scholarly journals Computational Tools and Resources Supporting CRISPR-Cas Experiments

Cells ◽  
2020 ◽  
Vol 9 (5) ◽  
pp. 1288 ◽  
Author(s):  
Pawel Sledzinski ◽  
Mateusz Nowaczyk ◽  
Marta Olejniczak
Keyword(s):  
Genome Engineering ◽  
Rapid Development ◽  
Dna Modification ◽  
Sequencing Data ◽  
Computational Tools ◽  
Guide Rna ◽  
The Third ◽  
Cas9 Nuclease ◽  
Result Analysis ◽  
Rna Design

The CRISPR-Cas system has become a cutting-edge technology that revolutionized genome engineering. The use of Cas9 nuclease is currently the method of choice in most tasks requiring a specific DNA modification. The rapid development in the field of CRISPR-Cas is reflected by the constantly expanding ecosystem of computational tools aimed at facilitating experimental design and result analysis. The first group of CRISPR-Cas-related tools that we review is dedicated to aid in guide RNA design by prediction of their efficiency and specificity. The second, relatively new group of tools exploits the observed biases in repair outcomes to predict the results of CRISPR-Cas edits. The third class of tools is developed to assist in the evaluation of the editing outcomes by analysis of the sequencing data. These utilities are accompanied by relevant repositories and databases. Here we present a comprehensive and updated overview of the currently available CRISPR-Cas-related tools, from the perspective of a user who needs a convenient and reliable means to facilitate genome editing experiments at every step, from the guide RNA design to analysis of editing outcomes. Moreover, we discuss the current limitations and challenges that the field must overcome for further improvement in the CRISPR-Cas endeavor.

scholarly journals A comparative analysis of computational tools for the prediction of epigenetic DNA methylation from long-read sequencing data

2021 ◽  
Author(s):  
Shruta Sandesh Pai ◽  
Aimee Rachel Mathew ◽  
Roy Anindya
Keyword(s):  
Dna Methylation ◽  
Dna Modification ◽  
Nanopore Sequencing ◽  
Sequencing Data ◽  
Computational Tools ◽  
Specific Location ◽  
Oxford Nanopore ◽  
Long Read ◽  
Dna Methylations ◽  
Higher Eukaryotes

AbstractRecent development of Oxford Nanopore long-read sequencing has opened new avenues of identifying epigenetic DNA methylation. Among the different epigenetic DNA methylations, N6-methyladenosine is the most prevalent DNA modification in prokaryotes and 5-methylcytosine is common in higher eukaryotes. Here we investigated if N6-methyladenosine and 5-methylcytosine modifications could be predicted from the nanopore sequencing data. Using publicly available genome sequencing data of Saccharomyces cerevisiae, we compared the open-access computational tools, including Tombo, mCaller, Nanopolish and DeepSignal for predicting 6mA and 5mC. Our results suggest that Tombo and mCaller can predict DNA N6-methyladenosine modifications at a specific location, whereas, Tombo dampened fraction, Nanopolish methylation likelihood and DeepSignal methylation probability have comparable efficiency for 5-methylcytosine prediction from Oxford Nanopore sequencing data.

scholarly journals Multiplexed and Inducible Gene Modulation in Human Pluripotent Stem Cells by CRISPR Interference and Activation

2019 ◽  
Author(s):  
Dane Z. Hazelbaker ◽  
Amanda Beccard ◽  
Patrizia Mazzucato ◽  
Gabriella Angelini ◽  
Angelica Messana ◽  
...  
Keyword(s):  
Stem Cells ◽  
Pluripotent Stem Cells ◽  
Genome Engineering ◽  
Human Pluripotent Stem Cells ◽  
Guide Rna ◽  
Genome Wide ◽  
Cas9 Nuclease ◽  
Genomic Studies ◽  
A Cell ◽  
Accurate Quantification

