scholarly journals Antifungal Activity and Phytochemical Screening of Vernonia amygdalina Extract against Botrytis cinerea Causing Gray Mold Disease on Tomato Fruits

Biology ◽  
2020 ◽  
Vol 9 (9) ◽  
pp. 286 ◽  
Author(s):  
Siti Fairuz Yusoff ◽  
Farah Farhanah Haron ◽  
Mahmud Tengku Muda Mohamed ◽  
Norhayu Asib ◽  
Siti Zaharah Sakimin ◽  
...  
Keyword(s):  
Antifungal Activity ◽  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Tomato Fruit ◽  
Gray Mold ◽  
Postharvest Disease ◽  
Limiting Factor ◽  
Vernonia Amygdalina ◽  
Antifungal Activities ◽  
Crude Extracts

Gray mold disease caused by Botrytis cinerea is a damaging postharvest disease in tomato plants, and it is known to be a limiting factor in tomato production. This study aimed to evaluate antifungal activities of Vernonia amygdalina leaf extracts against B. cinerea and to screen the phytochemical compound in the crude extract that had the highest antifungal activity. In this study, crude extracts of hexane, dichloromethane, methanol, and water extracts with concentration levels at 100, 200, 300, 400, and 500 mg/mL were shown to significantly affect the inhibition of B. cinerea. Among the crude extracts, dichloromethane extract was shown to be the most potent in terms of antifungal activities. The SEM observation proved that the treatment altered the fungal morphology, which leads to fungal growth inhibition. For the in vivo bioassay, the fruits treated with dichloromethane extract at 400 and 500 mg/mL showed the lowest disease incidence with mild severity of infection. There were 23 chemical compounds identified in V. amygdalina dichloromethane extract using GCMS analysis. The top five major compounds were dominated by squalene (16.92%), phytol (15.05%), triacontane (11.31%), heptacosane (7.14%), and neophytadiene (6.28%). Some of these significant compounds possess high antifungal activities. This study proved that V. amygdalina from dichloromethane extract could be useful for inhibiting gray mold disease on tomato fruit and has potential as a natural antifungal agent.

scholarly journals Development of Vernonia amygdalina Leaf Extract Emulsion Formulations in Controlling Gray Mold Disease on Tomato (Lycopersicon esculentum Mill.)

Agronomy ◽  
2021 ◽  
Vol 11 (2) ◽  
pp. 373
Author(s):  
Siti Fairuz Yusoff ◽  
Farah Farhanah Haron ◽  
Norhayu Asib ◽  
Mahmud Tengku Muda Mohamed ◽  
Siti Izera Ismail
Keyword(s):  
Antifungal Activity ◽  
Leaf Extract ◽  
Fungicidal Activity ◽  
Disease Incidence ◽  
Gray Mold ◽  
Positive Control ◽  
Economic Losses ◽  
Vernonia Amygdalina ◽  
Emulsion Formulation

Postharvest fruits including tomatoes are commonly infected by gray mold disease resulting in significant economic losses in the fruit industry. Therefore, this study aimed to develop botanical fungicide derived from Vernonia amygdalina leaf extract to control gray mold on tomato. The emulsion formulation containing surfactant, oil carrier and water was optimized at different non-ionic alkyl polyglucoside surfactants through eleven combinations of oil to surfactant ratio (0:10, 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, 9:1 and 10:0 w/w). From eight selected formulations, two formulations, F5 and F7 showed stable in storage, remarkable thermodynamic stability, smaller particle size (66.44 and 139.63 nm), highly stable in zeta potential (−32.70 and −31.70 mV), low in polydispersity index (0.41 and 0.40 PdI), low in viscosity (4.20 and 4.37 cP) and low in surface tension (27.62 and 26.41 mN/m) as compared to other formulations. In situ antifungal activity on tomato fruits showed F5 formulation had a fungicidal activity against B. cinerea with zero disease incidence and severity, whereas F7 formulation reduced 62.5% disease incidence compared to a positive control with scale 1. Based on these findings, F5 formulation exhibited pronounced antifungal activity and may contribute to the development of new and safe antifungal product against gray mold on tomato.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals The anti-acetylcholinesterase, insecticidal and antifungal activities of the entophytic fungus Trichoderma sp. isolated from Ricinus communis L. against Locusta migratoria L. and Botrytis cinerea Pers.: Fr.

