scholarly journals Genetic Monitoring of Crimean-Congo Hemorrhagic Fever Virus in the South of the European Part of Russia

2012 ◽  
pp. 80-85 ◽  
Author(s):  
A. S. Volynkina ◽  
A. N. Kulichenko
Keyword(s):  
Genetic Variants ◽  
Hemorrhagic Fever ◽  
Nucleotide Sequences ◽  
European Part ◽  
Clinical Samples ◽  
Virus Variant ◽  
Hemorrhagic Fever Virus ◽  
Cchf Virus ◽  
European Part Of Russia ◽  
First Time

Presented are the results of gene-typing of CCHF virus detected in clinical samples from CHF patients from the Stavropol, Rostov and Astrakhan Regions in 2011. For 28 samples determined are nucleotide sequences of the fragments 115–652 (S segment) and fragments 984–1469 (M segment). Philogenetic analysis of these nucleotide sequences demonstrated that typical strains circulated in 2011 in the regions under surveillance, importation of the new genetic variants of the virus did not take place. CCHF virus variant affiliated to the subgroup “Astrakhan-2” was detected in the clinical samples for the first time and characterized for its genome S- and M-segment fragments.

scholarly journals Detection of the RNA for new multicomponent virus in patients with Crimean-Congo hemorrhagic fever in southern Russia

2020 ◽  
Author(s):  
Vladimir Ternovoi ◽  
Anastasia Gladysheva ◽  
Alexandra Sementsova ◽  
Anna Zaykovskaya ◽  
Anna Volynkina ◽  
...  
Keyword(s):  
Phylogenetic Analyses ◽  
Hemorrhagic Fever ◽  
European Part ◽  
Viral Rna ◽  
Crimean Congo Hemorrhagic Fever ◽  
Viral Genomes ◽  
Cchf Virus ◽  
European Part Of Russia ◽  
Human Sera ◽  
Southern Russia

Background: Recently, a new multicomponent RNA-containing virus was described and called as Jingmen tick virus (JMTV) supposedly belonging to flaviviruses. A virus consists of four viral particles and JMTV was firstly isolated from ticks in China and South America. Aims: Detection viral RNA specific for JMTV complex, sequencing genome fragments and taxonomy identification novel virus from JMTV complex in patients with Crimean-Congo hemorrhagic fever (CCHF) from southern European part of Russia. Materials and methods: Panel of 20 randomly selected sera from patients with confirmed Crimean-Congo hemorrhagic fever was collected in 2016 and was used for detection JMTV and CCHF viral RNA by PCR with experimental primers. Subsequent sequencing of isolated fragments of viral genomes was used for identification JMTV and CCHF virus genetic materials and phylogenetic analyses. Results: The viral RNAs of the CCHF virus and JMTV were detected in blood of four patients. Sequencing of the isolated PCR fragment of S segment CCHF virus allowed identifying these RNA isolates as Europe 1 lineage, subgroups Va and Vb of the CCHF virus that is a typical for the southern European part of the Russia. The nucleotide sequences of segment 2 (GP glycoprotein) of the JMTV were also detected by RP PCR and sequencing in these human sera. The new JMTV isolates were clustered together by phylogenetic analysis. The level of nucleotide identity for newly discovered JMTV isolates was only about 81-82% with comparison to the previously described European variants (Kosovo) of the JMTV. Conclusions: The results suggest that viral genomic RNA for new multicomponent flavivirus named as Manych virus and related to the JMTV complex was discovered in sera of CCHF patients in Russia.

scholarly journals MONITORING OF NATURAL FOCAL INFECTIONS ON THE SOUTHERN EUROPEAN PART OF RUSSIA IN 2016

2018 ◽  
pp. 30-32 ◽  
Author(s):  
N.F. Vasilenko ◽  
O.V. Maletskaya ◽  
E.A. Manin ◽  
D.A. Prislegina ◽  
L.I. Shaposhnikova ◽  
...  
Keyword(s):  
Viral Encephalitis ◽  
Q Fever ◽  
Hemorrhagic Fever ◽  
European Part ◽  
West Nile Fever ◽  
Hemorrhagic Fever Virus ◽  
Granulocytic Anaplasmosis ◽  
European Part Of Russia ◽  
Federal Districts ◽  
Human Monocytic Ehrlichiosis

