scholarly journals First Report of Rice stripe virus of Proso Millet in Korea

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 150-150 ◽  
Author(s):  
Y. Yoon ◽  
J. Jung ◽  
B. Lee ◽  
Y. Lee ◽  
J. Lee ◽  
...  
Keyword(s):  
Coat Protein ◽  
South Korea ◽  
Foxtail Millet ◽  
Rice Stripe Virus ◽  
Management Options ◽  
First Report ◽  
Proso Millet ◽  
Cereal Grain ◽  
Yellow Stripe ◽  
The Impact

Rice stripe virus (RSV; genus Tenuivirus) is a serious threat to rice production in Korea (2). In 1965, a disease outbreak was observed on rice in South Korea, with plants showing yellow stripe symptoms (2). Reoccurrence of RSV in rice was observed again in 1980 in Gyeonggi and Chungcheong. In 2001, RSV was estimated to be infecting approximately 4,663 ha of rice in the provinces of Gyeonggi and Gangwha and approximately 5,000 ha of riceland in the provinces of Buan and, Seocheon (3). Proso millet (Panicum miliaceum L.) is grown as a cereal grain crop and used mainly for human food in South Korea (1). In June 2009, proso millet plants that displayed yellow stripe symptoms were collected at Sinjeon-Myeon, Gangjin-Gun, and Jeollanam-do provinces, where an outbreak of RSV in rice was reported. Diseased plants tested positive to RSV with an ELISA Kit (KisanBio, Seoul, Korea). Total RNA was extracted from leaf tissue with an RNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA). RSV coat protein specific-primers were produced (5′ TGTGGAACATAGTCCCACAGTAAGT 3′(upstream), 5′ CTAAGCCGCAACCATTCCTCCAGT 3′(downstream). Reverse transcription-PCR confirmed the presence of a 494-bp product as predicted for the presence of RSV. The coat protein of RSV isolates collected from proso millet, rice, and foxtail millet in the same area was also sequenced. Results confirmed that phylogenetic relationships were of high homology: 98.9% between RSV isolates from rice and foxtail millet, 99.2% between isolates from rice (GenBank Accession No. JN245626) and proso millet (GenBank Accession No. JN245627); 99.6% between rice and foxtail millet (GenBank Accession No. JN245628); and 99.6% between foxtail millet and proso millet. In addition, sequence comparisons showed 96 to 99% identity with known RSV sequences available in GenBank (Accession No. X53563) (4). To our knowledge, this is the first report of RSV of proso millet in South Korea. The finding of this disease confirms further spread of the virus within the northern part of South Korea and the need for research to develop more effective management options to reduce the impact of RSV in proso millet. References: (1) Y. Y. Choi et al. Biosci. Biotechnol. Biochem. 69:31, 2005. (2) B. C. Lee et al. Res. Plant Dis. 10:30, 2004. (3) B. C. Lee et al. Res. Plant Dis. 14:210, 2008. (4) Y. Zhu. J. Gen. Virol. 72:763, 1991.

scholarly journals First report of cucurbit chlorotic yellows virus infecting cucumber in South Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Hae-Ryun Kwak ◽  
Hui-Seong Byun ◽  
Hong-Soo Choi ◽  
Jong-Woo Han ◽  
Chang-Seok Kim ◽  
...  
Keyword(s):  
Coat Protein ◽  
South Korea ◽  
East Asia ◽  
Rna Extraction ◽  
Rt Pcr ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Chlorotic Mottle ◽  
Cucurbit Chlorotic Yellows Virus

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

scholarly journals First Report of Leek yellow stripe virus in Garlic in the State of Guanajuato, Mexico

