Characterization of LgnR, an IclR family transcriptional regulator involved in the regulation of l-gluconate catabolic genes in Paracoccus sp. 43P

Microbiology ◽  
2014 ◽  
Vol 160 (3) ◽  
pp. 623-634 ◽  
Author(s):  
Tetsu Shimizu ◽  
Akira Nakamura
Keyword(s):  
Constitutive Expression ◽  
Transcriptional Regulator ◽  
Pcr Analysis ◽  
Mobility Shift ◽  
Gene Encoding ◽  
Reverse Transcription Pcr ◽  
Dnase I Footprinting ◽  
Catabolic Genes ◽  
Genes Encoding ◽  
Mobility Shift Assay

Five genes encoding enzymes required for l-gluconate catabolism, together with genes encoding components of putative ABC transporters, are located in a cluster in the genome of Paracoccus sp. 43P. A gene encoding a transcriptional regulator in the IclR family, lgnR, is located in front of the cluster in the opposite direction. Reverse transcription PCR analysis indicated that the cluster was transcribed as an operon, termed the lgn operon. Two promoters, P lgnA and P lgnR , are divergently located in the intergenic region, and transcription from these promoters was induced by addition of l-gluconate or d-idonate, a catabolite of l-gluconate. Deletion of lgnR resulted in constitutive expression of lgnA, lgnH and lgnR, indicating that lgnR encodes a repressor protein for the expression of the lgn operon and lgnR itself. Electrophoretic mobility shift assay and DNase I footprinting analyses revealed that recombinant LgnR binds to both P lgnA and P lgnR , indicating that LgnR represses transcription from these promoters by competing with RNA polymerase for binding to these sequences. d-Idonate was identified as a candidate effector molecule for dissociation of LgnR from these promoters. Phylogenetic analysis revealed that LgnR formed a cluster with putative proteins from other genome sequences, which is distinct from those proteins of known regulatory functions, in the IclR family of transcriptional regulators. Additionally, the phylogeny suggests an evolutionary linkage between the l-gluconate catabolic pathway and d-galactonate catabolic pathways distributed in Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria and Actinobacteria.

scholarly journals Liver receptor homologue-1 is expressed in the adrenal and can regulate transcription of 11 beta-hydroxylase

2001 ◽  
Vol 27 (2) ◽  
pp. 255-258 ◽  
Author(s):  
ZN Wang ◽  
M Bassett ◽  
WE Rainey
Keyword(s):  
Adrenal Glands ◽  
Pcr Analysis ◽  
Orphan Nuclear Receptor ◽  
Rt Pcr ◽  
Hormone Production ◽  
Mobility Shift ◽  
Gene Encoding ◽  
Liver And Pancreas ◽  
Genes Encoding ◽  
Mobility Shift Assay

Liver receptor homologue-1 (LRH-1, designated NR5A2) is a mammalian homologue of Drosophila fushi tarazu factor (dFTZ-F1) and structurally belongs to the orphan nuclear receptor superfamily. LRH-1 can recognize the DNA sequence 5'-AAGGTCA-3', the canonical recognition motif for steroidogenic factor 1 (SF-1). Herein, we hypothesized that LRH-1 might play a role in the regulation of human adrenal expression of steroidogenic enzymes. To test this hypothesis, LRH-1 expression in human adult and fetal adrenal glands was examined by RT-PCR analysis. The fetal and adult adrenal glands, as well as liver and pancreas, were observed to express LRH-1 mRNA using RT-PCR. The ability of LRH-1 to enhance transcription of the gene encoding human 11 beta- hydroxylase (hCYP11B1) was then examined using the H295R adrenal cell line. LRH-1 co-transfection with hCYP11B1 luciferase promoter constructs caused a 25-fold induction of luciferase activity. Furthermore, co-transfection of a hCYP11B1 reporter construct containing a mutation in the SF-1 binding cis-element abolished the stimulatory effect of both SF-1 and LRH-1. Electrophoretic mobility shift assay (EMSA) demonstrated that LRH-1 could bind to the SF-1 response element. Taken together, our data suggested that LRH-1 is expressed in the adrenal, and can substitute for SF-1 to enhance transcription of genes encoding certain of the steroid-metabolizing enzymes. A role for LRH-1 in the regulation of adrenal or gonadal steroid hormone production should be further studied.

scholarly journals PcaO Positively Regulates pcaHG of the β-Ketoadipate Pathway in Corynebacterium glutamicum