2020 ◽  
Vol 7 (1) ◽  
pp. 112-125
Author(s):  
Djamel Eddine Laib ◽  
Abdelmadjid Benzara ◽  
Salah Akkal ◽  
Chawki Bensouici
Keyword(s):  
Antifungal Activity ◽  
Botrytis Cinerea ◽  
Endophytic Fungus ◽  
Ricinus Communis ◽  
Locusta Migratoria ◽  
Inhibition Rate ◽  
Antifungal Activities ◽  
Fungal Extract ◽  
Ricinus Communis L ◽  
Trichoderma Sp

AbstractThis study was conducted to evaluate anti-acetylcholinesterase and insecticidal and antifungal activities of the endophytic fungus Trichoderma sp, isolated from Ricinus communis L. leaves, against Locusta migratoria L. and Botrytis cinerea Pers.: Fr.. To evaluate the insecticidal and antifungal activities, different concentrations of the fungal extract were applied against L. migratoria (0.2, 0.3, 0.4 g/l) and against B. cinerea (1, 2, 3 g/l). It was found that the mortality of the targeted insects was positively proportional to fungal extract concentration and time after exposure (24, 48, 72 hours). The concentration 0.4 g/l appeared to be the most effective after 72 hours with mortality rate of 56.52%. Regarding antifungal activity, the concentration 3 g/l was the most effective against B. cinerea after 7 days, with an inhibition rate of 92.06% (excellent antifungal activity). Moreover, it was found that at 4 ug/ml the fungal extract had a maximum inhibitory capacity of Ache of 80% for acetylcholenesterase. Preliminary phytochemical analyses revealed the presence of alkaloids, flavonoids, phenols and saponins. In addition the colony of this endophytic fungus produced chitinases and proteases, which explained its important antifungal and insecticidal activities.

Streptomyces botrytidirepellens sp. nov., a novel actinomycete with antifungal activity against Botrytis cinerea

2021 ◽  
Vol 71 (9) ◽  
Author(s):  
Mengqi Jiang ◽  
Xi Xu ◽  
Jia Song ◽  
Dongmei Li ◽  
Liyuan Han ◽  
...  
Keyword(s):  
Antifungal Activity ◽  
Botrytis Cinerea ◽  
Gene Clusters ◽  
Gray Mold ◽  
Phytopathogenic Fungi ◽  
Antagonistic Effect ◽  
Economic Losses ◽  
Content Type ◽  
Desferrioxamine B ◽  
Cell Free Filtrate

The fungal pathogen Botrytis cinerea is the causal agent of devastating gray mold diseases in many economically important fruits, vegetables, and flowers, leading to serious economic losses worldwide. In this study, a novel actinomycete NEAU-LD23T exhibiting antifungal activity against B. cinerea was isolated, and its taxonomic position was evaluated using a polyphasic approach. Based on the genotypic, phenotypic and chemotaxonomic data, it is concluded that the strain represents a novel species within the genus Streptomyces , for which the name Streptomyces botrytidirepellens sp. nov. is proposed. The type strain is NEAU-LD23T (=CCTCC AA 2019029T=DSM 109824T). In addition, strain NEAU-LD23T showed a strong antagonistic effect against B. cinerea (82.6±2.5%) and varying degrees of inhibition on nine other phytopathogenic fungi. Both cell-free filtrate and methanol extract of mycelia of strain NEAU-LD23T significantly inhibited mycelial growth of B. cinerea. To preliminarily explore the antifungal mechanisms, the genome of strain NEAU-LD23T was sequenced and analyzed. AntiSMASH analysis led to the identification of several gene clusters responsible for the biosynthesis of bioactive secondary metabolites with antifungal activity, including 9-methylstreptimidone, echosides, anisomycin, coelichelin and desferrioxamine B. Overall, this research provided us an excellent strain with considerable potential to use for biological control of tomato gray mold.

scholarly journals Characterization of Botrytis cinerea From Commercial Cut Flower Roses

Plant Disease ◽  
2019 ◽  
Vol 103 (7) ◽  
pp. 1577-1583 ◽  
Author(s):  
M. Muñoz ◽  
J. E. Faust ◽  
G. Schnabel
Keyword(s):  
Botrytis Cinerea ◽  
Fungicide Resistance ◽  
Management Practices ◽  
Cultural Practices ◽  
Disease Incidence ◽  
Resistance Management ◽  
Gray Mold ◽  
Economic Losses ◽  
Cut Flower ◽  
Aspergillus Brasiliensis

