First report of Microdochium nivale and M. majus associated with brown foot rot of wheat in China

Microdochium nivale and M. majus not only cause seedling blight of wheat (Triticum aestivum L.) in cold dry soils, but also cause foot rot and ear blight of wheat under favorable conditions (Haigh et al. 2009). In May 2017, 2019, and 2020, a serious foot rot of wheat with an incidence of 92%, 45%, and 51% was observed in the field in Xiangcheng County (33.43° N, 114.84° E), Tanghe County (32.43° N, 112.66° E), and Linzhou City (36.13° N, 113.75° E), Henan Province, respectively. The serious brown lesions of the lower leaf sheaths is visible. The pathogens were isolated from brown leaf sheaths on potato dextrose agar (PDA) after being surface-sterilized (70% EtOH for 30 s followed by 3% NaClO for 1.5 min) and rinsed three times in sterile distilled water. After 5 d, mycelia were transferred to fresh PDA, and nine representative isolates (G17ZK2-1, G17ZK2-2, G17ZK2-3, g19TH10-4, g19TH10-5, g19TH10-6, G20LZ1-6, G20LZ1-7, and G20LZ1-8) were further purified by hyphal tipping. Species were identified based on morphological characteristics, and sequence analysis of partial sequences of the translation elongation factor-1α (TEF), the RNA polymerase II subunit (RPB2) gene and β-tubulin gene (Abdelhalim et al. 2020). Among the nine isolates, six isolates belonged to M. majus, three isolates belonged to M. nivale. Sequences of six isolates M. majus and three isolates M. nivale were deposited in GenBank with accession numbers MW428296-MW428298, MZ734119-MZ734121and MZ734139-MZ734141(TEF), MW384889, MW428291, MW428292, MZ734203-MZ734205 and MZ734161-MZ734163(RPB2), MW428293-MW428295, MZ501004-MZ501006 and MZ501024-MZ501026 (β-tubulin). For all the genes, isolates revealed 98-100% similarity to M. majus and M. nivale accessions, respectively. Microscopy of the six M. majus isolates showed: the conidia were falcate, straight to curved, apex pointed or obtuse to subacute, lacking basal differentiation, with 1 to 6 septa, 3.6 to 5.0 × 15.0 to 30.5 μm (av.= 4.5 × 23.2; n = 60). The three M. nivale isolates showed: the conidia were hyaline, 1 to 3 septa, 2.4 to 4.4 × 11.9 to 26.0 μm (av.= 3.5 × 14.7; n = 60). Perithecia of M. majus are dark brown, globose, and 95.2 to 190.5 × 95.2 to 228.6 μm (av.= 144.4 ×152.5; n = 30). Asci are clavate, and 6.8 to 11.0 ×68.2 to 77.3 μm (av.= 8.6×72.0; n = 30), contain eight ascospores. Mature ascospores are ellipsoidal, and 3.8 to 4.9 ×11.5 to 19.2 μm (av.= 4.0 ×15.2; n = 30), with 1 to 3 septa. These morphological characteristics were consistent with previous descriptions of these two species (Glynn et al. 2005). For pathogenicity tests, mycelia of M. nivale and M. majus was prepared using the modified procedure of Zhang et al. (2015). Two-week-old healthy wheat seedlings (cv. Aikang 58) were inoculated using 1 mL of prepared mycelia to one seedling, which was sprayied on soil. Control seedlings were inoculated with 1 mL distilled water containing 0.2% gelatin. After 10 days under 15/10℃, 16h/8h, all the inoculated plants had developed brown spots; while control plants remained healthy. The pathogens were reisolated from inoculated plants and identified as M. nivale and M. majus based on morphological characteristics and molecular methods described above. Although there are reports of M. majus associated with brown foot rot of wheat in Anhui Province and M. nivale associated with seedling blight of oat in Gansu Province (Chen et al. 2021; Tai et al. 2019). To our knowledge, this is the first report of brown foot rot of wheat caused by M. nivale and M. majus in China.

Download Full-text

First Report of Seedling Blight of Oat (Avena sativa) Caused by Microdochium nivale in China

Plant Disease ◽

10.1094/pdis-10-19-2139-pdn ◽

2020 ◽

Author(s):

Hao Chen ◽

Gui Qiao Liu ◽

Longhai Xue ◽

Chunjie Li ◽

Guiqin Zhao ◽

...