2010 ◽  
Vol 192 (6) ◽  
pp. 1565-1572 ◽  
Author(s):  
Ke-Xin Zhao ◽  
Yan Huang ◽  
Xi Chen ◽  
Nan-Xi Wang ◽  
Shuang-Jiang Liu
Keyword(s):  
Corynebacterium Glutamicum ◽  
Dnase I ◽  
Transcriptional Analysis ◽  
Target Sequence ◽  
Mobility Shift ◽  
Directed Mutation ◽  
Reverse Transcription Pcr ◽  
Dnase I Footprinting ◽  
Mobility Shift Assay

ABSTRACT We identified a new regulator, PcaO, which is involved in regulation of the protocatechuate (PCA) branch of the β-ketoadipate pathway in Corynebacterium glutamicum. PcaO is an atypical large ATP-binding LuxR family (LAL)-type regulator and does not have a Walker A motif. A mutant of C. glutamicum in which pcaO was disrupted (RES167ΔpcaO) was unable to grow on PCA, and growth on PCA was restored by complementation with pcaO. Both an enzymatic assay of PCA 3,4-dioxygenase activity (encoded by pcaHG) and transcriptional analysis of pcaHG by reverse transcription-PCR revealed that PcaO positively regulated pcaHG. A promoter-LacZ transcriptional fusion assay suggested that PcaO interacted with the sequence upstream of pcaHG. Electrophoretic mobility shift assay (EMSA) analysis indicated that an imperfect palindromic sequence (−78AACCCCTGACCTTCGGGGTT−59) that was located upstream of the −35 region of the pcaHG promoter was essential for PcaO regulation. DNase I footprinting showed that this imperfect palindrome was protected from DNase I digestion. Site-directed mutation and EMSA tests revealed that this palindrome sequence was essential for PcaO binding to the DNA fragment. In vitro EMSA results showed that ATP weakened the binding between PcaO and its target sequence but ADP strengthened this binding, while the effect of protocatechuate on PcaO binding was dependent on the protocatechuate concentration.

scholarly journals Complex transcriptional regulation of the Saccharomyces cerevisiae CYB2 gene encoding cytochrome b2: CYP1(HAP1) activator binds to the CYB2 upstream activation site UAS1-B2.

1991 ◽  
Vol 11 (7) ◽  
pp. 3762-3772 ◽  
Author(s):  
T Lodi ◽  
B Guiard
Keyword(s):  
Saccharomyces Cerevisiae ◽  
Regulatory Region ◽  
Transcriptional Regulator ◽  
Direct Analysis ◽  
Transcriptional Level ◽  
Glucose Fermentation ◽  
Gene Encoding ◽  
Dnase I Footprinting ◽  
Mrna Transcripts ◽  
Binding Sequence

Expression of the Saccharomyces cerevisiae gene encoding cytochrome b2 (EC 1.2.2.3), CYB2, was investigated by direct analysis of mRNA transcripts and by measurement of the expression of lacZ fused to the CYB2 control regions. These studies indicated that regulation of the CYB2 gene is subject to several metabolic controls at the transcriptional level: inhibition due to glucose fermentation, induction by lactate, and inhibition in anaerobiosis or in absence of heme biosynthesis. Furthermore, we have shown that the CYB2 promoter contains one cis negative regulatory region and two heme-dependent positive regions, one of which is controlled by the transcriptional regulator CYP1 (HAP1) which is involved in the modulation of the expression of several oxygen-regulated genes. The CYP1 (HAP1)-binding sequence was located by gel retardation and DNase I footprinting experiments and compared with the binding sequences previously characterized in detail (UAS1CYC1, UAS'CYP3 (CYC7), and UASCTT1).

scholarly journals Ferrous Iron- and Sulfur-Induced Genes in Sulfolobus metallicus

2007 ◽  
Vol 73 (8) ◽  
pp. 2491-2497 ◽  
Author(s):  
Stephan Bathe ◽  
Paul R. Norris
Keyword(s):  
Reverse Transcription ◽  
Ferrous Iron ◽  
Subtractive Hybridization ◽  
Open Reading Frames ◽  
Gene Encoding ◽  
Reverse Transcription Pcr ◽  
Genes Encoding ◽  
Induced Genes ◽  
Reading Frames ◽  
Sulfur Oxygenase Reductase

