scholarly journals Physiological and molecular responses for long term salinity stress in common fig (Ficus carica L.)

2021 ◽  
Vol 27 (1) ◽  
pp. 107-117
Author(s):  
Monther T. Sadder ◽  
Ibrahim Alshomali ◽  
Ahmad Ateyyeh ◽  
Anas Musallam
Keyword(s):  
Salinity Stress ◽  
Ficus Carica ◽  
Molecular Responses ◽  
Common Fig

scholarly journals Salinity Stress in Potato: Understanding Physiological, Biochemical and Molecular Responses

Life ◽  
2021 ◽  
Vol 11 (6) ◽  
pp. 545
Author(s):  
Kumar Nishant Chourasia ◽  
Milan Kumar Lal ◽  
Rahul Kumar Tiwari ◽  
Devanshu Dev ◽  
Hemant Balasaheb Kardile ◽  
...  
Keyword(s):  
Salt Stress ◽  
Osmotic Stress ◽  
Salinity Stress ◽  
Crop Production ◽  
Antioxidant Activities ◽  
Water Status ◽  
Membrane Damage ◽  
Mitigation Strategies ◽  
Ammonium Compound ◽  
Molecular Responses

Among abiotic stresses, salinity is a major global threat to agriculture, causing severe damage to crop production and productivity. Potato (Solanum tuberosum) is regarded as a future food crop by FAO to ensure food security, which is severely affected by salinity. The growth of the potato plant is inhibited under salt stress due to osmotic stress-induced ion toxicity. Salinity-mediated osmotic stress leads to physiological changes in the plant, including nutrient imbalance, impairment in detoxifying reactive oxygen species (ROS), membrane damage, and reduced photosynthetic activities. Several physiological and biochemical phenomena, such as the maintenance of plant water status, transpiration, respiration, water use efficiency, hormonal balance, leaf area, germination, and antioxidants production are adversely affected. The ROS under salinity stress leads to the increased plasma membrane permeability and extravasations of substances, which causes water imbalance and plasmolysis. However, potato plants cope with salinity mediated oxidative stress conditions by enhancing both enzymatic and non-enzymatic antioxidant activities. The osmoprotectants, such as proline, polyols (sorbitol, mannitol, xylitol, lactitol, and maltitol), and quaternary ammonium compound (glycine betaine) are synthesized to overcome the adverse effect of salinity. The salinity response and tolerance include complex and multifaceted mechanisms that are controlled by multiple proteins and their interactions. This review aims to redraw the attention of researchers to explore the current physiological, biochemical and molecular responses and subsequently develop potential mitigation strategies against salt stress in potatoes.

Proteomic analysis of long-term salinity stress-responsive proteins in Thellungiella halophila leaves

2008 ◽  
Vol 53 (22) ◽  
pp. 3530-3537 ◽  
Author(s):  
Fei Gao ◽  
YiJun Zhou ◽  
LingYun Huang ◽  
DaCheng He ◽  
GenFa Zhang
Keyword(s):  
Salinity Stress ◽  
Proteomic Analysis ◽  
Thellungiella Halophila

Deep molecular responses achieved in patients with CML-CP who are switched to nilotinib after long-term imatinib

Blood ◽  
2014 ◽  
Vol 124 (5) ◽  
pp. 729-736 ◽  
Author(s):  
Timothy P. Hughes ◽  
Jeffrey H. Lipton ◽  
Nelson Spector ◽  
Francisco Cervantes ◽  
Ricardo Pasquini ◽  
...  
Keyword(s):  
Minimal Residual Disease ◽  
Residual Disease ◽  
Molecular Responses ◽  
Key Points ◽  
Treatment Free Remission ◽  
Minimal Residual

Key Points Nilotinib induced deeper molecular responses than continued imatinib in patients with minimal residual disease on long-term imatinib. These deeper responses may enable more patients to benefit from treatment-free remission trials.

scholarly journals Assessment of allelopathic activity of common fig (Ficus carica) and their alleviation by activated charcoal

2000 ◽  
Vol 45 (Supplement) ◽  
pp. 90-91
Author(s):  
Y. Morita ◽  
H. Gemma ◽  
Y. Fujii
Keyword(s):  
Activated Charcoal ◽  
Ficus Carica ◽  
Allelopathic Activity ◽  
Common Fig

Green synthesis and characterization of iron oxide nanoparticles using Ficus carica (common fig) dried fruit extract

2019 ◽  
Vol 127 (2) ◽  
pp. 241-245 ◽  
Author(s):  
Derya Aksu Demirezen ◽  
Yalçın Şevki Yıldız ◽  
Şeyda Yılmaz ◽  
Dilek Demirezen Yılmaz
Keyword(s):  
Iron Oxide ◽  
Green Synthesis ◽  
Iron Oxide Nanoparticles ◽  
Ficus Carica ◽  
Synthesis And Characterization ◽  
Oxide Nanoparticles ◽  
Fruit Extract ◽  
Common Fig ◽  
Dried Fruit

