tomato mosaic virus from Hemerocallis sp. and Impatiens hawkeri

The culture and commercialization of ornamental plants have considerably increased in the last years. To supply the commercial demand, several Hemerocallis and Impatiens varieties have been bred for appreciated qualities such as flowers with a diversity of shapes and colors. With the aim of characterizing the tobamovirus isolated from Hemerocallis sp. (tobamo-H) and Impatiens hawkeri (tobamo-I) from the USA and São Paulo, respectively, as well as to establish phylogenetic relationships between them and other Tobamovirus species, the viruses were submitted to RNA extraction, RT-PCR amplification, coat-protein gene sequencing and phylogenetic analyses. Comparison of tobamovirus homologous sequences yielded values superior to 98.5% of identity with Tomato mosaic virus (ToMV) isolates at the nucleotide level. In relation to tobamo-H, 100% of identity with ToMV from tomatoes from Australia and Peru was found. Based on maximum likelihood (ML) analysis it was suggested that tobamo-H and tobamo-I share a common ancestor with ToMV, Tobacco mosaic virus, Odontoglossum ringspot virus and Pepper mild mottle virus. The tree topology reconstructed under ML methodology shows a monophyletic group, supported by 100% of bootstrap, consisting of various ToMV isolates from different hosts, including some ornamentals, from different geographical locations. The results indicate that Hemerocallis sp. and I. hawkeri are infected by ToMV. This is the first report of the occurrence of this virus in ornamental species in Brazil.

Download Full-text

First Reports of Potato spindle tuber viroid on Solanum jasminoides and of Tomato apical stunt viroid on Solanum rantonnetti in Poland

Plant Disease ◽

10.1094/pdis-04-13-0382-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1663-1663 ◽

Cited By ~ 2

Author(s):

E. Hennig ◽

J. Pięcińska ◽

N. Borodynko ◽

B. Hasiów-Jaroszewska

Keyword(s):

Rna Extraction ◽

Ornamental Plants ◽

Pcr Amplification ◽

Potato Spindle Tuber Viroid ◽

Positive Sample ◽

Rt Pcr ◽

Specific Primer ◽

Tomato Plants ◽

Stunt Viroid ◽

Pcr Product

Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5′CTTCAGTTGTTTCCACCGGGTAG 3′ /Vir2 5′TTCCTGTGGTGCACTCCTGACC 3′ (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5′ ATCCCCGGGGAAACCTGGAGCGAAC3′ /2H1 5′CCCTGAAGCGCTCCTCCGAG 3′ (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland. References: (1) R. A. Mumford et al. OEPP/EPPO Bulletin 30:431, 2000. (2) OEPP/EPPO Bulletin PM 7/33(1), 34:257, 2004. (3) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (4) H. L. Weidemann and U. Buchta. Potato Res. 41:1, 1998.

Download Full-text

Morphometric and Molecular Diversity among Seven European Isolates of Pratylenchus penetrans

Plants ◽

10.3390/plants10040674 ◽

2021 ◽

Vol 10 (4) ◽

pp. 674

Author(s):

Mesfin Bogale ◽

Betre Tadesse ◽

Rasha Haj Nuaima ◽

Bernd Honermeier ◽

Johannes Hallmann ◽

...

Keyword(s):

Phylogenetic Analyses ◽

Management Strategies ◽

Ornamental Plants ◽

Geographic Origin ◽

Tail Length ◽

Nematode Species ◽

Intraspecific Diversity ◽

Effective Control ◽

Pratylenchus Penetrans ◽

The Usa

Pratylenchus penetrans is an economically important root-lesion nematode species that affects agronomic and ornamental plants. Understanding its diversity is of paramount importance to develop effective control and management strategies. This study aimed to characterize the morphological and genetic diversity among seven European isolates. An isolate from the USA was included in the molecular analyses for comparative purposes. Morphometrics of the European P. penetrans isolates generally were within the range of the original descriptions for this species. However, multiple morphometric characteristics, including body length, maximum body width, tail length and length of the post-vulval uterine sac showed discrepancies when compared to other populations. Nucleotide sequence-based analyses revealed a high level of intraspecific diversity among the isolates. We observed no correlation between D2-D3 rDNA- and COXI-based phylogenetic similarities and geographic origin. Our phylogenetic analyses including selected GenBank sequences also suggest that the controversy surrounding the distinction between P. penetrans and P. fallax remains.

