scholarly journals Response of the Leek (Allium porrum)-Mycorrhizal Fungus Symbiosis to Cutting Levels, Light Exposure and Seedling Density

2021 ◽  
Vol 2 (3) ◽  
pp. 1-6
Author(s):  
G. Nowo Nekou ◽  
A.-M. Sontsa-Donhoung ◽  
. Hawaou ◽  
M. Bahdjolbe ◽  
R. Tobolbaï ◽  
...  
Keyword(s):  
Mycorrhizal Fungi ◽  
Light Exposure ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
The Other ◽  
Allium Porrum ◽  
Seedling Density ◽  
Positive Effects ◽  
Other Hand ◽  
The Impact

This work aims to assess the leek-arbuscular fungus symbiosis response to the effect of cutting and light exposure on the one hand, and the impact of seedling density on this symbiosis on the other hand. Allium Porrum was grown in a container in two different trials. Four species of arbuscular mycorrhizal fungi, Glomus hoi, Scutellospora gregaria, Rhizophagus intraradices and Gigaspora margarita were used to constitute the mycorrhizal inoculum. After 150 days of growth and inoculation, a series of cuts were made on the aerial part (0% = zero cut, 50% = half cut, 100% = whole cut). Plants that had undergone these treatments were placed in shade and sun for 30 days. The leek density per bag was varied by the order of 1, 2, 3 and 4 plant (s) by the pocket density test. Results showed that for 0% of cut in the shade, the vesicle occurrence decreases from 83.33% to 52.22%, and from 90% to 25.5% for 50% of cut in the shade. On the other hand, there is a significant increase in intra-root spores for a complete cut compared to other levels of cuts. For extra-root sporulation, under light, cuts have a negative and weak effect (from -11 to -3%) while in the absence of light, cuts have significant positive effects (from +16 to +61%). Regarding seedling density, the best root colonization (90%) and biomass production (14 g) are obtained with three plants per pot, but it is rather with a density of two plants per pot that extra-root sporulation is higher (153 spores/g). Variation in light, cut level and density significantly affects the development of mycorrhizal fungi.

Effectiveness and persistence of arbuscular mycorrhizal fungi on the physiology, nutrient uptake and yield of Crimson seedless grapevine

2014 ◽  
Vol 153 (6) ◽  
pp. 1084-1096 ◽  
Author(s):  
E. NICOLÁS ◽  
J. F. MAESTRE-VALERO ◽  
J. J. ALARCÓN ◽  
F. PEDRERO ◽  
J. VICENTE-SÁNCHEZ ◽  
...  
Keyword(s):  
Mycorrhizal Fungi ◽  
Water Status ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Photosynthetic Performance ◽  
Positive Effects ◽  
Periodic Monitoring ◽  
Use Efficiency ◽  
Second Year

SUMMARYIn the present study, carried out in South-eastern Spain, a commercial arbuscular mycorrhizal fungus (AMF;Glomus iranicumvar.tenuihypharumsp.nova) was introduced through drip irrigation to inoculate Crimson grapevines. Their effects on the physiological and nutritional activity were evaluated for 2 years (2011–12). Additionally, during the second year of experimentation, the persistence of mycorrhizae on the grapevine and their effects were innovatively analysed.The AMF satisfactorily colonized the Crimson grapevine roots, improved the plants water status, induced an improvement in the photosynthetic performance that increased the water use efficiency, promoted the uptake of phosphorus (P), potassium (K) and calcium (Ca) and led to a mobilization of starch reserves in the apex in winter, which was possibly responsible for enhancing root development. Moreover, inoculated plants had significantly increased yield and improved quality of grapes, which led to early grape maturation. Overall, the persistent effect of AMF during the second year produced similar positive effects, although to a lesser extent, to those obtained in the inoculated treatment.The results found in the present study show that this AMF application technique can be recommended for sustainable agriculture in arid and semi-arid areas. Moreover, as a result of the competition with the native mycorrhizae, periodic monitoring of the percentage of mycorrhizal colonization and re-inoculation in order to obtain all the positive effects evidenced in the inoculated treatment is recommended.