Botrytis cinerea Pers. infects cut flower roses (Rosa × hybrida L.) during greenhouse production and gray mold symptoms are often expressed in the postharvest environment, resulting in significant economic losses. Disease management is based on cultural practices and preventative chemical treatments; however, gray mold outbreaks continue to occur. Rose tissues from six commercial shipments from two greenhouses in Colombia were evaluated to determine the Botrytis species composition as well as identify other pathogens present, gray mold incidence and severity, and fungicide resistance profiles. Botrytis isolates (49 total) were grouped into six morphological phenotypes, and all were identified to be B. cinerea sensu stricto. Disease incidence was higher in the petals than in the stem, stamen, ovary, sepal, or leaf tissues. Other fungi were isolated infrequently and included Alternaria alternata, Cladosporium cladosporioides, Epicoccum nigrum, Penicillium citrinum, Aspergillus brasiliensis, and Diplodia sp. Fungicide resistance profiles were determined using previously established discriminatory doses. Isolates resistant to thiophanate-methyl, iprodione, boscalid, and cyprodinil were found frequently in all shipments and in both greenhouses. The frequency of resistance to penthiopyrad, fenhexamid, fluopyram, isofetamid, and fludioxonil varied between shipments and greenhouses. No resistance to pydiflumetofen was observed at the discriminatory doses tested. Isolates with resistance to multiple chemical classes were commonly found. These results indicate that fungicide resistance management practices may improve preharvest and postharvest gray mold control of cut flower roses.

scholarly journals Application of Plant Extracts to Control Postharvest Gray Mold and Susceptibility of Apple Fruits to B. cinerea from Different Plant Hosts

Foods ◽  
2020 ◽  
Vol 9 (10) ◽  
pp. 1430 ◽  
Author(s):  
Lina Šernaitė ◽  
Neringa Rasiukevičiūtė ◽  
Alma Valiuškaitė
Keyword(s):  
Antifungal Activity ◽  
Fungal Pathogens ◽  
Plant Protection ◽  
Gray Mold ◽  
Postharvest Disease ◽  
Cinnamon Extract ◽  
Wide Range ◽  
Plant Hosts ◽  
Apple Fruits

Sustainable plant protection can be applied on apples against fungal pathogens such as Botrytis cinerea (which is responsible for gray mold)—a significant global postharvest disease. This pathogen can affect a wide range of hosts; and fruits may have variable susceptibilities to B. cinerea from different plant hosts. New possibilities to control gray mold in food production are under demand due to the emergence of resistance against antifungal agents in fungal pathogens. Cinnamon, pimento, and laurel extracts were previously assessed for antifungal activities under in vitro conditions and were found to have the potential to be effective against postharvest gray mold. Therefore, this study aimed to investigate the antifungal activity of cinnamon, pimento, and laurel extracts in vitro and against postharvest gray mold on apples to determine the susceptibility of apple fruits to B. cinerea from different plant hosts, and to analyze the chemical composition of the extracts. Apples (cv. “Connell Red”) were treated with different concentrations of extracts and inoculated with B. cinerea isolates from apple and strawberry followed by evaluation of in vitro antifungal activity. The results reveal that most of the concentrations of the extracts that were investigated were not efficient enough when assessed in the postharvest assay, despite having demonstrated a high in vitro antifungal effect. Apples were less susceptible to B. cinerea isolated from strawberry. To conclude, cinnamon extract was found to be the most effective against apple gray mold; however, higher concentrations of the extracts are required for the efficient inhibition of B. cinerea in fruits during storage.

scholarly journals Characterization of Botrytis cinerea Isolates from Strawberry with Reduced Sensitivity to Polyoxin D Zinc Salt

Plant Disease ◽  
2016 ◽  
Vol 100 (10) ◽  
pp. 2057-2061 ◽  
Author(s):  
Madeline E. Dowling ◽  
Meng-Jun Hu ◽  
Linus T. Schmitz ◽  
Jennifer R. Wilson ◽  
Guido Schnabel
Keyword(s):  
United States ◽  
South Carolina ◽  
Botrytis Cinerea ◽  
Tomato Fruit ◽  
Resistance Management ◽  
The United States ◽  
Gray Mold ◽  
Zinc Salt ◽  
Malt Extract ◽  
Action Committee