The results of epizootological monitoring of the Southern European part of Russia (Southern and North- Caucasian Federal Districts), which has been tested for 18 nosological forms of natural focal infections are presented. There have been tested the laboratory studies of 45 615 samples of field material, the markers of pathogens of 15 nosological forms are identified. The circulation of Crimean-Congo hemorrhagic fever virus is identified in 10 subjects, the pathogen of tularemia – in eight regions, Lyme borreliosis – in seven, Q fever – in six; pathogens of hemorrhagic fever with renal syndrome, West Nile fever, leptospirosis and human granulocytic anaplasmosis – in five subjects. The markers of pathogens of human monocytic ehrlichiosis and tick-borne viral encephalitis were detected in four subjects, pseudotuberculosis and intestinal yersiniosis – in three and Arboviruses (Sindbis, Inkoо, Tahyna) – in one region.

Peronosporales of Skadovsky Zvenigorod Biological Station (Moscow Region)

2018 ◽  
Vol 52 (1) ◽  
pp. 91-100
Author(s):  
E. Yu. Blagoveshchenskaya
Keyword(s):  
Downy Mildew ◽  
European Part ◽  
Moscow Region ◽  
State University ◽  
Biological Station ◽  
Annotated List ◽  
European Part Of Russia ◽  
First Time ◽  
Moscow State University

The paper provides the results of seven-year study of downy mildew on Skadovsky Zvenigorod Biological Station of Moscow State University (ZBS MSU, Moscow Region). A total of 29 species of Peronosporales (Oomycota) were revealed during the study. An annotated list of species is presented, among them Peronospora anemones is recorded for the first time for Russia, P. chelidonii and P. stachydis are new for the European part of Russia, 8 species are new for the Moscow Region.

The first record of Jaapia ochroleuca (Basidiomycota) in the European part of Russia

2013 ◽  
Vol 47 ◽  
pp. 68-73
Author(s):  
S. V. Volobuev
Keyword(s):  
Nature Reserve ◽  
First Record ◽  
European Part ◽  
European Russia ◽  
Taxonomic Position ◽  
Morphological Description ◽  
Microscopic Structure ◽  
European Part Of Russia ◽  
Distribution And Ecology ◽  
First Time

The corticioid basidiomycete Jaapia ochroleuca (Bres.) Nannf. et J. Erikss. is recorded for the first time in the European Russia from the «Bryansky Les» Nature Reserve (Bryansk Region). The taxonomic position of the species is defined briefly. Its morphological description and data on distribution and ecology are provided. The details of microscopic structure of the collected specimen are illustrated.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

scholarly journals Epizootiological Monitoring of Natural Focal Infections in the South of the European Part of the Russian Federation in 2017

2019 ◽  
pp. 45-49
Author(s):  
N. F. Vasilenko ◽  
O. V. Maletskaya ◽  
D. A. Prislegina ◽  
E. A. Manin ◽  
O. V. Semenko ◽  
...  
Keyword(s):  
Russian Federation ◽  
Q Fever ◽  
Hemorrhagic Fever ◽  
European Part ◽  
The South ◽  
Hemorrhagic Fever Virus ◽  
Granulocytic Anaplasmosis ◽  
Control Research ◽  
The Russian Federation ◽  
Human Monocytic Ehrlichiosis

