scholarly journals Diplodia sapinea in Swedish forest nurseries

2020 ◽  
Vol 57 (No. 1) ◽  
pp. 66-69
Author(s):  
Rebecca Larsson ◽  
Audrius Menkis ◽  
Åke Olson
Keyword(s):  
Infected Plant ◽  
Morphological Characteristics ◽  
Plant Tissues ◽  
Forest Pathogen ◽  
Agar Media ◽  
Disease Spreading ◽  
Forest Nurseries ◽  
Pinus Spp ◽  
First Time ◽  
Infected Plant Material

Diplodia sapinea is a common forest pathogen on Pinus spp. in a large part of the world. In 2013, disease caused by this pathogen on Scots pine (Pinus sylvestris) trees in Sweden was reported for the first time. In this study, we report the first detection of D. sapinea on diseased seedlings of P. sylvestris from two Swedish forest nurseries. Infected seedlings were collected July–November 2019. Diplodia sapinea  was identified by morphological characteristics of fungal structures on plant tissues and from culture grown on Hagem agar media, followed by sequencing of fungal ITS rDNA. The result emphasizes the susceptibility of P. sylvestris seedlings. More research is needed to better understand the risk for disease spreading within forest nurseries and into the forest through infected plant material.

scholarly journals First Report of a Gall Midge Species (Diptera: Cecidomyiidae) Associated With Pistachios

2020 ◽  
Vol 11 (1) ◽  
Author(s):  
Farshid O Sirjani ◽  
Edwin E Lewis
Keyword(s):  
Gall Midge ◽  
Species Level ◽  
Plant Tissues ◽  
First Report ◽  
Branch Dieback ◽  
First Time ◽  
Level Identification

Abstract A new dipterous pest is reported, for the first time, on commercial pistachios from Sirjan, Kerman province, Iran. The genus of the insect was determined to be Resseliella Seitner (Diptera: Cecidomyiidae). Adults are light brown to brown in color and 0.8–1.5 mm in length with females, generally, slightly larger than males. Females have an elongated ovipositor, which is characteristic of the genus. Larvae are orange in color, 2–3 mm in length in the later instars, feed under bark without inducing galls, and cause branch dieback on trees of various ages. Brown to black discolorations are observed on plant tissues under bark where the larvae feed. Infestations observed on current and the previous—year’s growths, ranged from 0.5 to 1.2 cm in diameter, and all located in outer branches. Dry leaves and fruit clusters on infested branches remain attached, which may be used to recognize infestation by the gall midge. Dark-colored, sunken spots with splits on the bark located at the base of the wilted sections of the shoots also are symptoms of Resseliella sp. larval activity. Species-level identification of the gall midge is currently underway.

scholarly journals First Description of Two Sequence Type 2 Acinetobacter baumannii Isolates Carrying OXA-23 Carbapenemase in Pagellus acarne Fished from the Mediterranean Sea near Bejaia, Algeria

2016 ◽  
Vol 60 (4) ◽  
pp. 2513-2515 ◽  
Author(s):  
Soumia Brahmi ◽  
Abdelaziz Touati ◽  
Axelle Cadière ◽  
Nassima Djahmi ◽  
Alix Pantel ◽  
...  
Keyword(s):  
Acinetobacter Baumannii ◽  
Mediterranean Sea ◽  
Sequence Type ◽  
Content Type ◽  
Carbapenem Resistant ◽  
Selective Agar ◽  
Agar Media ◽  
The Mediterranean ◽  
First Time

ABSTRACTTo determine the occurrence of carbapenem-resistantAcinetobacter baumanniiin fish fished from the Mediterranean Sea near the Bejaia coast (Algeria), we studied 300 gills and gut samples that had been randomly and prospectively collected during 1 year. After screening on selective agar media, using PCR arrays and whole-genome sequencing, we identified for the first time two OXA-23-producingA. baumanniistrains belonging to the widespread sequence type 2 (ST2)/international clone II and harboring aminoglycoside-modifying enzymes [aac(6′)-Ib andaac(3′)-I genes].