Polyoxin D is a Fungicide Resistance Action Committee (FRAC) code 19 fungicide that was recently registered for gray mold control of strawberry in the United States. In this study, we determined the sensitivity to polyoxin D zinc salt (hereafter, polyoxin D) of Botrytis cinerea isolates from 41 commercial strawberry farms in South Carolina, North Carolina, Maryland, Virginia, and Ohio and investigated the fitness of sensitive (S) and reduced sensitive (RS) isolates. Relative mycelial growth ranged between 0 and over 100% on malt extract agar amended with a discriminatory dose of polyoxin D at 5 μg/ml. Isolates that grew more than 70% at that dose were designated RS and were found in three of the five states. The 50% effective dose (EC50) values of three S and three RS isolates ranged from 0.59 to 2.27 and 4.6 to 5.8 μg/ml, respectively. The three RS isolates grew faster on detached tomato fruit treated with Ph-D WDG at recommended label dosage than S isolates (P < 0.008). In all, 25 randomly selected RS isolates exhibited reduced sporulation ability (P < 0.0001) and growth rate (P < 0.0001) but increased production of sclerotia (P < 0.0386) compared with 25 S isolates. Of 10 isolates tested per phenotype, the number of RS isolates producing sporulating lesions on apple, tomato, and strawberry was significantly lower compared with S isolates (P < 0.0001 for each fruit type). The results of this study indicate that resistance management is necessary for fungicides containing polyoxin D. To our knowledge, this is the first study demonstrating reduced sensitivity to FRAC 19 fungicides in B. cinerea isolates from the United States.

scholarly journals Effects of Origanum vulgare essential oil and its two main components, carvacrol and thymol, on the plant pathogen Botrytis cinerea

PeerJ ◽  
2020 ◽  
Vol 8 ◽  
pp. e9626
Author(s):  
Huiyu Hou ◽  
Xueying Zhang ◽  
Te Zhao ◽  
Lin Zhou
Keyword(s):  
Antifungal Activity ◽  
Essential Oil ◽  
Botrytis Cinerea ◽  
Spore Germination ◽  
Gray Mold ◽  
Origanum Vulgare ◽  
Mycelium Growth ◽  
Main Components

Background Botrytis cinerea causes serious gray mold disease in many plants. This pathogen has developed resistance to many fungicides. Thus, it has become necessary to look for new safe yet effective compounds against B. cinerea. Methods Essential oils (EOs) from 17 plant species were assayed against B. cinerea, of which Origanum vulgare essential oil (OVEO) showed strong antifungal activity, and accordingly its main components were detected by GC/MS. Further study was conducted on the effects of OVEO, carvacrol and thymol in vitro on mycelium growth and spore germination, mycelium morphology, leakages of cytoplasmic contents, mitochondrial injury and accumulation of reactive oxygen species (ROS) of B. cinerea. The control efficacies of OVEO, carvacrol and thymol on tomato gray mold were evaluated in vivo. Results Of all the 17 plant EOs tested, Cinnamomum cassia, Litsea cubeba var. formosana and O. vulgare EOs had the best inhibitory effect on B. cinerea, with 0.5 mg/mL completely inhibiting the mycelium growth of B. cinerea. Twenty-one different compounds of OVEO were identified by gas chromatography–mass spectrometry, and the main chemical components were carvacrol (89.98%), β-caryophyllene (3.34%), thymol (2.39%), α-humulene (1.38%) and 1-methyl-2-propan-2-ylbenzene isopropyl benzene (1.36%). In vitro experiment showed EC50 values of OVEO, carvacrol and thymol were 140.04, 9.09 and 21.32 μg/mL, respectively. Carvacrol and thymol completely inhibited the spore germination of B. cinerea at the concentration of 300 μg/mL while the inhibition rate of OVEO was 80.03%. EC50 of carvacrol and thymol have significantly (P < 0.05) reduced the fresh and dry weight of mycelia. The collapse and damage on B. cinerea mycelia treated with 40 μg/mL of carvacrol and thymol was examined by scanning electron microscope (SEM). Through extracellular conductivity test and fluorescence microscope observation, it was found that carvacrol and thymol led to increase the permeability of target cells, the destruction of mitochondrial membrane and ROS accumulation. In vivo conditions, 1000 μg/mL carvacrol had the best protective and therapeutic effects on tomato gray mold (77.98% and 28.04%, respectively), and the protective effect was significantly higher than that of 400 μg/mL pyrimethanil (43.15%). While the therapeutic and protective effects of 1,000 μg/mL OVEO and thymol were comparable to chemical control. Conclusions OVEO showed moderate antifungal activity, whereas its main components carvacrol and thymol have great application potential as natural fungicides or lead compounds for commercial fungicides in preventing and controlling plant diseases caused by B. cinerea.

