scholarly journals First report of Meloidogyne arenaria on roots of Grona triflora in Guangdong Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Chang-chao Xu ◽  
Xiao-ge Han ◽  
Christian Staehelin ◽  
Jun-tao Zhang
Keyword(s):  
Southern China ◽  
Tail Length ◽  
Guangdong Province ◽  
Mountain Forest ◽  
Meloidogyne Arenaria ◽  
Root Knot Nematode ◽  
Morphometric Characters ◽  
Lateral Field ◽  
First Report ◽  
Sampling Plot

Grona triflora (Desmodium triflorum), a perennial herbaceous legume, is widely distributed in southern China. G. triflora has antipyretic, antiseptic and expectorant properties and can therefore be used as a phytomedicine (Ghosal et al. 1973). In July 2020, roots of G. triflora were investigated for nodules and rhizobia collection at the Shibaluohan Mountain Forest Park of Guangzhou. Root galls induced by a root-knot nematode were observed on 90% of the G. triflora samples (in a 200 m2 plot) and the infested plants had yellow, small and withered leaves compared with the healthy ones. The galls number on a G. triflora root ranged from 43 to 92 and the population densities of second stage juveniles (J2s) ranged from 573 to 894 per 100 cm3 soil surrounding the plant. The female perineal patterns showed a low dorsal arch, with lateral field marked by forked and broken striae, no punctate markings between the anus and tail terminus, which matched with the description of Meloidogyne arenaria (Hartman and Sasser 1985). The J2s had the following morphometric characters (n = 15): body length = 501.05 ± 23.71 µm; body width = 17.14 ± 1.23 µm; DGO = 3.13 ± 0.27 µm; stylet length = 12.97 ± 1.38 µm; tail length = 58.02 ± 4.77 µm; hyaline tail terminus = 10.08 ± 0.65 µm. DNA from four female nematodes was isolated for PCR-based diagnostic analyses. A fragment between the COII and LrRNA genes of the mitochondrial DNA was amplified with primers C2F3/1108 (Powers and Harris 1993). In addition, a 28S ribosomal DNA D2/D3 region was amplified with primers MF/MR (Hu et al. 2011). The amplicons were sequenced (GenBank No. MW315989 and MW307358). Nucleotide BLAST results indicated that both sequences show 100% identity with corresponding M. arenaria sequences of isolates from various countries such as Brazil, China, Myanmar and Vietnam (e.g., MK033428, JQ446377, KY293688 and MK026624). For further confirmation, sequence characterized amplified region (SCAR) PCR was employed using the M. arenaria specific primers Far/Rar (Zijlstra et al. 2000). The amplicon was also sequenced (GenBank No. MW315990). The Nucleotide BLAST results showed >99% identity with M. arenaria isolates from Indonesia and Argentina (KP234264, KP253748 and MK015624). Greenhouse tests were conducted to analyze the capacity of M. arenaria to induce galls on G. triflora roots. The G. triflora seeds were collected from the sampling plot and germinated on 0.8% (W/V) agar plates. Then the seedlings were planted in 14 cm deep and 15 cm diam pots filled with sterilized soil from sampling plot. Every seedling was inoculated with 2,000 J2s (n = 15) and plants without J2s were used as a control. Two months later, galls were observed for inoculated roots while no galls were formed on roots of control plants. An average of 13,300 J2s and eggs of M. arenaria (reproduction factor = 6.65) were recovered from the root. Stanton and Rizo (1988) found that G. triflora was susceptible to M. javanica in Australia, and Ogbuji (1978) reported that a population of M. incognita reproduced on roots of G. triflora in Nigeria after artificial inoculation. To our knowledge, this is the first report on G. triflora parasitized by M. arenaria in Guangdong province. M. arenaria has potential to infest local, economically important plants like citrus, pomelo, sugarcane, maize and peanut. As G. triflora is widely distributed in southern China, there is the risk of spreading M. arenaria into agricultural and horticultural systems, that will cause yield loss and economic impacts.