Impact of anthracene on the arbuscular mycorrhizal fungus lipid metabolism

Botany ◽  
2014 ◽  
Vol 92 (2) ◽  
pp. 173-178 ◽  
Author(s):  
M. Calonne ◽  
J. Fontaine ◽  
D. Debiane ◽  
F. Laruelle ◽  
A. Grandmougin-Ferjani ◽  
...  
Keyword(s):  
Lipid Metabolism ◽  
Mycorrhizal Fungi ◽  
Negative Impact ◽  
Anthropogenic Activities ◽  
Organic Pollutant ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Membrane Lipid ◽  
Acetate Incorporation ◽  
The Impact

Anthracene, a low-molecular-weight polycyclic aromatic hydrocarbon (PAH) originating mainly from anthropogenic activities, represents one of the major persistent organic pollutants frequently detected in polluted soils. A few studies have reported the negative effect of PAH on the main steps of the arbuscular mycorrhizal fungi (AMF) life cycle resulting from lipid peroxidation; however, little is known regarding the impact of anthracene on extraradical AMF lipid metabolism. Radiolabelling experiments showed significant decreases of [1-14C]acetate incorporation into the sterol precursors (4,4-dimethylsterols and 4α-methylsterols) and in the total phospholipids (PL) of Rhizophagus irregularis (Blaszk., Wubet, Renker & Buscot) extraradical mycelium when grown in the presence of anthracene. These findings suggested a slowing down of the sterol and total PL biosynthesis pathways in AMF treated with anthracene. The negative impact of the organic pollutant on AMF membrane lipid biosynthesis may explain the growth inhibition of the fungus after PAH exposure. This study increases the understanding of the biochemical mechanisms involved in PAH ecotoxicity on AMF.

scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

scholarly journals “The Show Must Go On”. Ethnography of the Art Market Facing the COVID-19 Pandemic

Arts ◽  
2021 ◽  
Vol 10 (3) ◽  
pp. 53
Author(s):  
Léa Saint-Raymond
Keyword(s):  
Graduate Students ◽  
Art Market ◽  
The Other ◽  
Physical Contact ◽  
Commercial Activity ◽  
Positive Effects ◽  
Other Hand ◽  
Long Run ◽  
The One ◽  
The Impact

This paper aims at understanding, from the inside, the impact of the COVID-19 pandemic and the accompanying restrictive administrative measures on the art market. It is based on the interviews and ethnographic surveys made by graduate students from the Ecole du Louvre, from September 2020 to May 2021. This methodology makes it possible to demonstrate that, during the crisis, art market professionals were driven by the motto “the show must go on”. On the one hand, they wished to keep a straight face and remain silent on their individual difficulties, preferring to talk about their vocation and the positive effects of the crisis. On the other hand, the commercial activity continued despite everything; if the pandemic accelerated the digital turn of the art market, the physical contact with the works and the collectors remained primordial. The art market thus remained physical but accelerated its digital turn. The proportion of each interactional framework—physical and digital—is still uncertain, difficult to measure today and to predict in the long run.

scholarly journals Ancient lineages of arbuscular mycorrhizal fungi provide little plant benefit

Mycorrhiza ◽  
2021 ◽  
Author(s):  
Verena Säle ◽  
Javier Palenzuela ◽  
Concepción Azcón-Aguilar ◽  
Iván Sánchez-Castro ◽  
Gladstone Alves da Silva ◽  
...  
Keyword(s):  
Plant Growth ◽  
Arbuscular Mycorrhizal Fungi ◽  
Nutrient Uptake ◽  
Mycorrhizal Fungi ◽  
Growth Promotion ◽  
Arbuscular Mycorrhizal ◽  
Allium Porrum ◽  
Sand Mixture ◽  
Wide Range ◽  
The Impact

AbstractAlmost all land plants form symbiotic associations with arbuscular mycorrhizal fungi (AMF). Individual plants usually are colonized by a wide range of phylogenetically diverse AMF species. The impact that different AMF taxa have on plant growth is only partly understood. We screened 44 AMF isolates for their effect on growth promotion and nutrient uptake of leek plants (Allium porrum), including isolates that have not been tested previously. In particular, we aimed to test weather AMF lineages with an ancient evolutionary age differ from relatively recent lineages in their effects on leek plants. The AMF isolates that were tested covered 18 species from all five AMF orders, eight families, and 13 genera. The experiment was conducted in a greenhouse. A soil–sand mixture was used as substrate for the leek plants. Plant growth response to inoculation with AMF varied from − 19 to 232% and depended on isolate, species, and family identity. Species from the ancient families Archaeosporaceae and Paraglomeraceae tended to be less beneficial, in terms of stimulation plant growth and nutrient uptake, than species of Glomeraceae, Entrophosporaceae, and Diversisporaceae, which are considered phylogenetically more recent than those ancient families. Root colonization levels also depended on AMF family. This study indicates that plant benefit in the symbiosis between plants and AMF is linked to fungal identity and phylogeny and it shows that there are large differences in effectiveness of different AMF.