Download Full-text

First Report of Tomato mosaic virus Infecting Pepino in China

Plant Disease ◽

10.1094/pdis-05-12-0475-pdn ◽

2012 ◽

Vol 96 (11) ◽

pp. 1704-1704 ◽

Cited By ~ 1

Author(s):

B.-B. Ge ◽

G.-J. Liu ◽

H.-Q. Wang

Keyword(s):

Mosaic Virus ◽

High Efficiency ◽

Sandwich Elisa ◽

Rna Extraction ◽

Reference Sequence ◽

Tomato Mosaic Virus ◽

Yield Reduction ◽

Indicator Plants ◽

First Report ◽

Local Lesions

Pepino (Solanum muricatum L.) is a vegetatively propagated plant that is native to South America and is commercially grown in many countries (4) including China for its juicy and fragrant fruits. An unusual disease of pepino characterized by a yield reduction of fruits and mosaic, puckering, and distortion of leaves was observed in surveys conducted during 2010 to 2011 in pepino growing regions of Gansu, Jilin, and Yunnan provinces. These symptoms were similar to a disease caused by the Tomato mosaic virus (ToMV) first reported in Spain in 1998 (3). The sap from infected pepino was mechanically inoculated to 12 plants each of Chenopodium quinoa, Lycopersicon esculentum, and Gomphrena globosa, and the resulting symptoms were similar to those incited by ToMV (1). Symptoms included yellowish local lesions on inoculated leaves of C. quinoa and systemic mosaic in L. esculentum. Necrotic or semi-necrotic local lesions developed on inoculated leaves of G. globosa followed by systemic mosaic 7 dpi. Symptomatic pepino and indicator plants were tested for the presence of ToMV using commercial double-antibody sandwich-ELISA diagnostic kits (Agdia, Elkhart, IN). The virus incidence ranged from 33.3 to 75% in pepino and the other three indicator plants. To further confirm the presence of ToMV, ELISA-positive samples were subjected to total RNA extraction using Trizol (Invitrogen) followed by reverse transcription (RT)-PCR with ToMV-specific forward (5′-ATGTCTTACTCAATCACTTC-3′) and reverse primers (5′-TTAA(G)GAT(C) GCA(T)GGTGCAG(C)AGG-3′), designed to amplify a 480-bp fragment of the coat protein. Amplicons of the expected size were obtained from all ELISA-positive samples, but not from healthy pepino plants. The amplicons were cloned into the pMD18-T (TaKaRa, Da Lian, China) vector and transformed into E. coli DH-5α competent cells. The sequences obtained (GenBank Accession Nos. JX025562, JX025563, JX025565, and JX025566) shared 99.58 to 99.79% similarity with the ToMV reference sequence (Accession No. NC002692). To our knowledge, this is the first report of ToMV infecting pepino in China. ToMV is an important pathogen that is mechanically transmitted with high efficiency as a result of agricultural practices. The disease is difficult to control once infection occurs in the field. This disease has caused serious economic loss in Spain (2), thus it is important to survey and monitor the incidence and distribution of ToMV in China. References: (1) I. Kamenova et al. Acta Hort. 722:277, 2006. (2) L. Pérez-Benlloch et al. Euphytica. 120:247, 2001. (3) J. Prohens et al. Plant Dis. 82:1281, 1998. (4) J. Prohens et al. Acta Hort. 523:53, 2000.

Download Full-text

The Frequency of HIV-1 Infection in Iranian Children and Determination of the Transmitted Drug Resistance in Treatment-Naïve Children

Current HIV Research ◽

10.2174/1570162x17666191106111211 ◽

2020 ◽

Vol 17 (6) ◽

pp. 397-407

Author(s):

Maryam Jarchi ◽

Farah Bokharaei-Salim ◽

Maryam Esghaei ◽

Seyed Jalal Kiani ◽

Fatemeh Jahanbakhsh ◽

...

Keyword(s):