Spectrum of Physiological and Molecular Responses in Plant Salinity Stress Tolerance

2020 ◽  
pp. 1-12
Author(s):  
Insha Amin ◽  
Aditya Banerjee ◽  
Abbu Zaid ◽  
Mudasir A. Mir ◽  
Shabir H. Wani ◽  
...  
Keyword(s):  
Stress Tolerance ◽  
Salinity Stress ◽  
Molecular Responses ◽  
Salinity Stress Tolerance

scholarly journals Hexane-Soluble Fraction of the Common Fig, Ficus carica, Inhibits Osteoclast Differentiation in Murine Bone Marrow-Derived Macrophages and RAW 264.7 Cells

2009 ◽  
Vol 13 (6) ◽  
pp. 417 ◽  
Author(s):  
Young Ran Park ◽  
Jae Soon Eun ◽  
Hwa Jung Choi ◽  
Manoj Nepal ◽  
Dae Keun Kim ◽  
...  
Keyword(s):  
Bone Marrow ◽  
Soluble Fraction ◽  
Osteoclast Differentiation ◽  
Ficus Carica ◽  
Raw 264.7 Cells ◽  
Raw 264.7 ◽  
Murine Bone Marrow ◽  
Common Fig ◽  
The Common

First Report of Eastern Dodder (Cuscuta monogyna) Parasitizing Common Fig (Ficus carica) at the Crimean Peninsula

Plant Disease ◽  
2019 ◽  
Vol 103 (7) ◽  
pp. 1795-1795
Author(s):  
Y. A. Krasylenko ◽  
R. Piwowarczyk
Keyword(s):  
Ficus Carica ◽  
Crimean Peninsula ◽  
First Report ◽  
Common Fig ◽  
The Crimean Peninsula

scholarly journals Prognostic Significance of Transcript-Type BCR‐ABL1 in Chronic Myeloid Leukemia

2020 ◽  
Vol 12 (1) ◽  
pp. e2020062
Author(s):  
Matteo Molica ◽  
Elisabetta Abruzzese ◽  
Massimo Breccia
Keyword(s):  
Chronic Myeloid Leukemia ◽  
Myeloid Leukemia ◽  
Fusion Gene ◽  
Prognostic Significance ◽  
High Rate ◽  
Long Term Outcomes ◽  
Term Outcome ◽  
Long Term Outcome ◽  
Molecular Responses

Chronic myeloid leukemia (CML) is characterized by the presence of the BCR-ABL1 fusion gene. In more than 95% of CML patients, the typical BCR-ABL1 transcript subtypes are e13a2 (b2a2), e14a2 (b3a2), or the simultaneous expression of both. Other less frequent transcript subtypes, such as e1a2, e2a2, e6a2, e19a2, e1a3, e13a3, and e14a3, have been sporadically reported. The main purpose of this review is to assess the possible impact of different transcripts on the response rate to tyrosine kinase inhibitors (TKIs), the achievement of stable deep molecular responses (s-DMR), the potential maintenance of treatment-free remission (TFR), and long-term outcome of CML patients treated with TKIs. According to the majority of published studies, patients with e13a2 transcript treated with imatinib have lower and slower cytogenetic and molecular responses than those with e14a2 transcript and should be considered a high-risk group who would mostly benefit from frontline treatment with second-generation TKIs (2GTIKIs). Although few studies have been published, similar significant differences in response rates to 2GTKIs have been not reported. The e14a2 transcript seems to be a favorable prognostic factor for obtaining s-DMR, irrespective of the TKI received, and is also associated with a very high rate of TFR maintenance. Indeed, patients with e13a2 transcript achieve a lower rate of s-DMR and experience a higher probability of TFR failure. According to most reported data in the literature, the type of transcript does not seem to affect long-term outcomes of CML patients treated with TKIs. In TFR, the e14a2 transcript appears to be related to favorable responses. 2GTKIs as frontline therapy might be a convenient approach in patients with e13a2 transcript to achieve optimal long-term outcomes.  

scholarly journals First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 422-422 ◽  
Author(s):  
M. Mijit ◽  
S. F. Li ◽  
S. Zhang ◽  
Z. X. Zhang
Keyword(s):  
Mosaic Virus ◽  
Blot Hybridization ◽  
Ficus Carica ◽  
Pcr Analysis ◽  
Northern Blot Hybridization ◽  
Rt Pcr ◽  
Glycoprotein Precursor ◽  
First Report ◽  
Common Fig ◽  
Fig Mosaic Virus

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.

Sign in / Sign up

Export Citation Format

Share Document