ABSTRACTCRISPR-Cas9-mediated gene interference (CRISPRi) and activation (CRISPRa) approaches hold promise for functional genomic studies and genome-wide screens in human pluripotent stem cells (hPSCs). However, in contrast to CRISPR-Cas9 nuclease approaches, the efficiency of CRISPRi/a depends on continued expression of the dead Cas9 (dCas9) effector and guide RNA (gRNA), which can vary substantially depending on transgene design and delivery. Here, we design new fluorescently labeledpiggyBac(PB) vectors to deliver robust and stable expression of multiplexed gRNAs. In addition, we generate hPSC lines harboring AAVS1-integrated, inducible and fluorescent dCas9-KRAB and dCas9-VPR transgenes to allow for accurate quantification and tracking of cells that express both the dCas9 effectors and gRNAs. We then employ these systems to target theTCF4gene and conduct a rigorous assessment of expression levels of the dCas9 effectors, gRNAs and targeted gene. Collectively, these data provide proof-of-principle application of a stable, multiplexed PB gRNA delivery system that can be widely exploited to further enable genome engineering studies in hPSCs. Paired with diverse CRISPR tools including our dual fluorescence CRISPRi/a cell lines, this system would facilitate functional dissection of individual genes and pathways as well as larger-scale screens for studies of development and disease.

scholarly journals CRISPR RNA-guided integrases for high-efficiency and multiplexed bacterial genome engineering

2020 ◽  
Author(s):  
Phuc Leo H. Vo ◽  
Carlotta Ronda ◽  
Sanne E. Klompe ◽  
Ethan E. Chen ◽  
Christopher Acree ◽  
...  
Keyword(s):  
Genome Engineering ◽  
High Efficiency ◽  
Computational Algorithm ◽  
Bacterial Genome ◽  
Expression Vectors ◽  
Type I ◽  
Dna Integration ◽  
Guide Rna ◽  
Marker Free ◽  
Rna Design

Tn7-like transposons are pervasive mobile genetic elements in bacteria that mobilize using heteromeric transposase complexes comprising distinct targeting modules. We recently described a Tn7-like transposon from Vibrio cholerae that employs a Type I-F CRISPR–Cas system for RNA-guided transposition, in which Cascade directly recruits transposition proteins to integrate donor DNA downstream of genomic target sites complementary to CRISPR RNA. However, the requirement for multiple expression vectors and low overall integration efficiencies, particularly for large genetic payloads, hindered the practical utility of the transposon. Here, we present a significantly improved INTEGRATE (insertion of transposable elements by guide RNA-assisted targeting) system for targeted, multiplexed, and marker-free DNA integration of up to 10 kilobases at ~100% efficiency. Using multi-spacer CRISPR arrays, we achieved simultaneous multiplex insertions in three genomic loci, and facile multi-loci deletions when combining orthogonal integrases and recombinases. Finally, we demonstrated robust function in other biomedically- and industrially-relevant bacteria, and developed an accessible computational algorithm for guide RNA design. This work establishes INTEGRATE as a versatile and portable tool that enables multiplex and kilobase-scale genome engineering.

scholarly journals Allelic spectrum of the RNA guided CRISPR/Cas9 DNA repair events at PAM associated trinucleotide repeat (NGG)n in Caenorhabditis elegans.

2016 ◽  
Author(s):  
Wadim Kapulkin
Keyword(s):  
Genome Engineering ◽  
Trinucleotide Repeat ◽  
Repeat Region ◽  
End Joining ◽  
Guide Rna ◽  
C Elegans ◽  
Naturally Occurring ◽  
Cas9 Nuclease ◽  
Expected Performance ◽  
Animal Genomes

AbstractThis work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PAM repeat region. We describe the allelic spectrum of mutational events identified at position specified by gRNA-unc-22-1000. Of above experiments we conclude: i. the trinucleotide (NGG)n PAM repeat is a receptive target for the CRISPR/Cas9 experiments in C. elegans ii. we conclude the allelic spectrum indicates the gRNA-unc-22-1000 induces fairly frequent NHEJ joining events involving deletions and indels but also, a phenotypically distinct class of small in-frame deletions indicative for microhomology-mediated end-joining (MMEJ) as a result of S. pyogenes Cas9 activity at the trinucleotide (NGG)n PAM repeat region. We demonstrate guide RNA-unc-22-1000 could be used to modify complex transgenic C. elegans line expressing human beta-amyloid protein. We provide the evidence for bi-allelic transaction resulting from Cas9 action recovered in experiment in CB1138 him-6 background. We contrast the expected performance of gRNA-unc-22-1000 with guide targeting another type of C. elegans repeat embedding S. pyogenes PAM, the telomeric repeat (TTAGGC)n. We propose that preferential frame restoring MMEJ repair of the Cas9 cut at the 'modules' encoding for poly-glycine in +2(NGG)n position could be useful mode of genome engineering at the naturally occurring (NGG)n PAM embedding repeats dispersed across animal genomes.