SCENARIOS FOR AN EXPANDING DEMAND OF TOURISM ON THE COASTS OF CUBA

2017 ◽  
Author(s):  
Oscar Gutiérrez-Bolívar ◽  
Oscar Gutiérrez-Bolívar ◽  
Pedro Fernández Carrasco ◽  
Pedro Fernández Carrasco
Keyword(s):  
United States ◽  
The Other ◽  
Sudden Increase ◽  
Tourist Destination ◽  
Other Hand ◽  
The Usa ◽  
The Impact

The opening of relationships between United States and Cuba could be a drive for a huge increase in the affluence of tourism to Cuba and especially to the coast areas. Cuba has been for many years an important tourist destination for people from many countries, but almost forbidden for US citizens. The proximity of the USA, its amount of population as well as their great acquisition power will increase in a very substantial way the demand for accommodation and other uses in the proximity of the coasts. There will be a need to implement a package of measures that reduce the impact of such sudden increase in the coastal line. On the other hand that augment in tourism could be an opportunity to improve the standard of life of Cubans. The consideration of different possibilities of such development, the analysis of the damages that each one could cause as well as the measures that could avoid, ameliorate or compensate such effects are the goals that are going to be presented in this paper.

Laughter on the Fringes

2019 ◽  
Author(s):  
Anna Peterson
Keyword(s):  
The Other ◽  
Literary Canon ◽  
Autobiographical Writing ◽  
Treasure Trove ◽  
Old Comedy ◽  
Other Hand ◽  
Aggressive Humor ◽  
The One ◽  
The Individual ◽  
The Impact

This book examines the impact that Athenian Old Comedy had on Greek writers of the Imperial era. It is generally acknowledged that Imperial-era Greeks responded to Athenian Old Comedy in one of two ways: either as a treasure trove of Atticisms, or as a genre defined by and repudiated for its aggressive humor. Worthy of further consideration, however, is how both approaches, and particularly the latter one that relegated Old Comedy to the fringes of the literary canon, led authors to engage with the ironic and self-reflexive humor of Aristophanes, Eupolis, and Cratinus. Authors ranging from serious moralizers (Plutarch and Aelius Aristides) to comic writers in their own right (Lucian, Alciphron), to other figures not often associated with Old Comedy (Libanius) adopted aspects of the genre to negotiate power struggles, facilitate literary and sophistic rivalries, and provide a model for autobiographical writing. To varying degrees, these writers wove recognizable features of the genre (e.g., the parabasis, its agonistic language, the stage biographies of the individual poets) into their writings. The image of Old Comedy that emerges from this time is that of a genre in transition. It was, on the one hand, with the exception of Aristophanes’s extant plays, on the verge of being almost completely lost; on the other hand, its reputation and several of its most characteristic elements were being renegotiated and reinvented.

scholarly journals The methylome of the model arbuscular mycorrhizal fungus, Rhizophagus irregularis, shares characteristics with early diverging fungi and Dikarya

2021 ◽  
Vol 4 (1) ◽  
Author(s):  
Anurag Chaturvedi ◽  
Joaquim Cruz Corella ◽  
Chanz Robbins ◽  
Anita Loha ◽  
Laure Menin ◽  
...  
Keyword(s):  
Arbuscular Mycorrhizal Fungi ◽  
Plant Species ◽  
Mycorrhizal Fungi ◽  
Arbuscular Mycorrhizal Fungus ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Rhizophagus Irregularis ◽  
Functional Differences ◽  
Phosphate Regulation ◽  
Very High

AbstractEarly-diverging fungi (EDF) are distinct from Dikarya and other eukaryotes, exhibiting high N6-methyldeoxyadenine (6mA) contents, rather than 5-methylcytosine (5mC). As plants transitioned to land the EDF sub-phylum, arbuscular mycorrhizal fungi (AMF; Glomeromycotina) evolved a symbiotic lifestyle with 80% of plant species worldwide. Here we show that these fungi exhibit 5mC and 6mA methylation characteristics that jointly set them apart from other fungi. The model AMF, R. irregularis, evolved very high levels of 5mC and greatly reduced levels of 6mA. However, unlike the Dikarya, 6mA in AMF occurs at symmetrical ApT motifs in genes and is associated with their transcription. 6mA is heterogeneously distributed among nuclei in these coenocytic fungi suggesting functional differences among nuclei. While far fewer genes are regulated by 6mA in the AMF genome than in EDF, most strikingly, 6mA methylation has been specifically retained in genes implicated in components of phosphate regulation; the quintessential hallmark defining this globally important symbiosis.