Drug Resistance ◽

Pediatric Patients ◽

Phylogenetic Analyses ◽

Rna Extraction ◽

Transmitted Drug Resistance ◽

The Arts ◽

Treatment Naïve ◽

Iranian Children ◽

Hiv 1

Background: The advent of resistance-associated mutations in HIV-1 is a barrier to the success of the ARTs. Objective: In this study, the abundance of HIV-1 infection in Iranian children, and also detection of the TDR in naïve HIV-1 infected pediatric (under 12 years old) were evaluated. Materials: From June 2014 to January 2019, a total of 544 consecutive treatment-naïve HIV-1- infected individuals enrolled in this study. After RNA extraction, amplification, and sequencing of the HIV-1 pol gene, the DRM and phylogenetic analysis were successfully performed on the plasma specimens of the ART-naïve HIV-1-infected-children under 12 years old. The DRMs were recognized using the Stanford HIV Drug Resistance Database. Results: Out of the 544 evaluated treatment-naïve HIV-1-infected individuals, 15 (2.8%) cases were children under 12 years old. The phylogenetic analyses of the amplified region of pol gene indicated that all of the 15 HIV-1-infected pediatric patients were infected by CRF35_AD, and a total of 13.3% (2/15) of these children were infected with HIV-1 variants with SDRMs (one child harbored two related SDRMs [D67N, V179F], and another child had three related SDRMs [M184V, T215F, and K103N]), according to the last algorithm of the WHO. No PIs-related SDRMs were observed in HIV-1-infected children. Conclusion: The current study demonstrated that a total of 13.3% of treatment-naïve HIV-1-infected Iranian pediatrics (under 12 years old) were infected with HIV-1 variants with SDRMs. Therefore, it seems that screening to recognize resistance-associated mutations before the initiation of ARTs among Iranian children is essential for favorable medication efficacy and dependable prognosis.

Download Full-text

Identification of Tomato Infecting Viruses That Co-Isolate with Nanovesicles Using a Combined Proteomics and Electron-Microscopic Approach

Nanomaterials ◽

10.3390/nano11081922 ◽

2021 ◽

Vol 11 (8) ◽

pp. 1922

Author(s):

Ramila Mammadova ◽

Immacolata Fiume ◽

Ramesh Bokka ◽

Veronika Kralj-Iglič ◽

Darja Božič ◽

...

Keyword(s):

Electron Microscopy ◽

Mosaic Virus ◽

Protein Identification ◽

Plant Viruses ◽

Size Exclusion ◽

Tomato Mosaic Virus ◽

High Yield ◽

Plant Resources ◽

Electron Microscopic ◽

Viral Particles

Plant-derived nanovesicles (NVs) have attracted interest due to their anti-inflammatory, anticancer and antioxidative properties and their efficient uptake by human intestinal epithelial cells. Previously we showed that tomato (Solanum lycopersicum L.) fruit is one of the interesting plant resources from which NVs can be obtained at a high yield. In the course of the isolation of NVs from different batches of tomatoes, using the established differential ultracentrifugation or size-exclusion chromatography methods, we occasionally observed the co-isolation of viral particles. Density gradient ultracentrifugation (gUC), using sucrose or iodixanol gradient materials, turned out to be efficient in the separation of NVs from the viral particles. We applied cryogenic transmission electron microscopy (cryo-TEM), scanning electron microscopy (SEM) for the morphological assessment and LC–MS/MS-based proteomics for the protein identification of the gradient fractions. Cryo-TEM showed that a low-density gUC fraction was enriched in membrane-enclosed NVs, while the high-density fractions were rich in rod-shaped objects. Mass spectrometry–based proteomic analysis identified capsid proteins of tomato brown rugose fruit virus, tomato mosaic virus and tomato mottle mosaic virus. In another batch of tomatoes, we isolated tomato spotted wilt virus, potato virus Y and southern tomato virus in the vesicle sample. Our results show the frequent co-isolation of plant viruses with NVs and the utility of the combination of cryo-TEM, SEM and proteomics in the detection of possible viral contamination.

Download Full-text

The phylogeographic history of tomato mosaic virus in Eurasia

Virology ◽

10.1016/j.virol.2020.12.009 ◽

2021 ◽

Vol 554 ◽

pp. 42-47

Author(s):

Yuting Xu ◽

Shuling Zhang ◽

Jianguo Shen ◽

Zujian Wu ◽

Zhenguo Du ◽

...

Keyword(s):

Mosaic Virus ◽

Tomato Mosaic Virus ◽

Phylogeographic History ◽

History Of

Download Full-text

Multilocus phylogenies reveal three new truffle-like taxa and the traces of interspecific hybridization in Octaviania (Boletaceae, Boletales)

IMA Fungus ◽

10.1186/s43008-021-00066-y ◽

2021 ◽

Vol 12 (1) ◽

Author(s):

Takamichi Orihara ◽

Rosanne Healy ◽

Adriana Corrales ◽

Matthew E. Smith

Keyword(s):