Keyword(s):

Rna Polymerase Ii ◽

Dna Sequences ◽

Avena Sativa ◽

Morphological Characteristics ◽

Gansu Province ◽

Microdochium Nivale ◽

Seedling Blight ◽

Single Spore ◽

First Report ◽

Millet Seed

Oat (Avena sativa) is extensively planted as a fodder crop on the vast ranges of northern and northwestern China, and it has become an important supplementary feed for grazing livestock (Yang et al. 2010). Microdochium nivale has been reported associated with seedling blight in many temperate regions (Imathiu et al. 2010) and the damage can result in serious loss of oat production. In August 2018, a serious seedling blight of oat (cv. Baiyan 7; about 30-day-old) was observed in the field in Shandan County, Zhangye City, Gansu Province (38.22° N, 101.22° E). More than 20% of oat plants were severely affected. Symptoms included leaf chlorosis and wilt. The root systems of infected plants were black and severely rotted, often with only a small amount of fine root remaining after removal from the soil. Twenty isolations were made from blackened roots on potato dextrose agar (PDA) and five isolations (TM-1, TM-2, TM-3, TM-4 and TM-5) were further purified by a single-spore method (Choi et al. 1999). Each isolate was identical based on preliminary molecular analyses of their DNA sequences of ITS by blast in the NCBI GenBank. The representative isolate TM-2 was selected for sequencing of the RNA polymerase II subunit (RPB2) gene. The isolated colonies were grown on PDA and formed colonies of approximately 62 mm (diameter) in 5 days at 25 ± 1 °C. Colonies exhibited entire margins, the color varied from white to pale yellow, and the sparse aerial mycelium were villous-floccose and cottony. The conidia were falcate, straight to curved, apex pointed or obtuse to subacute, lacking basal differentiation, 0-3-septate, most one-septate, 2.2 to 3.1 × 12.3 to 22.6μm (av.= 2.8 ×17.6; n=50). These morphological characteristics were consistent with previous descriptions of Microdochium (Zhang et al. 2010). Molecular identity was confirmed by sequencing partial sequences of ITS gene (ITS1 and ITS4 primers) (White et al. 1990) and RPB2 regions (RPB2-5f2 and RPB2-7cr) (O’Donnell et al. 2010). Sequences were deposited in GenBank under accessions MN428647 (RPB2) and MN428646 (ITS). Blast search revealed that both of the ITS and RPB2 sequences to be 99% similar to the corresponding sequences of M. nivale(CBS 116205) accession numbers KP859008.1 and KP859117.1. For pathogenicity tests, millet seed-based inoculum of M. nivale was prepared using a modified procedure of Fang et al. (2011). Three-week-old healthy oat seedlings of cv. Baiyan 7 were transplanted into potting mix containing millet seed-based inoculum of M. nivale at a rate of 3%. Control seedlings for comparison were transplanted into pots containing uninoculated potting mix. After 10 days, all the inoculated plants had developed seedling blight symptoms and that were similar to those observed in the field; while control plants remained healthy. The pathogen was reisolated from inoculated plants and identified as M. nivale based on morphological characteristics and the molecular methods described above. To our knowledge, this is the first report of seedling blight of oat caused by M. nivale in China.

Download Full-text

First Report of Fusarium Maize Ear Rot Caused by Fusarium kyushuense in China

Plant Disease ◽

10.1094/pdis-05-13-0558-pdn ◽

2014 ◽

Vol 98 (2) ◽

pp. 279-279 ◽

Cited By ~ 2

Author(s):

J.-H. Wang ◽

H.-P. Li ◽

J.-B. Zhang ◽

B.-T. Wang ◽

Y.-C. Liao

Keyword(s):

Fusarium Species ◽

Morphological Characteristics ◽

Distilled Water ◽

Ear Rot ◽

Tubulin Gene ◽

Average Growth ◽

First Report ◽

Maize Ear Rot ◽

Maize Ear ◽

Β Tubulin

From September 2009 to October 2012, surveys to determine population structure of Fusarium species on maize were conducted in 22 provinces in China, where the disease incidence ranged from 5 to 20% in individual fields. Maize ears with clear symptoms of Fusarium ear rot (with a white to pink- or salmon-colored mold at the ear tip) were collected from fields. Symptomatic kernels were surface-sterilized (1 min in 0.1% HgCl2, and 30 s in 70% ethanol, followed by three rinses with sterile distilled water), dried, and placed on PDA. After incubation for 3 to 5 days at 28°C in the dark, fungal colonies displaying morphological characteristics of Fusarium spp. (2) were purified by transferring single spores and identified to species level by morphological characteristics (2), and DNA sequence analysis of translation elongation factor-1α (TEF) and β-tubulin genes. A large number of Fusarium species (mainly F. graminearum species complex, F. verticillioides, and F. proliferatum) were identified. These Fusarium species are the main causal agents of maize ear rot (2). Morphological characteristics of six strains from Anhui, Hubei, and Yunnan provinces were found to be identical to those of F. kyushuense (1), which was mixed with other Fusarium species in the natural infection in the field. Colonies grew fast on PDA with reddish-white and floccose mycelia. The average growth rate was 7 to 9 mm per day at 25°C in the dark. Reverse pigmentation was deep red. Microconidia were obovate, ellipsoidal to clavate, and 5.4 to 13.6 (average 8.8) μm in length. Macroconidia were straight or slightly curved, 3- to 5-septate, with a curved and acute apical cell, and 26.0 to 50.3 (average 38.7) μm in length. No chlamydospores were observed. Identity of the fungus was further investigated by sequence comparison of the partial TEF gene (primers EF1/2) and β-tubulin gene (primers T1/22) of one isolate (3). BLASTn analysis of the TEF amplicon (KC964133) and β-tubulin gene (KC964152) obtained with cognate sequences available in GenBank database revealed 99.3 and 99.8% sequence identity, respectively, to F. kyushuense. Pathogenicity tests were conducted twice by injecting 2 ml of a prepared spore suspension (5 × 105 spores/ml) into maize ears (10 per isolate of cv. Zhengdan958) through silk channel 4 days post-silk emergence under field conditions in Wuhan, China. Control plants were inoculated with sterile distilled water. The ears were harvested and evaluated 30 days post-inoculation. Reddish-white mold was observed on inoculated ears and the infected kernels were brown. No symptoms were observed on water controls. Koch's postulates were fulfilled by re-isolating the pathogen from infected kernels. F. kyushuense, first described on wheat in Japan (1), has also been isolated from rice seeds in China (4). It was reported to produce both Type A and Type B trichothecene mycotoxins (1), which cause toxicosis in animals. To our knowledge, this is the first report of F. kyushuense causing maize ear rot in China and this disease could represent a serious risk of yield losses and mycotoxin contamination in maize and other crops. The disease must be considered in existing disease management practices. References: (1) T. Aoki and K. O'Donnell. Mycoscience 39:1, 1998. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006. (3) F. Van Hove et al. Mycologia 103:570, 2011. (4) Z. H. Zhao and G. Z. Lu. Mycotaxon 102:119, 2007.