Prime-editors (nickases), hRad51–Cas9 nickase fusions and dCas9 have the same problem as conventional CRISPR-Cas9 of plasmid/Cas9 integration after making a double stranded break

2019 ◽  
Author(s):  
Sandeep Chakraborty
Keyword(s):  
Cellular Response ◽  
Sequencing Data ◽  
Dna Breaks ◽  
Precise Integration ◽  
Guide Rna ◽  
Double Strand Dna Breaks ◽  
Human Therapy ◽  
P53 Activation ◽  
Programmable Nucleases

‘Prime-editing’ proposes to replace traditional programmable nucleases (CRISPR-Cas9) using a catalytically impaired Cas9 (dCas9) connected to a engineered reverse transcriptase, and a guide RNA encoding both the target site and the desired change. With just a ‘nick’ on one strand, it is hypothe- sized, the negative, uncontrollable effects arising from double-strand DNA breaks (DSBs) - translocations, complex proteins, integrations and p53 activation - will be eliminated. However, sequencing data pro- vided (Accid:PRJNA565979) reveal plasmid integration, indicating that DSBs occur. Also, looking at only 16 off-targets is inadequate to assert that Prime-editing is more precise. Integration of plasmid occurs in all three versions (PE1/2/3). Interestingly, dCas9 which is known to be toxic in E. coli and yeast, is shown to have residual endonuclease activity. This also affects studies that use dCas9, like base- editors and de/methylations systems. Previous work using hRad51–Cas9 nickases also show significant integration in on-targets, as well as off-target integration [1]. Thus, we show that cellular response to nicking involves DSBs, and subsequent plasmid/Cas9 integration. This is an unacceptable outcome for any in vivo application in human therapy.

Current RNA-based Therapeutics in Clinical Trials

2019 ◽  
Vol 19 (3) ◽  
pp. 172-196 ◽  
Author(s):  
Ling-Yan Zhou ◽  
Zhou Qin ◽  
Yang-Hui Zhu ◽  
Zhi-Yao He ◽  
Ting Xu
Keyword(s):  
Clinical Trials ◽  
Rapid Development ◽  
Genetic Diseases ◽  
Three Dimensional ◽  
Therapeutic Effects ◽  
Messenger Rnas ◽  
Small Interfering Rnas ◽  
Rna Modifications ◽  
Guide Rna ◽  
Endogenous Genes

Long-term research on various types of RNAs has led to further understanding of diverse mechanisms, which eventually resulted in the rapid development of RNA-based therapeutics as powerful tools in clinical disease treatment. Some of the developing RNA drugs obey the antisense mechanisms including antisense oligonucleotides, small interfering RNAs, microRNAs, small activating RNAs, and ribozymes. These types of RNAs could be utilized to inhibit/activate gene expression or change splicing to provide functional proteins. In the meantime, some others based on different mechanisms like modified messenger RNAs could replace the dysfunctional endogenous genes to manage some genetic diseases, and aptamers with special three-dimensional structures could bind to specific targets in a high-affinity manner. In addition, the recent most popular CRISPR-Cas technology, consisting of a crucial single guide RNA, could edit DNA directly to generate therapeutic effects. The desired results from recent clinical trials indicated the great potential of RNA-based drugs in the treatment of various diseases, but further studies on improving delivery materials and RNA modifications are required for the novel RNA-based drugs to translate to the clinic. This review focused on the advances and clinical studies of current RNA-based therapeutics, analyzed their challenges and prospects.

scholarly journals A Whole Virion Vaccine for COVID-19 Produced via a Novel Inactivation Method and Preliminary Demonstration of Efficacy in an Animal Challenge Model

Vaccines ◽  
2021 ◽  
Vol 9 (4) ◽  
pp. 340
Author(s):  
Izabela K Ragan ◽  
Lindsay M Hartson ◽  
Taru S Dutt ◽  
Andres Obregon-Henao ◽  
Rachel M Maison ◽  
...  
Keyword(s):  
Vaccine Candidate ◽  
Rapid Development ◽  
Neutralizing Antibody ◽  
Emerging Diseases ◽  
Effective Vaccine ◽  
Preliminary Evaluation ◽  
Sequencing Data ◽  
Post Challenge ◽  
Vaccine Candidates ◽  
The Impact