scholarly journals First Report of the Root-Knot Nematode Meloidogyne arenaria Race 2 from Several Vegetable Crops in Jordan

Plant Disease ◽  
2005 ◽  
Vol 89 (2) ◽  
pp. 206-206 ◽  
Author(s):  
M. Karajeh ◽  
W. Abu-Gharbieh ◽  
S. Masoud
Keyword(s):  
North Carolina ◽  
Meloidogyne Arenaria ◽  
Vegetable Crops ◽  
Root Knot Nematode ◽  
Lateral Field ◽  
Differential Host ◽  
First Report ◽  
Race 1 ◽  
Meloidogyne Spp ◽  
Race 2

Meloidogyne arenaria (Neal) Chitwood (race 2) is reported for the first time in Jordan. The nematode populations were recovered from several vegetable crops, including tomato (Lycopersicon esulentum Mill), squash (Cucurbita pepo L.), cucumber (Cucumis sativus L.), and bean (Phaseolus vulgaris L.), at Dier Alla in the northern area of the Jordan Valley. Symptoms included root galling, leaf chlorosis, and stunting. Galled plant root samples were collected during a survey conducted from May 2002 to August 2003 covering most of the irrigated agricultural areas of Jordan. Eighty-three Meloidogyne spp. populations were collected from various vegetable crops and fruit trees. Identification to species and race levels of the nematode populations was based on combination of currently available methods including nematode morphology, host preference based on the North Carolina (NC) differential host test (1), and cytogenetics and DNA-fingerprinting. Seventy of the eighty-three collected populations were identified as M. javanica, five as M. incognita (race 1), three as M. incognita (race 2), and five as M. arenaria (race 2). The perineal patterns of M. arenaria were characterized by a low, round to indented dorsal arch near the lateral field with irregular forks in the lateral field, fine smooth striae, and a distinct whorl. Race 2 was identified with the NC differential host test. Cytogenetic studies indicated that M. arenaria populations were triploid with an average of 52.2 chromosomes, while the populations of M. incognita (race 1), M. incognita (race 2), and M. javanica were hypotriploid with an average of 45.2, 46.1, and 46.7 chromosomes, respectively. Two polymerase chain reaction (PCR)-based assays were used to confirm species identification and to study genetic variability of the Meloidogyne spp. populations including sequence characterized amplified regions (SCAR) and random amplified polymorphic DNA (RAPD). In the SCAR-PCR-based assay (2), typical DNA products of 420, 670, or 1,200 bp in size were amplified by using extracted DNA of M. arenaria (race 2), M. javanica, or M. incognita (race 1 or 2), respectively, as template DNA. The RAPD-PCR primer, OPA-01, produced DNA patterns with bands that clearly distinguished M. arenaria from the other two Meloidogyne spp. To our knowledge, this is the first report of the root-knot nematode, M. arenaria race 2, in Jordan. References: (1) A. Taylor and J. Sasser, North Carolina State University Graphics, Raleigh, NC, 1978. (2) C. Zijlstra et al. Nematology 2:847, 2000.

scholarly journals Root-Knot Disease Caused by Meloidogyne arenaria and M. javanica in Teak in São Paulo State, Brazil

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 151-151
Author(s):  
J. V. de Araújo Filho ◽  
A. C. Z. Machado ◽  
R. S. C. A. de Faria ◽  
L. E. A. Camargo
Keyword(s):  
Sao Paulo ◽  
The State ◽  
Meloidogyne Arenaria ◽  
São Paulo ◽  
Mato Grosso ◽  
Lateral Field ◽  
First Report ◽  
Paulo State ◽  
São Paulo State ◽  
Esterase Phenotypes