Download Full-text

First Report of Anthracnose Caused by Colletotrichum tabaci on green pepper (Capsicum annuum) in China

Plant Disease ◽

10.1094/pdis-07-21-1383-pdn ◽

2021 ◽

Author(s):

Lijuan Wei ◽

Chengde Yang ◽

Richard Osei ◽

Lingxiao Cui ◽

Mengjun Jin ◽

...

Keyword(s):

Capsicum Annuum ◽

Light Condition ◽

Morphological Characteristics ◽

Gansu Province ◽

Distilled Water ◽

Sequencing Analysis ◽

Dark Halo ◽

Green Pepper ◽

First Report ◽

Pepper Leaves

Vitamins, capsaicin and capsochrome are abundant in pepper (Capsicum annuum), a fruit that is also used as a spice. During hot and rainy seasons, anthracnose disease caused by Colletotrichum spp. affects pepper crops and causes significant yield losses in the pre- and post-harvest stages(Liu et al. 2016). Unidentified disease spots were discovered on peppers leaves in a field in Wei yuan (35°8'10" N, 104°12'54" E), Gansu Province, China, in September 2019. The diseases was found to have a 100% incidence in a 0.07-ha area, which drew our attention. The lesions were mostly found in the middle and upper parts of the leaves, and the symptoms mostly showed up as roughly circular patches on the leaves with dark brown, and yellowish center. 18 tissues with a diameter of 1 cm were obtained from the line between healthy and diseased portions. They were sterilized for 45 s in 1% mercuric chloride, then rinsed 5 times in sterile distilled water and dried with sterile filter paper. After 4 days of culture on a plate with a PDA media 5 strains were recovered from the treated tissue. Healthy pepper plants grown in the lab were inoculated with conidia suspension (50 mL, 107 conidia/mL) for pathogenicity while sterile distilled water was used as control. Each treatment had three duplicates. Leaves infected with the BYL strain 16 days later showed obvious symptoms, which were comparable to those found in the field. The control leaves showed no sign of disease. The pathogen was re-isolated from the infected pepper leaves and it had the same features as strain BYL. Koch's postulate was proven correct. The BYL colony started out white, then turned gray-brown with black sclerotia in the center. Conidia were hyaline, smooth, cylindrical, typically straight, with rounded ends, and ranged in size from11.754-16.477(14.587±0.139×2.833-4.220(3.348±0.037) μm. Appressoria solitary or in loose clusters, 6.910-9.078×5.386-7.119 μm in size, medium brown, smooth-walled, ellipsoidal or irregular in form, with noticeable piercing pore with dark halo. The isolate was identified as Colletotrichum species based on the morphological characteristics (Damm et al. 2014).It was then re-identified using multi-molecular analysis. To amplify and sequence of the isolates, the genes ITS, TUB2, CHS1, ACT, GAPDH and HIS3 were employed (Weir et al. 2012, Crous et al. 2004). They were deposited in GenBank (MW581857 for ITS, MW595706 for ACT, MW595707 for CHS1, MW595708 for GAPDH, MW595709 for HIS3, and MW595710 for TUB2). The sequence of ITS, ACT, CHS1, and HIS3 in GenBank were found to be 100% identical to those of Colletotrichum tabaci (JQ005763 for ITS, KM105414 for ACT, JQ005784 for CHS1 and KM105346 for HIS3). The primers GAPDH and TUB2 amplified a gene sequence that was 99% identical to Colletotrichum tabaci in GenBank (KM105559 for GAPDH and JQ005847 for TUB2). Based on appearance and sequencing analysis, the isolate was identified as Colletotrichum tabaci. The optimal light condition for BYL growth was 12 h light/12 h dark cycle, temperature 30 o C, pH 8, sucrose as carbon source, and yeast extract as nitrogen source according to the biological features. Colletotrichum tabaci caused anthracnose in peppers in the field. This is the first report of Colletotrichum tabaci causing anthracnose in peppers in China that we are aware of.