scholarly journals Application of Plant Extracts in Micropropagation and Cryopreservation of Bleeding Heart: An Ornamental-Medicinal Plant Species

Agriculture ◽  
2021 ◽  
Vol 11 (6) ◽  
pp. 542
Author(s):  
Dariusz Kulus ◽  
Natalia Miler
Keyword(s):  
Tissue Culture ◽  
Plant Growth ◽  
Plant Growth Regulators ◽  
Growth Regulators ◽  
Plant Extracts ◽  
The Other ◽  
White Gold ◽  
Natural Extracts ◽  
Other Hand ◽  
The Impact

Lamprocapnos spectabilis (L.) Fukuhara (bleeding heart) is valued both in the horticultural and pharmaceutical markets. Despite its great popularity, information on the in vitro tissue culture technology in this species is limited. There is also little knowledge on the application of plant extracts in the tissue culture systems of plants other than orchids. The aim of this study is to compare the utility of traditional plant growth regulators (PGRs) and natural extracts—obtained from the coconut shreds, as well as oat, rice, and sesame seeds—in the micropropagation and cryopreservation of L. spectabilis ‘Gold Heart’ and ‘White Gold’. The biochemical analysis of extracts composition is also included. In the first experiment related to micropropagation via axillary buds activation, the single-node explants were cultured for a 10-week-long propagation cycle in the modified Murashige and Skoog medium fortified either with 1.11 µM benzyladenine (BA) and 1.23 µM indole-3-butritic acid (IBA) or with 10% (v/v) plant extracts. A PGRs- and extract-free control was also considered. In the cryopreservation experiment, the same 10% (v/v) extracts were added into the medium during a seven-day preculture in the encapsulation-vitrification cryopreservation protocol. It was found that the impact of natural additives was cultivar- and trait-specific. In the first experiment, the addition of coconut extract favoured the proliferation of shoots and propagation ratio in bleeding heart ‘Gold Heart’. Rice extract, on the other hand, promoted callus formation in ‘White Gold’ cultivar and was more effective in increasing the propagation ratio in this cultivar than the conventional plant growth regulators (4.1 and 2.6, respectively). Sesame extract suppressed the development of the explants in both cultivars analysed, probably due to the high content of polyphenols. As for the second experiment, the addition of plant extracts into the preculture medium did not increase the survival level of the cryopreserved shoot tips (sesame and oat extracts even decreased this parameter). On the other hand, coconut extract, abundant in simple sugars and endogenous cytokinins, stimulated a more intensive proliferation and growth of shoots after rewarming of samples. Analysing the synergistic effect of conventional plant growth regulators and natural extracts should be considered in future studies related to L. spectabilis.

Education and Learning at a Medieval English Cathedral: Exeter 1380–1548

1981 ◽  
Vol 32 (3) ◽  
pp. 265-283 ◽  
Author(s):  
Nicholas Orme
Keyword(s):  
Sixteenth Century ◽  
Good Deal ◽  
The Other ◽  
Educational Institutions ◽  
Medieval England ◽  
Literary Education ◽  
Other Hand ◽  
The People ◽  
The Impact

During the last hundred years our knowledge of the educational institutions of medieval England has steadily increased, both of schools and universities. We know a good deal about what they taught, how they were organised and where they were sited. The next stage is to identify their relationship with the society which they existed to serve. Whom did they train, to what standards and for what ends? These questions pose problems. They cannot be answered from the constitutional and curricular records which tell us about the structure of educational institutions. Instead, they require a knowledge of the people—the pupils and scholars—who went to the medieval schools and universities. We need to recover their names, to compile their biographies and thereby to establish their origins, careers and attainments. If this can be done on a large enough scale, the impact of education on society will become clearer. In the case of the universities, the materials for this task are available and well known. Thanks to the late Dr A. B. Emden, most of the surviving names of the alumni of Oxford and Cambridge have been collected and published, together with a great many biographical records about them. For the schools, on the other hand, where most boys had their literary education if they had one at all, such data are not available. Except for Winchester and Eton, we do not possess lists of the pupils of schools until the middle of the sixteenth century, and there is no way to remedy the deficiency.

Sign in / Sign up

Export Citation Format

Share Document