Teak (Tectona grandis Linn. F.) is one of the most important forest crops in Brazil, occupying areas in different regions, such as Goiás, Mato Grosso, Paraná, and São Paulo states. Teak wood is used for many purposes such as shipbuilding, rolling and plywood, firewood, and charcoal. In May 2011, teak symptomatic feeder root samples, exhibiting inconspicuous, small galls, were collected in the municipality of Piracicaba, São Paulo State, Brazil (22°41′46.90″S, 47°38′36.84″W). Specimens were identified through perineal patterns and esterase phenotypes of 20 adult females (1,2). Perineal patterns and esterase phenotypes were consistent with those described for Meloidogyne arenaria (Neal, 1889) Chitwood, 1949 and M. javanica (Treub, 1885) Chitwood, 1949. Perineal patterns of M. arenaria showed a low dorsal arch, compressed dorsolaterally, with lateral field marked by some forked and broken striae; no punctate markings between anus and tail terminus were observed. Perineal patterns of M. javanica were rounded, with low dorsal arch, striae smooth, lateral field distinct, clearly demarcated from striae by parallel lines. From the esterase electrophoresis we obtained A2 (Rm:1.2;1.3) and J3 (Rm:1.0;1.25;1.4) phenotypes, typical from M. arenaria and M. javanica, respectively. To our knowledge, this is the first report of M. arenaria parasitizing teak roots in Brazil and elsewhere (new host) and the first report of M. javanica infecting teak in the State of São Paulo. Previously, M. javanica was reported to be infecting teak-growing areas in the State of Mato Grosso (3). This finding has a great importance, not only by the inclusion of these parasites in teak pathological scenario, but also for predicting possible damage in plant species used in teak-based intercropping systems. References: (1) P. R. Esbenshade and A. C. Triantaphyllou. J. Nematol. 22:10, 1990. (2) K. M. Hartman and J. N. Sasser. 1985. Page 115 in: An Advanced Treatise on Meloidogyne. Volume II, Methodology. K. R. Barker et al., eds. North Carolina State University Graphics, Raleigh,1985. (3) R. A. Silva et al. Nematol. Bras. 27:261, 2003.

scholarly journals First Report of the Root-Knot Nematode Meloidogyne enterolobii Parasitizing Watermelon from Veracruz, Mexico

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 428-428 ◽  
Author(s):  
A. Ramírez-Suárez ◽  
L. Rosas-Hernández ◽  
S. Alcasio-Rangel ◽  
T. O. Powers
Keyword(s):  
Phylogenetic Trees ◽  
Citrullus Lanatus ◽  
Pcr Amplification ◽  
Original Description ◽  
Root Knot Nematode ◽  
Morphometric Characters ◽  
First Report ◽  
Worldwide Distribution ◽  
Meloidogyne Enterolobii ◽  
Stylet Length