Download Full-text

First Report of Flyspeck Caused by Zygophiala wisconsinensis on Sweet Persimmon Fruit in Korea

Plant Disease ◽

10.1094/pdis-12-10-0917 ◽

2011 ◽

Vol 95 (5) ◽

pp. 616-616 ◽

Cited By ~ 1

Author(s):

J. Kim ◽

O. Choi ◽

J.-H. Kwon

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Its Rdna ◽

Control Treatment ◽

Diospyros Kaki ◽

Distilled Water ◽

First Report ◽

Persimmon Fruit ◽

Fungal Isolates ◽

Agar Disc

Sweet persimmon (Diospyros kaki L.), a fruit tree in the Ebenaceae, is cultivated widely in Korea and Japan, the leading producers worldwide (2). Sweet persimmon fruit with flyspeck symptoms were collected from orchards in the Jinju area of Korea in November 2010. The fruit had fungal clusters of black, round to ovoid, sclerotium-like fungal bodies with no visible evidence of a mycelial mat. Orchard inspections revealed that disease incidence ranged from 10 to 20% in the surveyed area (approximately 10 ha) in 2010. Flyspeck symptoms were observed on immature and mature fruit. Sweet persimmon fruit peels with flyspeck symptoms were removed, dried, and individual speck lesions transferred to potato dextrose agar (PDA) and cultured at 22°C in the dark. Fungal isolates were obtained from flyspeck colonies on 10 sweet persimmon fruit harvested from each of three orchards. Fungal isolates that grew from the lesions were identified based on a previous description (1). To confirm identity of the causal fungus, the complete internal transcribed spacer (ITS) rDNA sequence of a representative isolate was amplified and sequenced using primers ITS1 and ITS4 (4). The resulting 552-bp sequence was deposited in GenBank (Accession No. HQ698923). Comparison with ITS rDNA sequences showed 100% similarity with a sequence of Zygophiala wisconsinensis Batzer & Crous (GenBank Accession No. AY598855), which infects apple. To fulfill Koch's postulates, mature, intact sweet persimmon fruit were surface sterilized with 70% ethanol and dried. Three fungal isolates from this study were grown on PDA for 1 month. A colonized agar disc (5 mm in diameter) of each isolate was cut from the advancing margin of a colony with a sterilized cork borer, transferred to a 1.5-ml Eppendorf tube, and ground into a suspension of mycelial fragments and conidia in a blender with 1 ml of sterile, distilled water. The inoculum of each isolate was applied by swabbing a sweet persimmon fruit with the suspension. Three sweet persimmon fruit were inoculated per isolate. Three fruit were inoculated similarly with sterile, distilled water as the control treatment. After 1 month of incubation in a moist chamber at 22°C, the same fungal fruiting symptoms were reproduced as observed in the orchards, and the fungus was reisolated from these symptoms, but not from the control fruit, which were asymptomatic. On the basis of morphological characteristics of the fungal colonies, ITS sequence, and pathogenicity to persimmon fruit, the fungus was identified as Z. wisconsinensis (1). Flyspeck is readily isolated from sweet persimmon fruit in Korea and other sweet persimmon growing regions (3). The exposure of fruit to unusual weather conditions in Korea in recent years, including drought, and low-temperature and low-light situations in late spring, which are favorable for flyspeck, might be associated with an increase in occurrence of flyspeck on sweet persimmon fruit in Korea. To our knowledge, this is the first report of Z. wisconsinensis causing flyspeck on sweet persimmon in Korea. References: (1) J. C. Batzer et al. Mycologia 100:246, 2008. (2) FAOSTAT Database. Retrieved from http://faostat.fao.org/ , 2008. (3) H. Nasu and H. Kunoh. Plant Dis. 71:361, 1987. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990.

Download Full-text

First report of Coniella castaneicola causing leaf blight on blueberry (Vaccinium virgatum) in China

Plant Disease ◽

10.1094/pdis-05-21-1122-pdn ◽

2021 ◽

Author(s):

Jiahao Lai ◽

Guihong Xiong ◽

Bing Liu ◽

Weigang Kuang ◽

Shuilin Song

Keyword(s):