Découverte d’une nouvelle population de Rhithrogena delphinensis Sowa & Degrange, 1987, dans le massif des Arves, et compléments à la description de la larve (Ephemeroptera, Heptageniidae)

2021 ◽  
Vol 126 (4) ◽  
pp. 401-420
Author(s):  
Bertrand Launay ◽  
Julien Barnasson ◽  
Juliette Becquet ◽  
Michel Brulin ◽  
Sophie Cauvy-Fraunie ◽  
...  
Keyword(s):  
Drainage Basin ◽  
Morphological Characteristics ◽  
Western Alps ◽  
Coi Gene ◽  
Morphological Description ◽  
Base Pairs ◽  
Northern Flank ◽  
Ecological Requirements ◽  
First Time ◽  
Existing Data

Discovery of a new population of Rhithrogena delphinensis Sowa & Degrange, 1987, in the Arves Massif, and additions to the morphological description of the larva (Ephemeroptera, Heptageniidae). Rhithrogena delphinensis, described originally on the basis of four larvae from the Western Alps, south of the Arves Massif and from the northern flank of the Ecrins Massif, had not been captured again since 1986. Here, we report the discovery of a new population from river Arvan, whose drainage basin is located between the Grandes Rousses Massif and the northern flank of the Arves Massif. This newly discovered population seems abundant in numbers, and reveals the particular ecological requirements of the species as well as its dependence on glacier fed or nival streams. The morphological characteristics of the larvae are described in detail, and illustrated by photographs. The variability of some of the proposed identification criteria is discussed, and a key to the identification of the Rhithrogena species from the alpestris group of the Western Alps, to which R. delphinensis belongs, is provided. Finally, a portion of 658 base pairs of the COI gene of R. delphinensis is sequenced for the first time and compared to already existing data on the alpestris group in the Western Alps.

Coronary artery myogenic response in a genetic model of hypertrophic cardiomyopathy

2002 ◽  
Vol 283 (6) ◽  
pp. H2244-H2249 ◽  
Author(s):  
Henrik H. Petersen ◽  
Jonathan Choy ◽  
Brian Stauffer ◽  
Farzad Moien-Afshari ◽  
Christian Aalkjaer ◽  
...  
Keyword(s):  
Transgenic Mouse ◽  
Genetic Model ◽  
Morphological Characteristics ◽  
Myogenic Tone ◽  
Chain Gene ◽  
Myogenic Response ◽  
Cardiac Phenotype ◽  
First Time ◽  
Pressure Myograph ◽  
Intravascular Pressure

Hypertrophic cardiac myopathy (HCM) is the leading cause of mortality in young athletes. Abnormalities in small intramural coronary arteries have been observed at autopsy in such subjects. The walls of these intramural vessels, especially in the ventricular septum, are thickened, and the lumen frequently appears narrowed. Whether these morphological characteristics have functional correlates is unknown. We studied coronary myogenic tone in a transgenic mouse model of HCM that has mutations in the cardiac α-myosin heavy chain gene. This transgenic mouse has a cardiac phenotype that resembles that occurring in humans. We examined the possible vascular contributions to the pathology of HCM. Septal arteries from 3- and 11-mo-old wild-type (WT) and transgenic (TG) mice were studied on a pressure myograph. The myogenic response to increased intravascular pressure in older animals was significantly reduced [maximal constriction: 32 ± 4% (TG) and 46 ± 4% (WT), P < 0.05]. After inhibition of endothelin receptors with bosentan, both WT and TG mice had similar increases in myogenic constriction. The sensitivity to exogenous endothelin was significantly reduced in TG mice, suggesting that the reduced myogenic constriction in HCM was due to reduced receptor sensitivity. In conclusion, we show for the first time that 1) myogenic tone in the coronary septal artery of the mouse is regulated by a basal release of endothelin, and 2) pressure-induced myogenic activation is attenuated in HCM, possibly consequent to a reduction in endothelin responsiveness. The associated reduction in coronary vasodilatory reserve may increase susceptibility to ischemia and arrhythmias.