Rna Polymerase Ii ◽

Phylogenetic Analyses ◽

Large Subunit ◽

Gene Tree ◽

Phylogenetic Network ◽

Elongation Factor ◽

Morphological Observation ◽

Tree Comparison ◽

Unknown Species ◽

The Usa

ABSTRACTAmong many convergently evolved sequestrate fungal genera in Boletaceae (Boletales, Basidiomycota), the genus Octaviania is the most diverse. We recently collected many specimens of Octaviania subg. Octaviania, including several undescribed taxa, from Japan and the Americas. Here we describe two new species in subgenus Octaviania, O. tenuipes and O. tomentosa, from temperate to subtropical evergreen Fagaceae forests in Japan based on morphological observation and robust multilocus phylogenetic analyses (nrDNA ITS and partial large subunit [LSU], translation elongation factor 1-α gene [TEF1] and the largest subunit of RNA polymerase II gene [RPB1]). Based on specimens from the Americas as well as studies of the holotype, we also taxonomically re-evaluate O. asterosperma var. potteri. Our analysis suggests that O. asterosperma var. potteri is a distinct taxon within the subgenus Octaviania so we recognize this as O. potteri stat. nov. We unexpectedly collected O. potteri specimens from geographically widespread sites in the USA, Japan and Colombia. This is the first verified report of Octaviania from the South American continent. Our molecular analyses also revealed that the RPB1 sequence of one O. tenuipes specimen was identical to that of a closely related species, O. japonimontana, and that one O. potteri specimen from Minnesota had an RPB1 sequence of an unknown species of O. subg. Octaviania. Additionally, one O. japonimontana specimen had an unusually divergent TEF1 sequence. Gene-tree comparison and phylogenetic network analysis of the multilocus dataset suggest that these heterogenous sequences are most likely the result of previous inter- and intra-specific hybridization. We hypothesize that frequent hybridization events in Octaviania may have promoted the high genetic and species diversity found within the genus.

Download Full-text

Uncovering two phases of early intercontinental COVID-19 transmission dynamics

Journal of Travel Medicine ◽

10.1093/jtm/taaa200 ◽

2020 ◽

Vol 27 (8) ◽

Author(s):

Jing Yang ◽

Juan Li ◽

Shengjie Lai ◽

Corrine W Ruktanonchai ◽

Weijia Xing ◽

...

Keyword(s):

Phylogenetic Analyses ◽

International Travel ◽

Contact Tracing ◽

Genetic Sequencing ◽

Response Strategies ◽

The World ◽

Containment Measures ◽

The Usa ◽

Community Transmission ◽

Two Phases

Abstract Background The COVID-19 pandemic has posed an ongoing global crisis, but how the virus spread across the world remains poorly understood. This is of vital importance for informing current and future pandemic response strategies. Methods We performed two independent analyses, travel network-based epidemiological modelling and Bayesian phylogeographic inference, to investigate the intercontinental spread of COVID-19. Results Both approaches revealed two distinct phases of COVID-19 spread by the end of March 2020. In the first phase, COVID-19 largely circulated in China during mid-to-late January 2020 and was interrupted by containment measures in China. In the second and predominant phase extending from late February to mid-March, unrestricted movements between countries outside of China facilitated intercontinental spread, with Europe as a major source. Phylogenetic analyses also revealed that the dominant strains circulating in the USA were introduced from Europe. However, stringent restrictions on international travel across the world since late March have substantially reduced intercontinental transmission. Conclusions Our analyses highlight that heterogeneities in international travel have shaped the spatiotemporal characteristics of the pandemic. Unrestricted travel caused a large number of COVID-19 exportations from Europe to other continents between late February and mid-March, which facilitated the COVID-19 pandemic. Targeted restrictions on international travel from countries with widespread community transmission, together with improved capacity in testing, genetic sequencing and contact tracing, can inform timely strategies for mitigating and containing ongoing and future waves of COVID-19 pandemic.

Download Full-text

Multigene Combined Detection by RT-qPCR Using Cytological Specimens

Acta Cytologica ◽

10.1159/000514821 ◽

2021 ◽

pp. 1-10

Author(s):

Yang Ma ◽

Jingxia Zhao ◽

Yun Du ◽

Rui Wang ◽

Xiaokun Ji ◽

...