In early April 2012, a sampling of watermelon crop Citrullus lanatus (Thunb.) Matsum & Nakai, 1916 cv. Sunsugar took place as part of the National System of Epidemiological Phytosanitary Surveillance (SINAVEF-MEX). This sampling was conducted at Riachuelos locality, Tecolutla, Veracruz, located at the geographic coordinates: 20.42008° N and 96.9627° W, within 50 meters of the Gulf of Mexico. Plants showed yellowing, stunting, and high levels of infection expressed by extensive galling on the roots. These symptoms were reproduced in the greenhouse on watermelon cv. Sunsugar. Egg masses were extracted to obtain juveniles (J2). Female necks and perineal patterns were mounted as well as males and J2 to take measurements of selected morphometric characters. To determine the nematode identity based on a morphological species concept, the following characters were considered. Females: stylet length, DGO and perineal pattern; males: stylet length; J2: body, stylet, tail, and hyaline tail terminus length. The morphometric analysis showed that those values corresponded to the original description of the root-knot nematode Meloidogyne enterolobii Yang & Eisenback, 1983 (=M. mayaguensis Rammah & Hirschmann, 1988) (1,2,3,4). For confirmation of this finding, a molecular diagnosis was performed using markers located in rDNA and mtDNA by PCR amplification and DNA sequencing. The rDNA region analyzed was the expansion segments D2-D3 of the 28S gene (primers D2A and D3B). This produced an amplified product of 780 bp. With regard to mtDNA, an amplification of the marker located between the genes COII/16S (primers C2F3 and 1108) resulted in a fragment of 705 bp that is specific for M. enterolobii (1). Sequences of the amplified products were compared with sequences from GenBank (NCBI). The sequences of both markers exhibited 99 and 100% identity with sequences corresponding to M. enterolobii isolates from Florida, Puerto Rico, and China. Maximum likelihood phylogenetic trees of rDNA and mtDNA sequences demonstrated that the Mexican isolate of M. enterolobii grouped among other isolates exclusive of other Meloidogyne species. The detection of this nematode in Veracruz, Mexico, expands the previously known worldwide distribution. It represents a serious threat due to the high level of aggressiveness shown in watermelon, which was so severe that growers had to change to a different crop. To our knowledge, this is the first report of the root-knot nematode M. enterolobii infecting watermelon cv. Sunsugar in Veracruz, Mexico. References: (1) J. Brito et al. J. Nematol. 36:232, 2004. (2) G. Karssen et al. ZooKeys 181:67, 2012. (3) A. Rammah and H. Hirshmann. J. Nematol. 20:58, 1988. (4) B. Yang and J. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals First report of the nematodes Filenchus orientalis and Hemicriconemoides californianus on faba bean in Iran

2016 ◽  
Vol 9 (1) ◽  
pp. 44-50
Author(s):  
S. Azimi ◽  
E. Mahdikhani-Moghadam ◽  
H. Rouhani ◽  
H. Rajabi Memari
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Morphometric Characters ◽  
Lateral Field ◽  
Stylet Length ◽  
First Time ◽  
Plant Parasitic ◽  
Iranian Populations

Summary During a survey in Iran, two known species of plant-parasitic nematodes of the families Tylenchidae and Criconematidae were reported for the first time. The morphological and morphometric characters of Iranian populations of the two recovered species are discussed and illustrated based on morphological and morphometrics data. Iranian population of Filenchus orientalis is characterized by having a 601-755μm body length, stylet length of 9.0-11.3 μm, lateral field with four incisures, tail length of 100-118 μm and males with 15-21 μm long spicules. Hemicriconemoides californianus population is characterized by having a body length of 430-550μm, lip region with two annuli, stylet length of 75-83μm and tail length of 20-28 μm. The morphological and morphometric characters of both species are in agreement with those in original descriptions.

scholarly journals Two new species of Lepidocyrtus Bourlet s. lat. (Collembola: Entomobryidae) from China

2019 ◽  
Author(s):  
Yitong Ma
Keyword(s):  
New Species ◽  
Southern China ◽  
Guangdong Province ◽  
Hainan Province ◽  
First Report ◽  
Two New Species ◽  
Fourth Species

Two new species of the genus Lepidocyrtus Bourlet, 1839 from southern China are described here: L. (Acrocyrtus) huizhouensis sp. nov. from Guangdong Province and L. (Setogaster) wanningensis sp. nov. from Hainan Province. Lepidocytus (Acrocyrtus) huizhouensis sp. nov. is the fourth species of the subgenus reported from China and L. (Setogaster) wanningensis sp. nov. is the first report of the subgenus from China.

scholarly journals First report of Meloidogyne arenaria infecting Maidong (Ophiopogon japonicus) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Wentao Wu ◽  
Kunhao Ye ◽  
Zhu-hua Wang ◽  
Liwei Guo ◽  
Shu-sheng Zhu ◽  
...  
Keyword(s):  
Species Identification ◽  
Morphological Characteristics ◽  
Pathogenicity Test ◽  
28S Rrna ◽  
Meloidogyne Arenaria ◽  
Medicinal Uses ◽  
Lateral Field ◽  
First Report ◽  
Second Stage ◽  
Ophiopogon Japonicus