Molecular Identification ◽

Morphological Characteristics ◽

Leaf Blight ◽

Yield Potential ◽

Effective Control ◽

Economic Losses ◽

Distilled Water ◽

First Report ◽

Fungal Isolates ◽

Blight Disease

Blueberry (Vaccinium virgatum), an economically important small fruit crop, is characterized by its highly nutritive compounds and high content and wide diversity of bioactive compounds (Miller et al. 2019). In September 2020, an unknown leaf blight disease was observed on Rabbiteye blueberry at the Agricultural Science and Technology Park of Jiangxi Agricultural University in Nanchang, China (28°45'51"N, 115°50'52"E). Disease surveys were conducted at that time, the results showed that disease incidence was 90% from a sampled population of 100 plants in the field, and this disease had not been found at other cultivation fields in Nanchang. Leaf blight disease on blueberry caused the leaves to shrivel and curl, or even fall off, which hindered floral bud development and subsequent yield potential. Symptoms of the disease initially appeared as irregular brown spots (1 to 7 mm in diameter) on the leaves, subsequently coalescing to form large irregular taupe lesions (4 to 15 mm in diameter) which became curly. As the disease progressed, irregular grey-brown and blighted lesion ran throughout the leaf lamina from leaf tip to entire leaf sheath and finally caused dieback and even shoot blight. To identify the causal agent, 15 small pieces (5 mm2) of symptomatic leaves were excised from the junction of diseased and healthy tissue, surface-sterilized in 75% ethanol solution for 30 sec and 0.1% mercuric chloride solution for 2 min, rinsed three times with sterile distilled water, and then incubated on potato dextrose agar (PDA) at 28°C for 5-7 days in darkness. Five fungal isolates showing similar morphological characteristics were obtained as pure cultures by single-spore isolation. All fungal colonies on PDA were white with sparse creeping hyphae. Pycnidia were spherical, light brown, and produced numerous conidia. Conidia were 10.60 to 20.12 × 1.98 to 3.11 µm (average 15.27 × 2.52 µm, n = 100), fusiform, sickle-shaped, light brown, without septa. Based on morphological characteristics, the fungal isolates were suspected to be Coniella castaneicola (Cui 2015). To further confirm the identity of this putative pathogen, two representative isolates LGZ2 and LGZ3 were selected for molecular identification. The internal transcribed spacer region (ITS) and large subunit (LSU) were amplified and sequenced using primers ITS1/ITS4 (Peever et al. 2004) and LROR/LR7 (Castlebury and Rossman 2002). The sequences of ITS region (GenBank accession nos. MW672530 and MW856809) showed 100% identity with accessions numbers KF564280 (576/576 bp), MW208111 (544/544 bp), MW208112 (544/544 bp) of C. castaneicola. LSU gene sequences (GenBank accession nos. MW856810 to 11) was 99.85% (1324/1326 bp, 1329/1331 bp) identical to the sequences of C. castaneicola (KY473971, KR232683 to 84). Pathogenicity was tested on three blueberry varieties (‘Rabbiteye’, ‘Double Peak’ and ‘Pink Lemonade’), and four healthy young leaves of a potted blueberry of each variety with and without injury were inoculated with 20 μl suspension of prepared spores (106 conidia/mL) derived from 7-day-old cultures of LGZ2, respectively. In addition, four leaves of each variety with and without injury were sprayed with sterile distilled water as a control, respectively. The experiment was repeated three times, and all plants were incubated in a growth chamber (a 12h light and 12h dark period, 25°C, RH greater than 80%). After 4 days, all the inoculated leaves started showing disease symptoms (large irregular grey-brown lesions) as those observed in the field and there was no difference in severity recorded between the blueberry varieties, whereas the control leaves showed no symptoms. The fungus was reisolated from the inoculated leaves and confirmed as C. castaneicola by morphological and molecular identification, fulfilling Koch’s postulates. To our knowledge, this is the first report of C. castaneicola causing leaf blight on blueberries in China. The discovery of this new disease and the identification of the pathogen will provide useful information for developing effective control strategies, reducing economic losses in blueberry production, and promoting the development of the blueberry industry.

Download Full-text

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽

10.1094/pdis-94-9-1168c ◽

2010 ◽

Vol 94 (9) ◽

pp. 1168-1168

Author(s):

R. S. Trivedi ◽

J. G. Hampton ◽

J. M. Townshend ◽

M. V. Jaspers ◽

H. J. Ridgway

Keyword(s):

New Zealand ◽

Morphological Characteristics ◽

New Taxon ◽

First Report ◽

Agar Plug ◽

Carrot Seed ◽

Agar Media ◽

Leaves And Roots ◽

Seed Crops ◽

Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Download Full-text

First Report of Black Stem of Avicennia marina Caused by Fusarium equiseti in China

Plant Disease ◽

10.1094/pdis-08-13-0873-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 843-843 ◽

Cited By ~ 6

Author(s):

N.-H. Lu ◽

Q.-Z. Huang ◽

H. He ◽

K.-W. Li ◽

Y.-B. Zhang

Keyword(s):