Keyword(s):

Lung Adenocarcinoma ◽

Smoking Status ◽

Single Gene ◽

Rna Extraction ◽

Pcr Amplification ◽

Driver Mutations ◽

Amplification Refractory Mutation System ◽

Driver Genes ◽

Mutation Status ◽

Pik3ca Mutations

Objective: The aim of the study was to investigate the mutation status of multiple driver genes by RT-qPCR and their significance in advanced lung adenocarcinoma using cytological specimens. Materials and Methods: 155 cytological specimens that had been diagnosed with lung adenocarcinoma in the Fourth Hospital of Hebei Medical University were selected from April to November 2019. The cytological specimens included serous cavity effusion and fine-needle aspiration biopsies. Among cytological specimens, 108 cases were processed by using the cell block method (CBM), and 47 cases were processed by the disposable membrane cell collector method (MCM) before DNA/RNA extraction. Ten drive genes of EGFR, ALK, ROS1, BRAF, KRAS, NRAS, HER2, RET, PIK3CA, and MET were combined detected at one step by the amplification refractory mutation system and ABI 7500 RT-qPCR. Results: The purity of RNA (p = 0.005) and DNA (p = 0.001) extracted by using the MCM was both significantly higher than that extracted by using the CBM. Forty-seven cases of fresh cell specimens processed by the MCM all succeeded in multigene detections, while of 108 specimens processed by the CBM, 6 cases failed in multigene detections. Among 149 specimens, single-gene mutation rates of EGFR, ALK, ROS1, RET, HER2, MET, KRAS, NRAS, BRAF, and PIK3CA mutations were 57.71%, 6.04%, 3.36%, 2.68%, 2.01%, 2.01%, 1.34%, 0.67%, 0% and 0% respectively, and 6 cases including 2 coexistence mutations. We found that mutation status was correlated with gender (p = 0.047), but not correlated with age (p = 0.141) and smoking status (p = 0.083). We found that the EGFR mutation status was correlated with gender (p = 0.003), age (p = 0.015) and smoking habits (p = 0.007), and ALK mutation status was correlated with age (p = 0.002). Conclusion: Compared with the CBM, the MCM can improve the efficiency of DNA/RNA extraction and PCR amplification by removing impurities and enriching tumor cells. And we speculate that the successful detection rate of fresh cytological specimens was higher than that of paraffin-embedded specimens. EGFR, ALK, and ROS1 mutations were the main driver mutations in patients with advanced lung adenocarcinoma. We speculate that EGFR and ALK are more prone to concomitant mutations, respectively. Targeted therapies for patients with coexisting mutations need further study.

Download Full-text

Genome-Wide Identification and Expression Analysis of the Histone Deacetylase Gene Family in Wheat (Triticum aestivum L.)

Plants ◽

10.3390/plants10010019 ◽

2020 ◽

Vol 10 (1) ◽

pp. 19

Author(s):

Peng Jin ◽

Shiqi Gao ◽

Long He ◽

Miaoze Xu ◽

Tianye Zhang ◽

...

Keyword(s):

Abiotic Stress ◽

Gene Family ◽

Mosaic Virus ◽

Stress Responses ◽

Viral Infections ◽

Phylogenetic Analyses ◽

Plant Viruses ◽

Gene Family Evolution ◽

Yellow Mosaic Virus ◽

Wheat Yellow Mosaic Virus

Histone acetylation is a dynamic modification process co-regulated by histone acetyltransferases (HATs) and histone deacetylases (HDACs). Although HDACs play vital roles in abiotic or biotic stress responses, their members in Triticumaestivum and their response to plant viruses remain unknown. Here, we identified and characterized 49 T. aestivumHDACs (TaHDACs) at the whole-genome level. Based on phylogenetic analyses, TaHDACs could be divided into 5 clades, and their protein spatial structure was integral and conserved. Chromosomal location and synteny analyses showed that TaHDACs were widely distributed on wheat chromosomes, and gene duplication has accelerated the TaHDAC gene family evolution. The cis-acting element analysis indicated that TaHDACs were involved in hormone response, light response, abiotic stress, growth, and development. Heatmaps analysis of RNA-sequencing data showed that TaHDAC genes were involved in biotic or abiotic stress response. Selected TaHDACs were differentially expressed in diverse tissues or under varying temperature conditions. All selected TaHDACs were significantly upregulated following infection with the barley stripe mosaic virus (BSMV), Chinese wheat mosaic virus (CWMV), and wheat yellow mosaic virus (WYMV), suggesting their involvement in response to viral infections. Furthermore, TaSRT1-silenced contributed to increasing wheat resistance against CWMV infection. In summary, these findings could help deepen the understanding of the structure and characteristics of the HDAC gene family in wheat and lay the foundation for exploring the function of TaHDACs in plants resistant to viral infections.

Download Full-text