Maidong (Ophiopogon japonicus) is a perennial evergreen plant of the Asparagaceae, occurring mainly in China, Japan, Vietnam, and India. It grows in the damp place on the hillside below 2000 meters above sea level, under the forest or beside the stream;It has been widely cultivated in the Sichuan ofhina for medicinal uses; and it is included in the Chinese Pharmacopoeia. During April 2019, Maidong plants exhibiting symptoms of stunting, leaf wilting, and multiple galls in the roots associated with root-knot nematode (Meloidogyne sp.) were detected in a commercial field in near the city of Mianyang (N105°42′, E30°93′), Sichuan, China. The second-stage juveniles (J2) were collected from the soil in the root zone, and adult females were dissected from roots. Population densities of J2 ranged from 190 to 255 per 100 cm3. Subsequently, individual females (n=20) were extracted from root samples and submitted to Meloidogyne species identification by perineal pattern morphological analysis (n=20), and morphometric measurements of second stage juveniles (J2) (n = 20). The J2 showed the following morphometric characters：body length = 475.5 ± 24.2 µm, tail length = 55.2 ± 6.43µm, stylet length = 12.4 ± 1.56 µm and distance from dorsal esophageal gland opening to the stylet knot (DGO) = 2.97 ± 0.44 μm; perineal patterns of females showed a low dorsal arch, with lateral field marked by forked and broken striae, no punctate markings between anus and tail terminus were observed. These morphological characteristics are consistent with Meloidogyne arenaria (Neves et al. 2016). In addition, to confirm species identification, DNA was extracted from females (Blok, et al. 1997) and D2/D3 fragments of the 28S rRNA was amplified using the universal primers D2A/D3B. The DNA fragment obtained showed a 754 bp length (GenBank accession no. MW965614) that was sequenced and analyzed, sequences were 99.8% identical to the MH359158, KX151138 and EU364889 M. arenaria sequences. Furthermore, species-specific SCAR primers Far/Rar were used as described by Zijlstra et al. 2000. The PCR produced approximately 420 bp sequences, which was identical to that previously reported for M. arenaria (Zijlstra et al. 2000). Morphological and molecular characterization supports the identification of the isolate found on Ophiopogon japonicus as M. arenaria. To verify the nematode pathogenicity on Maidong plants, Maidong seed were planted in 20-cm diameter, 10-cm deep plastic pots containing 1000 cm3 sterilized soil and infested with 2000 M. arenaria J2 per seedling, using a sterilized micropipette. Plants were maintained at 20-25°C in a greenhouse. Control plants received sterile water, and the pathogenicity test was repeated three times. After 60 days, all inoculated plants showed reduced growth compared with control. The symptoms were similar to those observed in the field, a large number of galls (38.5 ± 2.4) and egg masses (18.5 ± 0.2) were found on each root system. Maidong was considered a good host for M. arenaria in Mianyang. M. arenaria is one of the most important plant parasitic nematode with a wide geographic distribution and causes great losses in many crops around the world (Perry et al. 2009). Through investigation, this is the first report worldwide of M. arenaria infecting Ophiopogon japonicus.

scholarly journals First Report of Meloidogyne arenaria Parasitizing Lettuce in Southern Spain

Plant Disease ◽  
2006 ◽  
Vol 90 (7) ◽  
pp. 975-975
Author(s):  
P. Castillo ◽  
B. B. Landa ◽  
J. A. Navas-Cortés ◽  
N. Vovlas ◽  
R. M. Jiménez-Díaz
Keyword(s):  
Crop Yields ◽  
Disease Incidence ◽  
Tail Length ◽  
Southern Spain ◽  
Parasitic Nematodes ◽  
Meloidogyne Arenaria ◽  
Root Knot Nematode ◽  
Sequence Characterized Amplified Region ◽  
Stylet Length ◽  
Dorsal Gland