Plant Disease ◽  
2006 ◽  
Vol 90 (11) ◽  
pp. 1458-1458 ◽  
Author(s):  
L. Pérez-Moreno ◽  
Z. Córdova-Rosales ◽  
E. Barboza-Corona ◽  
Rafael Ramírez-Malagón ◽  
J. Ramírez-Lúa ◽  
...  
Keyword(s):  
Coat Protein ◽  
Blot Analysis ◽  
The State ◽  
Latent Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
First Report ◽  
Leek Yellow Stripe Virus ◽  
Virus Complex ◽  
Yellow Stripe ◽  
Rna Blot Analysis

Garlic (Allium sativum L.) can be affected by a virus complex (1) consisting of two potyviruses, Onion yellow dwarf virus (OYDV) and Leek yellow stripe virus (LYSV), and two carlaviruses, Garlic common latent virus (GCLV) and Shallot latent virus (SLV) (1). To identify the components of the virus complex that could be present in garlic plants in Guanajuato State, which is the second largest garlic producer in the country and where presumptive viral symptoms were initially observed in December 2004, a survey was carried out in six locations: San Miguel de Allende and San Luis de la Paz in northern Guanajuato; Irapuato and Villagrán in the central region; and Salamanca and Valle de Santiago in the southern part of the state. Enzyme-linked immunosorbent assay (ELISA) was carried out to detect LYSV, OYDV, GCLV, and SLV in 195 garlic leaf samples collected during January 2005 from plants with leaf yellow stripe, mosaic, enation, deformation, or dwarfism symptoms. A set of primers, previously reported and specific to the coat protein cistron of LYSV (1), were synthesized and used in a reverse transcriptase-polymerase chain reaction (RT-PCR). The amplified product (1,020 nucleotides) was cloned into plasmid pGEM T-Easy (Promega, Madison, WI) and sequenced (Gen-bank Accession No. DQ841554). Sequence analysis showed that the cloned DNA fragment shared 97% similarity with the coat protein cistron of LYSV isolate no. 3 from Okinawa (GenBank Accession No. AB194632). The fragment was then radioactively labelled and used as a probe in the RNA blot analysis of all samples to confirm the ELISA results of LYSV. Of the 195 samples, 64 tested positive by RNA blot analysis. Forty-one of these were also positive by ELISA for LYSV. Preliminary, positive ELISA results were also obtained for OYDV, GCLV and SLV. To our knowledge, this is the first report of LYSV in the State of Guanajuato and in Mexico. The correct identification of viruses present in garlic will help to use the appropriate strategies to reduce viral incidence in this garlic-producing region. Reference: (1) T. V. M. Fajardo et al. Fitopatol. Bras. 26:619, 2001.

scholarly journals First report of Botrytis cinerea causing gray mold on Astragalus membranaceus in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Mengjun Jin ◽  
Chengde Yang ◽  
Lijuan Wei ◽  
Lingxiao Cui ◽  
Yidan Wang ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Morphological Characteristics ◽  
Gray Mold ◽  
Gansu Province ◽  
Astragalus Membranaceus ◽  
Management Options ◽  
Tissue Samples ◽  
First Report ◽  
Average Size ◽  
The Impact