scholarly journals First Report of Botrytis Blight of Peanut Caused by Botrytis cinerea in Georgia

Plant Disease ◽  
2005 ◽  
Vol 89 (8) ◽  
pp. 910-910 ◽  
Author(s):  
J. E. Woodward ◽  
T. B. Brenneman ◽  
R. C. Kemerait ◽  
A. K. Culbreath ◽  
J. R. Clark
Keyword(s):  
Botrytis Cinerea ◽  
Disease Incidence ◽  
Block Design ◽  
Gray Mold ◽  
American Phytopathological Society ◽  
Breeding Programs ◽  
First Report ◽  
Tomato Spotted Wilt ◽  
Arachis Hypogaea L ◽  
Wilt Virus

Because of the importance of spotted wilt caused by Tomato spotted wilt virus (TSWV), most peanut (Arachis hypogaea L.) breeding programs in the southeastern United States are focusing on developing resistance to TSWV. Many of the cultivars with improved resistance to TSWV are late maturing, requiring 150 days to reach optimum maturity. This factor could greatly impact disease problems at harvest. During November of 2004, an unknown disease was observed on peanut cvs. Georgia 02-C and Hull in a commercial field in Appling County. Symptoms included wilting stems with water-soaked lesions and a dense, gray mold growing on infected tissues. Final disease incidence was less than 5%. For isolation, diseased tissue was surface sterilized by soaking in 0.5% sodium hypochlorite for 1 min, air dried, plated on potato dextrose agar (PDA), and incubated at 20°C. Botrytis cinerea Pers.:Fr., causal agent of Botrytis blight, was isolated from the margins of infected tissue. Mycelia were initially white but became gray after 72 h at which time tall, branched, septate conidiophores formed. Mature, unicellular, ellipsoid, hyaline conidia (8.9 × 10.4 μm) formed in botryose heads (1). Hard, black, irregular-shaped sclerotia formed after 2 weeks. Stems of greenhouse-grown peanut plants (cv. Georgia Green) were inoculated with PDA plugs colonized with either B. cinerea or B. allii Munn. Inoculations were made 3 cm below the last fully expanded leaf on wounded and nonwounded tissue. Noncolonized PDA plugs served as controls (n = 9). Plants were arranged in a dew chamber at 20°C in a randomized complete block design. Lesions and spore masses identical to those observed in the field appeared 3 to 5 days after being inoculated with B. cinerea. The B. allii inoculations caused only superficial lesions. After 5 days, mean lesion lengths for B. cinerea were 59 and 37 mm for wounded and nonwounded inoculations, respectively. B. cinerea was recovered from 100% of the symptomatic tissues. Botrytis blight is considered a late-season disease that occurs in cool, wet weather (3). Symptoms similar to those of Botrytis blight were observed on mature and over-mature peanut in Georgia and have been cited as “unpublished observations” (2); however, to our knowledge, this is the first report of the disease in Georgia. Although Botrytis blight is not considered a major peanut disease, it may become more prevalent at harvest as producers utilize late-maturing cultivars to manage spotted wilt. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Guide of Imperfect Fungi. 4th ed. The American Phytopathological Society, St. Paul, MN, 1998. (2) K. H. Garren and C. Wilson. Peanut Diseases. Pages 262–333 in: The Peanut, the Unpredictable Legume. The National Fertilizer Assoc. Washington D.C. 1951. (3) D. M. Porter. Botrytis blight. Pages 10–11 in: Compendium of Peanut Diseases. 2nd ed. N. Kokalis-Burelle et al., eds. The American Phytopathological Society, St. Paul, MN. 1997.

Sign in / Sign up

Export Citation Format

Share Document