The COVID-19 pandemic has generated intense interest in the rapid development and evaluation of vaccine candidates for this disease and other emerging diseases. Several novel methods for preparing vaccine candidates are currently undergoing clinical evaluation in response to the urgent need to prevent the spread of COVID-19. In many cases, these methods rely on new approaches for vaccine production and immune stimulation. We report on the use of a novel method (SolaVAX) for production of an inactivated vaccine candidate and the testing of that candidate in a hamster animal model for its ability to prevent infection upon challenge with SARS-CoV-2 virus. The studies employed in this work included an evaluation of the levels of neutralizing antibody produced post-vaccination, levels of specific antibody sub-types to RBD and spike protein that were generated, evaluation of viral shedding post-challenge, flow cytometric and single cell sequencing data on cellular fractions and histopathological evaluation of tissues post-challenge. The results from this preliminary evaluation provide insight into the immunological responses occurring as a result of vaccination with the proposed vaccine candidate and the impact that adjuvant formulations, specifically developed to promote Th1 type immune responses, have on vaccine efficacy and protection against infection following challenge with live SARS-CoV-2. This data may have utility in the development of effective vaccine candidates broadly. Furthermore, the results of this preliminary evaluation suggest that preparation of a whole virion vaccine for COVID-19 using this specific photochemical method may have potential utility in the preparation of one such vaccine candidate.

scholarly journals An improved method for precise genome editing in zebrafish using CRISPR-Cas9 technique

2021 ◽  
Author(s):  
Eugene V. Gasanov ◽  
Justyna Jędrychowska ◽  
Michal Pastor ◽  
Malgorzata Wiweger ◽  
Axel Methner ◽  
...  
Keyword(s):  
Genome Editing ◽  
High Efficiency ◽  
Target Site ◽  
Proof Of Concept ◽  
Intervention Site ◽  
End Joining ◽  
Guide Rna ◽  
Guide Rnas ◽  
Cas9 Nuclease ◽  
Non Homologous End Joining

AbstractCurrent methods of CRISPR-Cas9-mediated site-specific mutagenesis create deletions and small insertions at the target site which are repaired by imprecise non-homologous end-joining. Targeting of the Cas9 nuclease relies on a short guide RNA (gRNA) corresponding to the genome sequence approximately at the intended site of intervention. We here propose an improved version of CRISPR-Cas9 genome editing that relies on two complementary guide RNAs instead of one. Two guide RNAs delimit the intervention site and allow the precise deletion of several nucleotides at the target site. As proof of concept, we generated heterozygous deletion mutants of the kcng4b, gdap1, and ghitm genes in the zebrafish Danio rerio using this method. A further analysis by high-resolution DNA melting demonstrated a high efficiency and a low background of unpredicted mutations. The use of two complementary gRNAs improves CRISPR-Cas9 specificity and allows the creation of predictable and precise mutations in the genome of D. rerio.

scholarly journals A Survey of Computational Tools to Analyze and Interpret Whole Exome Sequencing Data

2016 ◽  
Vol 2016 ◽  
pp. 1-16 ◽  
Author(s):  
Jennifer D. Hintzsche ◽  
William A. Robinson ◽  
Aik Choon Tan
Keyword(s):  
Exome Sequencing ◽  
Whole Exome Sequencing ◽  
Sequencing Data ◽  
Disease Treatment ◽  
Computational Tools ◽  
Whole Exome ◽  
Data Production ◽  
Whole Exome Sequencing Data ◽  
Computationally Intensive ◽  
Generation Technology

Whole Exome Sequencing (WES) is the application of the next-generation technology to determine the variations in the exome and is becoming a standard approach in studying genetic variants in diseases. Understanding the exomes of individuals at single base resolution allows the identification of actionable mutations for disease treatment and management. WES technologies have shifted the bottleneck in experimental data production to computationally intensive informatics-based data analysis. Novel computational tools and methods have been developed to analyze and interpret WES data. Here, we review some of the current tools that are being used to analyze WES data. These tools range from the alignment of raw sequencing reads all the way to linking variants to actionable therapeutics. Strengths and weaknesses of each tool are discussed for the purpose of helping researchers make more informative decisions on selecting the best tools to analyze their WES data.

Sign in / Sign up

Export Citation Format

Share Document