Astragalus membranaceus, known as Huang-qi, is a perennial herbal medicine plant that grows 50 to 150 cm high, with 13 to 31 small leaves (Fu et al. 2014). In September 2019, a disease investigation was conducted in Weiyuan, Gansu province, China, while the weather was rainy and cool. In 50% of the investigated fields (n=10, the average size of 10 fields is 0.14 ha), visible gray mold was observed on the stems of A. membranaceus. Approximately 30%-50% of the stems in those fields were withered and necrotic, with abundant dark brown mold due to presence of conidiophores. To further determine the causal agent of disease, 12 symptomatic samples were collected from 4 different fields (3 symptomatic samples per field). The stem samples were disinfected with 10% sodium hypochlorite for 1 minute, cut into pieces (2 to 3mm × 10 mm, n=12), rinsed 3 times with sterile water, and dried on sterile tissue. Samples were then placed on potato dextrose agar (PDA), 3 pieces per plate, which were incubated at 25℃ in the dark. After 3 days, hyphal tips growing from the disinfected tissues were individually transferred to new PDA plates and incubated at 25℃ in the dark. From the ten isolates obtained, GWT6-2 was chosen as a representative isolate for further study. Colonies of GWT6-2 had gray aerial mycelia with the margins that eventually turned taupe. In addition, some black and hard sclerotia (1.93 to 12.21 mm × 1.29 to 11.57 mm, n=20) with round or irregular shape developed on the colonies after approximately 10 days of incubation at 25℃ in the dark. Hyaline and round or elliptical conidia (7.86 to 14.53 μm × 6.81 to 11.79 μm, n=50) were attached on the top of brown conidiophores. Based on morphological characteristics, the isolate was initially identified as Botrytis sp. (Ellis 1971). For pathogenicity tests, 5 mm agar plugs prepared from 1-week-old cultures of GWT6-2 were placed on four stabbed stems of A. membranaceus (planted in flowerpots, 230 × 170 mm). A similar number of plants inoculated with PDA plugs (5 mm) were used as control, and the assay was replicated 3 times. All the treatments were kept in plastic buckets with a temperature of 20℃-25℃ and relative humidity of 80%-90%. After 48h, the agar plugs were removed, and the plants were maintained in the plastic buckets for 3-4 days. Waterlogged spots developed on the inoculated stems of A. membranaceus 3 days after inoculation, which elongated to 3-5cm after 4-5 days of inoculation, and the gray mold that appeared on the diseased lesions was similar to that observed in the fields. The pathogen was reisolated from diseased tissues, and the cultural (colonies) and microscopic characteristics (conidia and conidiophores) were similar to those of original isolate. However, controls were asymptomatic. To further identify the species, the genomic DNA of GWT6-2 was extracted, and the internal transcribed spacer (ITS), heat shock protein (HSP60) and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) genes were amplified with the primers ITS1/ITS4 (White et al. 1990), HSP60-F/HSP60-R and G3PDH-F/G3PDH-R (Staats et al. 2005), respectively. The PCR amplicons were sequenced and compared to other sequences in GenBank using BLAST. The results indicated that the ITS, HSP60 and G3PDH sequences of GWT6-2 (MT225784.1, MT230538.1, MT263015.1) were 99.08%, 100% and 99.25% identical to the sequences of B. cinerea strain GZFQ-1 (MH454037.1, MH479931.1, MH479930.1) and B. cinerea isolate 5-3 (MH718836.1, MH796663.1, MH796662.1), respectively. A multilocus phylogenetic tree was constructed with the ITS, HSP60 and G3PDH reference sequences, and the result revealed that the grouping of strain GWT6-2 was supported by 99% bootstrap value. Based on the morphological characteristics and molecular identification, the strain GWT6-2 was eventually identified as Botrytis cinerea. To our knowledge, this is the first report of B. cinerea causing gray mold on the stems of A. membranaceus in China. The occurrence of B. cinerea may affects the aerial growth of A. membranaceus resulting in economic yield losses of this important medicinal plant. Therefore, further investigations into the impact of this pathogen on A. membranaceus growth and management options are needed.

scholarly journals First Report of Shallot virus X in Onion in Sudan

Plant Disease ◽  
2012 ◽  
Vol 96 (7) ◽  
pp. 1075-1075 ◽  
Author(s):  
K. Hamed ◽  
W. Menzel ◽  
M. E. Mohamed ◽  
G. Dafallah ◽  
A. M. A. Gadelseed ◽  
...  
Keyword(s):  
Coat Protein ◽  
Disease Incidence ◽  
Sandwich Elisa ◽  
Research Station ◽  
New Disease ◽  
Rt Pcr ◽  
Cycle Sequencing ◽  
First Report ◽  
Sequence Identity ◽  
The Impact