scholarly journals Reproduction and population structure of the sea cucumber Holothuria tubulosa in the Dardanelles Strait, Turkey

2015 ◽  
Vol 17 (1) ◽  
pp. 47 ◽  
Author(s):  
H. DERELİ ◽  
S. TÜRK ÇULHA ◽  
M. ÇULHA ◽  
B. H. ÖZALP ◽  
A. A. TEKİNAY
Keyword(s):  
Population Density ◽  
Gonadosomatic Index ◽  
Morphological Characteristics ◽  
Environmental Parameters ◽  
Population Characteristics ◽  
High Positive Correlation ◽  
Mediterranean Populations ◽  
Reproductive Patterns ◽  
First Time ◽  
The Relationship

In this study, Holothuria tubulosa Gmelin 1791 was investigated from April 2013 to March 2014 in the Dardanelles Strait, to outline the morphological characteristics, reproductive patterns and the relationship between population characteristics and environmental parameters. Between 15 and 30 individuals of this species were sampled monthly from three stations. There was a negative allometry between length and weight, being gutted weight the most reliable measurement for this species. Reproductive patterns of the species were identified the first time for Turkish coasts. By macroscopic examination of the gonads, smallest sizes (gutted length) were measured as 8.4 and 8.1 cm for female and male, respectively. Sex ratio was calculated as 1: 1.1 with differences between seasons. The reproduction of sea cucumbers occurred between August and September after Gonadosomatic Index (GSI) values reached their maximum in July. The species was found down to 10 m depth with a population density of 0.21 / m2, which was rather low compared to previously reported values for Mediterranean populations of this species. There was a high positive correlation between population density and GSI of the species. The highest population density was observed where the largest sea grass meadows are found.

scholarly journals A taxonomic revision of genus Phloeophila (Orchidaceae, Pleurothallidinae) in Ecuador

2021 ◽  
Vol 66 (1) ◽  
pp. 37-45
Author(s):  
Marco Marcelo Jiménez ◽  
Leisberth Alexis Vélez-Abarca ◽  
Luis Enrique Baquero ◽  
Carlos James Naranjo
Keyword(s):  
New Species ◽  
Morphological Characteristics ◽  
Taxonomic Revision ◽  
Identification Key ◽  
Southern Mexico ◽  
First Time ◽  
A New Species

The orchid genus Phloeophila is distributed from southern Mexico to Brazil and Bolivia, as well as Cuba. A taxonomic revision including the three Phloeophila species present in Ecuador is presented. Morphological characteristics, an identification key, maps of known localities and illustrations of the species are also included. In Ecuador, species of Phloeophila are only known from the Amazonian rainforests, growing from 890 to 1600 meters of altitude. Phloeophila condorana is described as a new species based on specimens collected in the Ecuadorian province of Zamora-Chinchipe and compared to Phloeophila nummularia. Phloeophila nummularia is reported for the first time in Peru. A lectotype for Pleurothallis echinantha is selected.

scholarly journals First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168
Author(s):  
R. S. Trivedi ◽  
J. G. Hampton ◽  
J. M. Townshend ◽  
M. V. Jaspers ◽  
H. J. Ridgway
Keyword(s):  
New Zealand ◽  
Morphological Characteristics ◽  
New Taxon ◽  
First Report ◽  
Agar Plug ◽  
Carrot Seed ◽  
Agar Media ◽  
Leaves And Roots ◽  
Seed Crops ◽  
Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

scholarly journals New Balkan records of Bombus subterraneus (Linnaeus 1758) and Bombus cryptarum (Fabricius 1775) from Greece

2017 ◽  
Vol 18 ◽  
pp. 56 ◽  
Author(s):  
Ioannis Th. Anagnostopoulos
Keyword(s):  
Mitochondrial Dna ◽  
New Records ◽  
Morphological Characteristics ◽  
Rflp Analysis ◽  
Original Data ◽  
Insect Fauna ◽  
Bumblebee Species ◽  
Species Lists ◽  
Vicia Cracca ◽  
First Time