Morphological Characteristics ◽

Its Region ◽

Avicennia Marina ◽

Optical Microscope ◽

Ethanol Solution ◽

Morphological Observation ◽

Fusarium Equiseti ◽

First Report ◽

Initial Symptoms ◽

Β Tubulin

Avicennia marina is a pioneer species of mangroves, a woody plant community that periodically emerges in the intertidal zone of estuarine regions in tropical and subtropical regions. In February 2013, a new disease that caused the stems of A. marina to blacken and die was found in Techeng Island of Zhanjiang, Guangdong Province, China. Initial symptoms of the disease were water-soaked brown spots on the biennial stems that coalesced so whole stems browned, twigs and branches withered, leaves defoliated, and finally trees died. This disease has the potential to threaten the ecology of the local A. marina community. From February to May 2013, 11 symptomatic trees were collected in three locations on the island and the pathogen was isolated as followed: tissues were surface disinfected with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 45 s, rinsed with sterilized water three times, dried, placed on potato dextrose agar (PDA), and incubated for 3 to 5 days at 28°C without light. Five isolates (KW1 to KW5) with different morphological characteristics were obtained, and pathogenic tests were done according Koch's postulates. Fresh wounds were made with a sterile needle on healthy biennial stems of A. marina, and mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. All treated plants were incubated at room temperature. Similar symptoms of black stem were observed only on the stems inoculated the isolate KW5 after 35 days, while the control and all stems inoculated with the other isolates remained symptomless. An isolate similar to KW5 was re-isolated from the affected materials. The pathogenic test was repeated three times with the same conditions and it was confirmed that KW5 was the pathogen causing the black stem of A. marina. Hyphal tips of KW5 were transferred to PDA medium in petri dishes for morphological observation. After 48 to 72 h, white, orange, or brown flocculence patches of KW5 mycelium, 5.0 to 6.0 cm in diameter, grew. Tapering and spindle falciform macroconidia (11 to 17.3 μm long × 1.5 to 2.5 μm wide) with an obviously swelled central cell and narrow strips of apical cells and distinctive foot cells were visible under the optical microscope. The conidiogenous cells were intertwined with mycelia and the chlamydospores were globose and formed in clusters. These morphological characteristics of the isolate KW5 are characteristic of Fusarium equiseti (1). For molecular identification, the ITS of ribosomal DNA, β-tubulin, and EF-1α genes were amplified using the ITS4/ITS5 (5), T1/T2 (2), and EF1/EF2 (3) primer pairs. These sequences were deposited in GenBank (KF515650 for the ITS region; KF747330 for β-tubulin region, and KF747331 for EF-1α region) and showed 98 to 99% identity to F. equiseti strains (HQ332532 for ITS region, JX241676 for β-tubulin gene, and GQ505666 for EF-1α region). According to both morphological and sequences analysis, the pathogen of the black stem of A. marina was identified as F. equiseti. Similar symptoms on absorbing rootlets and trunks of A. marina had been reported in central coastal Queensland, but the pathogen was identified as Phytophthora sp. (4). Therefore, the disease reported in this paper differs from that reported in central coastal Queensland. To our knowledge, this is the first report of black stems of A. marina caused by F. equiseti in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, 1st ed. Wiley-Blackwell, Hoboken, NJ, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) K. G. Pegg. Aust et al. Plant Pathol. 3:6, 1980. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.

Download Full-text

First Report of Leaf Spot of Sweet Basil Caused by Cercospora guatemalensis in Korea

Plant Disease ◽

10.1094/pdis-05-12-0436-pdn ◽

2012 ◽

Vol 96 (10) ◽

pp. 1580-1580

Author(s):

J. H. Park ◽

K. S. Han ◽

J. Y. Kim ◽

H. D. Shin

Keyword(s):

Leaf Spot ◽

Morphological Characteristics ◽

Its Region ◽

Culture Collection ◽

Distilled Water ◽

First Report ◽

Sweet Basil ◽

Organic Farm ◽

Leaf Spots ◽

Close Phylogenetic Relationship

Sweet basil, Ocimum basilicum L., is a fragrant herb belonging to the family Lamiaceae. Originated in India 5,000 years ago, sweet basil plays a significant role in diverse cuisines across the world, especially in Asian and Italian cooking. In October 2008, hundreds of plants showing symptoms of leaf spot with nearly 100% incidence were found in polyethylene tunnels at an organic farm in Icheon, Korea. Leaf spots were circular to subcircular, water-soaked, dark brown with grayish center, and reached 10 mm or more in diameter. Diseased leaves defoliated prematurely. The damage purportedly due to this disease has reappeared every year with confirmation of the causal agent made again in 2011. A cercosporoid fungus was consistently associated with disease symptoms. Stromata were brown, consisting of brown cells, and 10 to 40 μm in width. Conidiophores were fasciculate (n = 2 to 10), olivaceous brown, paler upwards, straight to mildly curved, not geniculate in shorter ones or one to two times geniculate in longer ones, 40 to 200 μm long, occasionally reaching up to 350 μm long, 3.5 to 6 μm wide, and two- to six-septate. Conidia were hyaline, acicular to cylindric, straight in shorter ones, flexuous to curved in longer ones, truncate to obconically truncate at the base, three- to 16-septate, and 50 to 300 × 3.5 to 4.5 μm. Morphological characteristics of the fungus were consistent with the previous reports of Cercospora guatemalensis A.S. Mull. & Chupp (1,3). Voucher specimens were housed at Korea University herbarium (KUS). An isolate from KUS-F23757 was deposited in the Korean Agricultural Culture Collection (Accession No. KACC43980). Fungal DNA was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced. The resulting sequence of 548 bp was deposited in GenBank (Accession No. JQ995781). This showed >99% similarity with sequences of many Cercospora species, indicating their close phylogenetic relationship. Isolate of KACC43980 was used in the pathogenicity tests. Hyphal suspensions were prepared by grinding 3-week-old colonies grown on PDA with distilled water using a mortar and pestle. Five plants were inoculated with hyphal suspensions and five plants were sprayed with sterile distilled water. The plants were covered with plastic bags to maintain a relative humidity of 100% for 24 h and then transferred to a 25 ± 2°C greenhouse with a 12-h photoperiod. Typical symptoms of necrotic spots appeared on the inoculated leaves 6 days after inoculation, and were identical to the ones observed in the field. C. guatemalensis was reisolated from symptomatic leaf tissues, confirming Koch's postulates. No symptoms were observed on control plants. Previously, the disease was reported in Malawi, India, China, and Japan (2,3), but not in Korea. To our knowledge, this is the first report of C. guatemalensis on sweet basil in Korea. Since farming of sweet basil has recently started on a commercial scale in Korea, the disease poses a serious threat to safe production of this herb, especially in organic farming. References: (1) C. Chupp. A Monograph of the Fungus Genus Cercospora. Ithaca, NY, 1953. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology & Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , May 5, 2012. (3) J. Nishikawa et al. J. Gen. Plant Pathol. 68:46, 2002.