Onion (Alium cepa L.) is among the most important vegetable field crops in Sudan. During a disease survey in crops (cvs. Kamleen Yellow and Abu-freua) conducted in 2010, samples showing mild mottling symptoms were collected from Shambat Research Station Farm, Khartoum North, Sudan. A CF-11 cellulose chromatography dsRNA preparation (4) of a mixed onion leaf sample of five plants (20 g) resulted, apart from smaller dsRNAs up to 3 kbp, in a high molecular weight dsRNA of approximately 9 kbp. This dsRNA was used as a template for a random reverse transcriptase (RT)-PCR followed by cloning (4) and sequencing of two randomly selected clones by the ABI BigDye Terminator v3.1 Cycle Sequencing Kit. Comparison with sequences available at GenBank revealed high identities to Shallot virus X (ShVX). ShVX is the type member of the genus Allexivirus (Alphaflexiviridae). One sequence obtained showed 84% nt and 98% aa sequence identity (genome position 414 to 1,285 of Accession No. M97264) to the replicase, whereas the other sequence partially covered the ORF4 and coat protein (CP) coding region (7,127 to 7,998). This sequence showed 80% nt (entire sequence) and 80/89% aa sequence identity to the ORF4 encoded protein/coat protein of a Russian ShVX isolate, respectively. ShVX was first reported in shallot in Russia (2) and subsequently in the Netherlands, Germany, India (3), and New Zealand (1). To confirm the presence of ShVX in Sudan, 32 symptomatic leaf samples were collected in 2011 from different onion fields in Khartoum North, with a similar disease incidence compared to 2010. Thirty-one of these onion samples reacted positively in a double antibody sandwich-ELISA with a ShVX-specific antiserum (DSMZ AS-1042). Total RNA was extracted from five ShVX-ELISA positive onion samples using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. Two primer pairs were also designed on the basis of sequences obtained in the random RT-PCR approach, targeting a 659-bp fragment of the coat protein region (ShVX-CPs 5′GTTGAATGTGGCGAGCGCAA3′ and ShVX-CPas 5′AGTGCAGAAGCCTTCCACA3′) or a 686-bp fragment of the replicase (ShVX-Rs 5′ATGTACTTCGGTACGGCATCA3′ and ShVX-R-as 5′TAATCGAATGAGGTCGGCCA3′). Fragments of the expected sizes were obtained for all positive samples. One RT-PCR product of each primer pair was directly sequenced, showing high sequence identities to those previously obtained (>98%). The random RT-PCR sequences obtained in this study were submitted to GenBank (JQ751056 and JQ751057). On the basis of the nucleotide sequences obtained with the dsRNA template, ShVX specific RT-PCR, and ELISA, the presence of ShVX in Sudan was confirmed in two consecutive years. To our knowledge, this is the first report of ShVX in Sudan and Africa, indicating this virus is more widespread than previously reported. The presence of ShVX also suggests the presence of its only known vector, the mite Aceria tulipae. The virus may have been introduced to Sudan by infected onion sets. Even if the impact of ShVX on onion production has not been determined, its identification and the availability of a diagnostic antiserum may be helpful to select virus-free propagation material in order to achieve sustainable onion production in Sudan. References: (1) Z. Egusquiza et al. New Disease Reports 18:29, 2008. (2) K. V. Kanyuka et al. J. Gen. Virol. 73:2553, 1992. (3) S. Majumder et al. New Disease Reports 15:52, 2007. (4) W. Menzel et al. Arch. Virol. 154:1343, 2009.