From the study of the Greek bumblebee fauna (Hymenoptera: Apidae, Bombini), species lists have been published based on both literature records and original data from collected bees. Since 1995 a special effort to confirm with newly collected bees all bumblebee species reported in literature records for Greece has been in progress. Although numerous specimens have been collected and examined and in some instances yielding new Bombus species for the Greek insect fauna, some species, mainly those reported in older references, have not yet been found. Recently, identification of bumblebees collected in the Florina Prefecture - Northwest Macedonia, during the years 2006 and 2007 yielded information for two “literature cited” species, Bombus subterraneus (Linnaeus 1758) and Bombus cryptarum (Fabricius 1775). A B. subterraneus queen (collected at 40°47´38N, 21°26´10E on Vicia cracca) was distinguished by morphological characteristics and a worker B. cryptarum (collected at 40°41´58,7N, 21°28´18,5E on Echium spp) was revealed using mitochondrial DNA RFLP analysis of the CO1 gene. These new records from Florina are provided with comments, confirming the species presence in Greece for the first time after approximately 40 years.

scholarly journals The Chemical Environment at Maturation Stage in Pinus spp. Somatic Embryogenesis: Implications in the Polyamine Profile of Somatic Embryos and Morphological Characteristics of the Developed Plantlets

2021 ◽  
Vol 12 ◽  
Author(s):  
Antonia Maiara Marques do Nascimento ◽  
Luiza Giacomolli Polesi ◽  
Franklin Panato Back ◽  
Neusa Steiner ◽  
Miguel Pedro Guerra ◽  
...  
Keyword(s):  
Somatic Embryogenesis ◽  
Amino Acid ◽  
Somatic Embryos ◽  
Pinus Halepensis ◽  
Morphological Characteristics ◽  
Chemical Environment ◽  
Acid Mixture ◽  
Maturation Stage ◽  
Maturation Medium ◽  
Pinus Spp

Changes in the chemical environment at the maturation stage in Pinus spp. somatic embryogenesis will be a determinant factor in the conversion of somatic embryos to plantlets. Furthermore, the study of biochemical and morphological aspects of the somatic embryos could enable the improvement of somatic embryogenesis in Pinus spp. In the present work, the influence of different amino acid combinations, carbohydrate sources, and concentrations at the maturation stage of Pinus radiata D. Don and Pinus halepensis Mill. was analyzed. In P. radiata, the maturation medium supplemented with 175 mM of sucrose and an increase in the amino acid mixture (1,100 mgL–1 of L-glutamine, 1,050 mgL–1 of L-asparagine, 350 mgL–1 of L-arginine, and 35 mgL–1 of L-proline) promoted bigger embryos, with a larger stem diameter and an increase in the number of roots in the germinated somatic embryos, improving the acclimatization success of this species. In P. halepensis, the maturation medium supplemented with 175 mM of maltose improved the germination of somatic embryos. The increase in the amount of amino acids in the maturation medium increased the levels of putrescine in the germinated somatic embryos of P. halepensis. We detected significant differences in the amounts of polyamines between somatic plantlets of P. radiata and P. halepensis; putrescine was less abundant in both species. For the first time, in P. radiata and P. halepensis somatic embryogenesis, we detected the presence of cadaverine, and its concentration changed according to the species.

scholarly journals First Report of Botryosphaeria dothidea, Diplodia seriata, and Neofusicoccum luteum Associated with Canker and Dieback of Grapevines in Tunisia

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 420-420 ◽  
Author(s):  
S. Chebil ◽  
R. Fersi ◽  
A. Yakoub ◽  
S. Chenenaoui ◽  
M. Chattaoui ◽  
...  
Keyword(s):  
Morphological Characteristics ◽  
Aerial Mycelium ◽  
Its2 Region ◽  
Pathogenicity Test ◽  
Botryosphaeria Dothidea ◽  
Diplodia Seriata ◽  
First Report ◽  
Grapevine Dieback ◽  
Pinus Spp ◽  
Neofusicoccum Luteum