Download Full-text

First Report of Phytophthora drechsleri Associated with Stem and Foliar Blight of Gynura bicolor in Taiwan

Plant Disease ◽

10.1094/pdis-12-10-0931 ◽

2011 ◽

Vol 95 (7) ◽

pp. 874-874 ◽

Cited By ~ 1

Author(s):

Y. M. Shen ◽

C. H. Chao ◽

H. L. Liu

Keyword(s):

Disease Incidence ◽

Morphological Characteristics ◽

Hyphal Growth ◽

Pathogenicity Test ◽

Distilled Water ◽

First Report ◽

Foliar Blight ◽

Dual Cultures ◽

Phytophthora Drechsleri ◽

Gynura Bicolor

Gynura bicolor (Roxb. ex Willd.) DC., known as Okinawa spinach or hong-feng-cai, is a commonly consumed vegetable in Asian countries. In May 2010, plants with blight and wilt symptoms were observed in commercial vegetable farms in Changhua, Taiwan. Light brown-to-black blight lesions developed from the top of the stems to the petioles and extended to the base of the leaves. Severely infected plants declined and eventually died. Disease incidence was approximately 20%. Samples of symptomatic tissues were surface sterilized in 0.6% NaOCl and plated on water agar. A Phytophthora sp. was consistently isolated and further plated on 10% unclarified V8 juice agar, with daily radial growths of 7.6, 8.6, 5.7, and 2.4 mm at 25, 30, 35, and 37°C, respectively. Four replicates were measured for each temperature. No hyphal growth was observed at 39°C. Intercalary hyphal swellings and proliferating sporangia were produced in culture plates flooded with sterile distilled water. Sporangia were nonpapillate, obpyriform to ellipsoid, base tapered or rounded, and 43.3 (27.5 to 59.3) × 27.6 (18.5 to 36.3) μm. Clamydospores and oospores were not observed. Oospores were present in dual cultures with an isolate of P. nicotianae (p731) (1) A2 mating type, indicating that the isolate was heterothallic. A portion of the internal transcribed spacer sequence was deposited in GenBank (Accession No. HQ717146). The sequence was 99% identical to that of P. drechsleri SCRP232 (ATCC46724) (3), a type isolate of the species. The pathogen was identified as P. drechsleri Tucker based on temperature growth, morphological characteristics, and ITS sequence homology (3). To evaluate pathogenicity, the isolated P. drechsleri was inoculated on greenhouse-potted G. bicolor plants. Inoculum was obtained by grinding two dishes of the pathogen cultured on potato dextrose agar (PDA) with sterile distilled water in a blender. After filtering through a gauze layer, the filtrate was aliquoted to 240 ml. The inoculum (approximately 180 sporangia/ml) was sprayed on 24 plants of G. bicolor. An equal number of plants treated with sterile PDA processed in the same way served as controls. After 1 week, incubation at an average temperature of 29°C, blight and wilt symptoms similar to those observed in the fields appeared on 12 inoculated plants. The pathogen was reisolated from the lesions of diseased stems and leaves, fulfilling Koch's postulates. The controls remained symptomless. The pathogenicity test was repeated once with similar results. G. bicolor in Taiwan has been recorded to be infected by P. cryptogea (1,2), a species that resembles P. drechsleri. The recorded isolates of P. cryptogea did not have a maximal growth temperature at or above 35°C (1,2), a distinctive characteristic to discriminate between the two species (3). To our knowledge, this is the first report of P. drechsleri being associated with stem and foliar blight of G. bicolor. References: (1) P. J. Ann. Plant Pathol. Bull. 5:146, 1996. (2) H. H. Ho et al. The Genus Phytophthora in Taiwan. Institute of Botany, Academia Sinica, Taipei, 1995. (3) R. Mostowfizadeh-Ghalamfarsa et al. Fungal Biol. 114:325, 2010.