Maternal-Fetal Management in Trombophilia Related and Placenta-Mediated Pregnancy Complications

2018 ◽  
Vol 69 (9) ◽  
pp. 2396-2401
Author(s):  
Costin Berceanu ◽  
Elena Loredana Ciurea ◽  
Monica Mihaela Cirstoiu ◽  
Sabina Berceanu ◽  
Anca Maria Ofiteru ◽  
...  
Keyword(s):  
Pregnant Women ◽  
Pregnancy Complications ◽  
Case Control Study ◽  
Case Control ◽  
Placental Insufficiency ◽  
Management Options ◽  
Specific Therapy ◽  
Pregnancy Morbidity ◽  
The Impact ◽  
Control Study

It is widely accepted that thrombophilia in pregnancy greatly increases the risk of venous thromboembolism. Pregnancy complications arise, at least partly, from placental insufficiency. Any change in the functioning of the gestational transient biological system, such as inherited or acquired thrombophilia, might lead to placental insufficiency. In this research we included 64 pregnant women with trombophilia and 70 cases non-trombophilic pregnant women, with or without PMPC, over a two-year period. The purpose of this multicenter case-control study is to analyze the maternal-fetal management options in obstetric thrombophilia, the impact of this pathology on the placental structure and possible correlations with placenta-mediated pregnancy complications. Maternal-fetal management in obstetric thrombophilia means preconceptional or early diagnosis, prevention of pregnancy morbidity, specific therapy as quickly as possible and fetal systematic surveilance to identify the possible occurrence of placenta-mediated pregnancy complications.

Changes in Chemical Components of Foxtail Millet, Proso Millet, and Sorghum with Germination

2011 ◽  
Vol 40 (8) ◽  
pp. 1128-1135 ◽  
Author(s):  
Jee-Yeon Ko ◽  
Seuk-Bo Song ◽  
Jae-Saeng Lee ◽  
Jong-Rae Kang ◽  
Myung-Chul Seo ◽  
...  
Keyword(s):  
Foxtail Millet ◽  
Chemical Components ◽  
Proso Millet

Antioxidant Compounds and Activities of Foxtail Millet, Proso Millet and Sorghum with Different Pulverizing Methods

2011 ◽  
Vol 40 (6) ◽  
pp. 790-797 ◽  
Author(s):  
Myung-Chul Seo ◽  
Jee-Yeon Ko ◽  
Seuk-Bo Song ◽  
Jae-Saeng Lee ◽  
Jong-Rae Kang ◽  
...  
Keyword(s):  
Foxtail Millet ◽  
Antioxidant Compounds ◽  
Proso Millet

Disability, Stigma, and Children's Developing Selves

2019 ◽  
Author(s):  
Misa Kayama ◽  
Wendy Haight ◽  
May-Lee Ku ◽  
Minhae Cho ◽  
Hee Yun Lee
Keyword(s):  
South Korea ◽  
Inclusive Education ◽  
Children With Disabilities ◽  
Cultural Psychology ◽  
Peer Group ◽  
Individual Development ◽  
Typically Developing ◽  
Everyday Lives ◽  
The Impact ◽  
The U.S

Stigmatization is part of the everyday lives of children with disabilities, their families, and their friends. Negative social encounters, even with perfect strangers, can dampen joyful occasions, add stress to challenging situations, and lead to social isolation. This book describes a program of research spanning a decade that seeks to understand disabilities in their developmental and cultural contexts. The authors are especially interested in understanding adults’ socialization practices that promise to reduce stigmatization in the next generation. Guided by developmental cultural psychology, including the concept of “universalism without uniformity,” the authors focus on the understandings and responses to disability and associated stigmatization of elementary-school educators practicing in Japan, South Korea, Taiwan, and the U.S. Educators from all four cultural groups expressed strikingly similar concerns about the impact of stigmatization on the emerging cultural self, both of children with disabilities and their typically developing peers. Educators also described culturally nuanced socialization goals and practices pertaining to inclusive education. In Japan, for instance, educators emphasized the importance of peer group belonging and strategies to support the participation of children with disabilities. In the U.S., educators placed relatively more emphasis on individual development and discussed strategies for the equitable treatment of children with disabilities. Educators in South Korea and Taiwan emphasized the cultivation of compassion in typically developing children. The understanding gained through examination of how diverse individuals address common challenges using cultural resources available in their everyday lives provides important lessons for strengthening theory, policy, and programs.

Sign in / Sign up

Export Citation Format

Share Document