During the 2005-2006 autumn to winter lettuce-growing (Lactuca sativa cv. Iceberg) season, severely stunted and yellowing lettuce plants with disease incidence ranging from 80 to100% were observed in four commercial, fall-sown fields at Almodóvar del Río (Córdoba Province) in southern Spain. Early symptoms consisted of severely reduced growth of the plants that continued with extensive leaf yellowing and the absence of tight-head formation. Attacks by the disease were estimated to cause near complete loss of the crop yields since the lettuce head produced in affected fields were unmarketable. Observations of affected lettuce plants revealed high parasitism of the root system by a root-knot nematode (Meloidogyne sp.) in the main and feeder roots as well as heavy soil infestations by the nematode. The nematode was identified by the female perineal pattern, esterases phenotype, and a sequence-characterized amplified region polymerase chain reaction (SCAR-PCR) technique (1,2,4). Measurements and morphological observations of 20 second-stage juveniles (J2s) (body length = 463 ± 28 μm, dorsal gland orifice from stylet base = 2.8 ± 0.6 μm, stylet length = 10.4 ± 0.5 μm, tail length = 54.4 ± 0.6 μm; hyaline tail terminus = 9.4 ± 0.6 μm) and 10 adult females (stylet length = 14.5 ± 0.7 μm, dorsal gland orifice from stylet base = 4.7 ± 0.5 μm, and perineal pattern with low and rounded dorsal arch with coarse striae) conformed to the description of Meloidogyne arenaria (3). On the basis of the characteristics of the perineal pattern, the 2-band esterase phenotype, and the 420-bp SCAR fragment, the causal agent was identified as the peanut root-knot nematode M. arenaria. Nematodes were extracted from soil and root samples by standard procedures and their populations quantified. M. arenaria was detected in nearly all soil and root samples assessed, with nematode population densities ranging from 206 to 1,072 eggs and J2s per 5 g of fresh roots. Different Meloidogyne spp. have been reported parasitizing lettuce roots, especially M. hapla in northern areas (2); however, to our knowledge this is the first time that M. arenaria is reported parasitizing lettuce roots in Spain and elsewhere. References: (1) P. R. Esbenshade and A. C. Triantaphyllou. J. Nematol. 22:10, 1990. (2) N. A. Mitkowski et al. Plant Dis. 86:840, 2002. (3) K. J. Orton Williams. Meloidogyne arenaria. CIH Descriptions of Plant-Parasitic Nematodes. Set 5, No. 62. Commonwealth Institute of Helminthology, St. Albans, 1975. (4) C. Zijlstra et al. Nematology 2:847, 2000.

scholarly journals First Report of Meloidogyne javanica Parasitizing Duboisia sp. in Paraná State, Brazil

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1745-1745
Author(s):  
A. C. Z. Machado ◽  
O. F. Dorigo ◽  
A. Boss ◽  
P. Tironi
Keyword(s):  
Morphological Characteristics ◽  
Tail Length ◽  
Nematode Species ◽  
Eastern Coast ◽  
State University ◽  
Root Knot Nematode ◽  
First Report ◽  
North Carolina State University ◽  
Tail Tip ◽  
And Control