Download Full-text

First report of Leptosphaeria biglobosa ‘canadensis’ causing blackleg on oilseed rape (Brassica napus) in China

Plant Disease ◽

10.1094/pdis-12-20-2735-pdn ◽

2021 ◽

Author(s):

Tao Luo ◽

Guoqing Li ◽

Long Yang

Keyword(s):

Brassica Napus ◽

Oilseed Rape ◽

Southern China ◽

Disease Incidence ◽

Morphological Characteristics ◽

Gansu Province ◽

Bootstrap Support ◽

First Report ◽

Fungal Isolates ◽

Leptosphaeria Biglobosa

Oilseed rape (Brassica napus L.) is one of the most important oilseed crops in China. It is widely cultivated in China, with winter oilseed rape in Yangtze River basin and in southern China, and spring oilseed rape in northern China. In August 2017, a survey for Leptosphaeria spp. on spring oilseed rape was conducted in Minle county, Zhangye city, Gansu Province, China. The symptoms typical of blackleg on basal stems of oilseed rape were observed in the field. A large number of black fruiting bodies (pycnidia) were present on the lesions (Fig. 1A). The disease incidence of basal stem infection in the surveyed field was 19%. A total of 19 diseased stems were collected to isolate the pathogen. After surface sterilizing (75% ethanol for 30 s, 5% NaOCl for 60 s, followed by rinsing in sterilized water three times), diseased tissues were cultured on acidified potato dextrose agar (PDA) plates at 20°C for 7 days. Twelve fungal isolates were obtained. All fungal isolates produced typical tan pigment on PDA medium, and produced pycnidia after two weeks (Fig. 1B). Colony morphological characteristics indicated that these isolates might belong to Leptosphaeria biglobosa. To confirm identification, multiple PCR was conducted using the species-specific primers LmacF, LbigF, LmacR (Liu et al. 2006). Genomic DNA of each isolate was extracted using the cetyltrimethylammonium bromide (CTAB) method. DNA samples of L. maculans isolate UK-1 and L. biglobosa isolate W10 (Cai et al. 2015) were used as references. Only a 444-bp DNA band was detected in all 12 isolates and W10, whereas a 333-bp DNA band was detected only in the UK-1 isolate (Fig. 1C). PCR results suggested that these 12 isolates all belong to L. biglobosa. In addition, the internal transcribed spacer (ITS) region of these 12 isolates was analyzed for subspecies identification (Vincenot et al. 2008). Phylogenetic analysis based on ITS sequence showed that five isolates (Lb1134, Lb1136, Lb1138, Lb1139 and Lb1143) belonged to L. biglobosa ‘brassicae’ (Lbb) with 78% bootstrap support, and the other seven isolates (Lb1135, Lb1137, Lb1140, Lb1141, Lb1142, Lb1144 and Lb1145) belonged to L. biglobosa ‘canadensis’ (Lbc) with 95% bootstrap support (Fig. 1D). Two Lbb isolates (Lb1134 and Lb1136) and two Lbc isolates (Lb1142 and Lb1144) were randomly selected for pathogenicity testing on B. napus cultivar Zhongshuang No. 9 (Wang et al. 2002). Conidial suspensions (10 μL, 1 × 107 conidia mL-1) of these four isolates were inoculated on needle-wounded cotyledons (14-day-old seedling), with 10 cotyledons (20 wounded sites) per isolate. A further 10 wounded cotyledons were inoculated with water and served as controls. Seedlings were maintained in a growth chamber at 20°C with 100% relative humidity and a 12-h photoperiod. After 7 days, cotyledons inoculated with the four isolates showed necrotic lesions in the inoculated wounds. Control cotyledons had no symptoms (Fig. 2). Fungi re-isolated from the infected cotyledons showed similar colony morphology as the original isolates. Therefore, L. biglobosa ‘brassicae’ and L. biglobosa ‘canadensis’ appear to be the pathogens causing the observed blackleg symptoms on spring oilseed rape in Gansu, China. In previous studies, L. biglobosa ‘brassicae’ has been found in many crops in China, including oilseed rape (Liu et al. 2014; Cai et al. 2015), Chinese radish (Raphanus sativus) (Cai et al. 2014a), B. campestris ssp. chinensis var. purpurea (Cai et al. 2014b), broccoli (B. oleracea var. italica) (Luo et al. 2018), ornamental kale (B. oleracea var. acephala) (Zhou et al. 2019a), B. juncea var. multiceps (Zhou et al. 2019b), B. juncea var. tumida (Deng et al. 2020) and Chinese cabbage (B. rapa subsp. pekinensis) (Yu et al. 2021 accepted). To the best of our knowledge, this is the first report of L. biglobosa ‘canadensis’ causing blackleg on B. napus in China.

Download Full-text