Objective– analysis of epizootiological manifestations of natural focal infections in the territory of the south of the European part of the Russian Federation in 2017.Materials and methods. Statistical documentation data from the Rospotrebnadzor Administrations, Centers of Hygiene and Epidemiology in the constituent entities of the Russian Federation, and Plague Control Research Institutes and Stations were used. The information was processed using Microsoft Excel 2010 software.Results and discussion. Epizootiological survey for 19 nosological forms of natural focal infections in the territory of the south of the European part of the Russian Federation was conducted. The total of 70155 samples of field material was tested; markers of 14 pathogens of natural focal infections were identified. The circulation of Crimean-Congo hemorrhagic fever virus was revealed in 11 constituent entities, tularemia and Lyme borreliosis pathogens – in 8 entities, West Nile virus – in 7. Markers of leptospirosis, Q fever, human granulocytic anaplasmosis and human monocytic ehrlichiosis pathogens were detected in 6 constituent entities, markers of the agent of hemorrhagic fever with renal syndrome – in 5 entities; markers of intestinal yersiniosis pathogen – in 3 constituent entities of the Russian Federation, pathogens of tick spotted fevers group, tick-borne viral encephalitis and pseudotuberculosis – in 2. The circulation of the virus Sindbis was identified in the Rostov Region. 

scholarly journals New records of water scavenger beetles Berosus geminus Reiche & Saulcy, 1856 (Coleoptera: Hydrophilidae) from Russia

2020 ◽  
Vol 6 ◽  
pp. 423-428
Author(s):  
Alexey S. Sazhnev
Keyword(s):  
New Records ◽  
European Part ◽  
General Distribution ◽  
European Part Of Russia ◽  
First Time

The species Berosus geminus Reiche & Saulcy, 1856 (Hydrophilidae) is recorded for the first time for European part of Russia. A map with the general distribution of this species is provided.

scholarly journals New and rare lichens and allied fungi from Arkhangelsk region, North-West Russia

2020 ◽  
Vol 57 ◽  
pp. 85-100
Author(s):  
Viktoria Tarasova ◽  
Liudmila Konoreva ◽  
Mikhail Zhurbenko ◽  
Tatiana Pystina ◽  
Sergei Chesnokov ◽  
...  
Keyword(s):  
Iucn Red List ◽  
Red List ◽  
European Part ◽  
North West ◽  
Red Data Book ◽  
Arkhangelsk Region ◽  
European Part Of Russia ◽  
Data Book ◽  
The Russian Federation ◽  
First Time

Thirty-one lichen-forming fungi, 12 lichenicolous fungi, and 5 non-lichenized fungi are reported as new for Arkhangelsk Region; 7 species are new for its mainland area. Micarea fallax is reported for the first time for Russia; M. laeta and M. pusilla are new for the European part of Russia. The second finding of Nicropuncta rugulosa for Russia is recorded; microconidia are first observed in this species. The records of ten species which have been included in the new edition of the Red Data Book of the Arkhangelsk Region (2020) are presented. Nephromopsis laureri from the Red Data Book of the Russian Federation (2008) and Leptogium rivulare from the IUCN Red List are reported for the first time for Arkhangelsk Region.

On some species of the genus Acrolocha Thomson, 1858 of the Western Palaearctic Region (Coleoptera: Staphylinidae: Omaliinae: Omaliini)

Zootaxa ◽  
2019 ◽  
Vol 4576 (2) ◽  
pp. 347
Author(s):  
ALEXEY V. SHAVRIN ◽  
EDUARD A. KHACHIKOV
Keyword(s):  
European Part ◽  
Palaearctic Region ◽  
Palaearctic Species ◽  
Central European ◽  
European Part Of Russia ◽  
Western Palaearctic ◽  
First Time

New taxonomic, morphological and faunistic data for three Western Palaearctic species of the genus Acrolocha Thomson, 1858 are provided. Acrolocha caucasica Tóth, 1976 is redescribed and illustrated. The lectotype for A. pliginskii Bernhauer, 1912 is designated. Acrolocha amabilis (Heer, 1841) is recorded from Central European part of Russia and Georgia for the first time. 

Sign in / Sign up

Export Citation Format

Share Document