Duboisia sp. is a small tree belonging to the family Solanaceae originating from the rainforest areas of the eastern coast of Australia. Dried leaves are used for the extraction of pharmaceutical alkaloids, making this a commercially viable crop. The root-knot nematode Meloidogyne incognita has been reported parasitizing Duboisia myoporoides (5); however, no information of other root-knot nematode species associated with this plant was found. Duboisia sp. is cultivated at Solana Farm, near Arapongas (23°25′08″ S, 51°25′26″ W), Paraná State, Brazil. During the renovation of a production field in this municipality, galled roots were observed on plants and samples were submitted to the Nematology Laboratory at Instituto Agronômico do Paraná, IAPAR, on December 2013. Plants did not exhibit any above-ground symptoms. The specimens were identified through perineal patterns and esterase phenotypes of 20 adult females extracted from dissected roots (2,3) and morphometrics of 10 second-stage juveniles extracted from roots using the blender-sieving method (1). Morphological characteristics were consistent with those described for M. javanica (4). Females had rounded perineal patterns with low, trapezoid shape dorsal arch, striae smooth interrupted by a pair of incisures on both sides, corresponding to lateral fields, clearly demarcated from striae by more or less parallel lines, tail whorl often distinct (4). The juvenile mean body length was 459.9 ± 28.7 μm and tail length averaged 51.6 ± 5.1 μm, with 10 to 16 μm long hyaline region and finely rounded tail tip (4). Results from the esterase electrophoresis were typical of M. javanica (2) with the J3 (Rm = 1.0, 1.3, and 1.4) phenotype being obtained. To our knowledge, this is the first report of M. javanica on Duboisia sp. in Brazil. This finding has great importance for Brazilian production since this nematode may damage plants, reduce yields, and control of this nematode on Duboisia sp. is difficult (5). Additional work is necessary in order to elucidate the losses caused by M. javanica on Duboisia sp. References: (1) J. I. Bonetti and S. Ferraz. Fitopatol. Bras. 6:533, 1981. (2) P. R. Esbenshade and A. C. Triantaphyllou. J. Nematol. 22:10, 1990. (3) K. M. Hartman and J. N. Sasser. Page 115 in: An Advanced Treatise on Meloidogyne. Volume II Methodology. K. R. Barker et al., eds. North Carolina State University Graphics, Raleigh, 1985. (4) D. J. Hunt and Z. A. Handoo. Page 55 in: Root-Knot Nematodes. R. N. Perry et al., eds. CABI International, Wallingford, UK, 2010. (5) A. M. Mello et al. Nematol. Bras. 22(2):12, 1998.

scholarly journals First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio

Plant Disease ◽  
2012 ◽  
Vol 96 (9) ◽  
pp. 1385-1385
Author(s):  
H. D. Lopez-Nicora ◽  
T. Mekete ◽  
N. J. Taylor ◽  
T. L. Niblack
Keyword(s):  
Body Length ◽  
Tail Length ◽  
The Body ◽  
28S Rrna ◽  
Lateral Field ◽  
First Report ◽  
Pratylenchus Vulnus ◽  
Buxus Sempervirens ◽  
Stylet Length ◽  
De Man

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

First record of the genus Discotylenchus Siddiqi, 1980 (Nematoda: Tylenchidae) from Iran, with description of one new and data on two known species

Zootaxa ◽  
2012 ◽  
Vol 3493 (1) ◽  
pp. 72
Author(s):  
RAZIEH GHAEMI ◽  
EBRAHIM POURJAM ◽  
MOHAMMAD REZA ATIGHI ◽  
MAJID PEDRAM ◽  
GERRIT KARSSEN
Keyword(s):  
Tail Length ◽  
Original Description ◽  
First Record ◽  
Morphological Characters ◽  
Morphometric Characters ◽  
Lateral Field ◽  
Original Population ◽  
Stylet Length ◽  
First Time ◽  
Labial Disc

The genus Discotylenchus is reported for the first time from Iran. Discotylenchus iranicus n. sp. is described and illustratedbased on morphological and morphometric characters. The new species is characterized by a combination of the followingmorphological features: lip region continuous and smooth, tapering to an offset prominent labial disc, lateral field withfour incisures, stylet length of 14–15μm, vulva position at 70.8–76.5 %, tail length of 81–100μm, conoid with a roundedtip and presence of males. The Iranian population of D. brevicaudatus shows a wider morphometric range compared tothe original description and the male of this species is described for the first time. The morphological characters and range of morphometric data of D. discretus are in full agreement with the original population.

Sign in / Sign up

Export Citation Format

Share Document