In 2011, common symptoms of grapevine dieback were frequently observed in 2- to 5-year-old table grape (Vitis vinifera L.) cvs. in four vineyards located in northern Tunisia. The symptoms included dead spur and cordons, shoot dieback, and sunken necrotic bark lesions, which progressed into the trunk resulting in the death of large sections of the vine. Longitudinal and transversal sections of cordons and spurs from symptomatic vines revealed brown wedge-shaped cankers of hard consistency. Twelve symptomatic samples from spur and cordons were collected, surface disinfected by dipping into 5% (v/v) sodium hypochlorite for 2 min, and small pieces from the edge of necrotic and healthy tissue were removed and plated onto potato dextrose agar (PDA) at 25°C in the dark. Based on colony and conidia morphological characteristics, isolates were divided in three species, named Diplodia seriata, Botryosphaeria dothidea, and Neofusicoccum luteum. D. seriata colonies were gray-brown with dense aerial mycelium producing brown cylindric to ellipsoid conidia rounded at both ends and averaged 22.4 × 11.7 μm (n = 50). B. dothidea colonies were initially white with abundant aerial mycelium, gradually becoming dark green olivaceous. Conidia were fusiform to fusiform elliptical with a subobtuse apex and averaged 24.8 × 4.7 μm (n = 50). N. luteum colonies were initially pale to colorless, gradually darkening with age and becoming gray to dark gray producing a yellow pigment that diffuses into the agar. Conidia were hyaline, thin-walled, aseptate, fusiform to fusiform elliptical, and averaged 19.8 × 5.5 μm (n = 50). Identity of the different taxa was confirmed by sequence analyses of the internal transcribed spacer (ITS1-5.8S-ITS2) region of the rDNA and part of the elongation factor 1-alpha (EF1-α) gene. BLAST analysis of sequences indicated that six isolates were identified as D. seriata (GenBank: AY259094, AY343353), one isolate as B. dothidea (AY236949, AY786319) and one isolate as N. luteum (AY259091, AY573217). Sequences were deposited in GenBank under accessions from KC178817 to KC178824 and from KF546829 to KF546836 for ITS region and EF1-α gene, respectively. A pathogenicity test was conducted on detached green shoots cv. Italia for the eight Botryosphaeriaceae isolates. Shoots were inoculated by placing a colonized agar plug (5 mm diameter) from the margin of a 7-day-old colony on fresh wound sites made with a sterilized scalpel. Each wound was covered with moisturized cotton and sealed with Parafilm. Control shoots were inoculated using non-colonized PDA plugs. After 6 weeks, discoloration of xylem and phloem and necrosis with average length of 38.8, 17.6, and 11.2 mm were observed from inoculated shoots with D. seriata, N. luteum, and B. dothidea, respectively, and all three fungi were re-isolated from necrotic tissue, satisfying Koch's postulates. Control shoots showed no symptoms of the disease and no fungus was re-isolated. In Tunisia, Botryosphaeria-related dieback was reported only on citrus tree caused by B. ribis (2), on Pinus spp. caused by D. pinea (4), on Quercus spp. caused by D. corticola (3), and on olive tree (Olea europea) caused by D. seriata (1). To our knowledge, this is the first report of D. seriata, B. dothidea, and N. luteum associated with grapevine dieback in Tunisia. References: (1) M. Chattaoui et al. Plant Dis. 96:905, 2012. (2) H. S. Fawcett. Calif. Citrogr. 16:208, 1931. (3) B. T. Linaldeddu et al. J. Plant Pathol. 91:234. 2009. (4) B. T. Linaldeddu et al. Phytopathol. Mediterr. 47:258, 2008.

Sign in / Sign up

Export Citation Format

Share Document