ABSTRACT Genes of Sulfolobus metallicus that appeared to be upregulated in relation to growth on either ferrous iron or sulfur were identified using subtractive hybridization of cDNAs. The genes upregulated during growth on ferrous iron were found in a cluster, and most were predicted to encode membrane proteins. Quantitative reverse transcription-PCR of cDNA showed upregulation of most of these genes during growth on ferrous iron and pyrite compared to results during growth on sulfur. The highest expression levels observed included those for genes encoding proteins with similarities to cytochrome c oxidase subunits and a CbsA-like cytochrome. The genes identified here that may be involved in oxidation of ferrous iron by S. metallicus are termed fox genes. Of three available genomes of Sulfolobus species (S. tokodaii, S. acidocaldarius, and S. solfataricus), only that of S. tokodaii has a cluster of highly similar open reading frames, and only S. tokodaii of these three species was also able to oxidize ferrous iron. A gene encoding sulfur oxygenase-reductase was identified as the source of the dominant transcript in sulfur-grown cells of S. metallicus, with the predicted protein showing high identities to the previously described examples from S. tokodaii and species of Acidianus.

scholarly journals The Erwinia chrysanthemi 3937 PhoQ Sensor Kinase Regulates Several Virulence Determinants

2006 ◽  
Vol 188 (8) ◽  
pp. 3088-3098 ◽  
Author(s):  
Balakrishnan Venkatesh ◽  
Lavanya Babujee ◽  
Hui Liu ◽  
Pete Hedley ◽  
Takashi Fujikawa ◽  
...  
Keyword(s):  
Virulence Factors ◽  
Regulatory System ◽  
Soft Rot ◽  
Erwinia Chrysanthemi ◽  
Pcr Analysis ◽  
Sensor Kinase ◽  
Virulence Determinants ◽  
Gene Encoding ◽  
Reverse Transcription Pcr ◽  
Two Component

ABSTRACT The PhoPQ two-component system regulates virulence factors in Erwinia chrysanthemi, a pectinolytic enterobacterium that causes soft rot in several plant species. We characterized the effect of a mutation in phoQ, the gene encoding the sensor kinase PhoQ of the PhoPQ two-component regulatory system, on the global transcriptional profile of E. chrysanthemi using cDNA microarrays and further confirmed our results by quantitative reverse transcription-PCR analysis. Our results indicate that a mutation in phoQ affects transcription of at least 40 genes, even in the absence of inducing conditions. Enhanced expression of several genes involved in iron metabolism was observed in the mutant, including that of the acs operon that is involved in achromobactin biosynthesis and transport. This siderophore is required for full virulence of E. chrysanthemi, and its expression is governed by the global repressor protein Fur. Changes in gene expression were also observed for membrane transporters, stress-related genes, toxins, and transcriptional regulators. Our results indicate that the PhoPQ system governs the expression of several additional virulence factors and may also be involved in interactions with other regulatory systems.

Intrinsic Fluoride Tolerance Regulated by a Transcription Factor

2020 ◽  
Vol 99 (11) ◽  
pp. 1270-1278
Author(s):  
M. Lu ◽  
Z. Xiang ◽  
T. Gong ◽  
X. Zhou ◽  
Z. Zhang ◽  
...  
Keyword(s):  
Transcription Factor ◽  
Inhibitory Concentration ◽  
Transcriptional Regulator ◽  
Mutant Library ◽  
Mobility Shift ◽  
Binding Motifs ◽  
Dnase I Footprinting ◽  
Dna Binding Motifs ◽  
Dental Hard Tissues ◽  
Planktonic State

Fluoride facilitates the remineralization of dental hard tissues and affects bacterial activities. Therefore, it is extensively used as an anti-caries agent in clinical practice and daily life. Although some studies focused on understanding Streptococcus mutans’ response to fluoride, the mechanism regulating intrinsic fluoride tolerance is not yet clear. Since the TetR family of transcription factors is associated with multidrug resistance, our aim was to evaluate whether they are related to fluoride tolerance in S. mutans. A mutant library including each S. mutans TetR gene was constructed and the transcription factor fluoride related transcriptional regulator (FrtR) was identified. The in-frame deletion of the S. mutans frtR gene resulted in decreased cell viability under fluoride in both the planktonic state and single-/dual-species biofilms. This in-frame frtR mutant was used for RNA-sequencing and the fluoride related permease gene ( frtP) was found as 1 of the downstream genes directly regulated by FrtR. The recombinant FrtR protein was purified, and conserved DNA binding motifs were determined using electrophoretic mobility shift and DNase I footprinting assays. Finally, a series of mutant and complement strains were constructed to perform the minimum inhibitory concentration (MIC) assays, which indicated that frtP upregulation led to the increase of fluoride sensitivity. Collectively, our results indicate that FrtR is an important transcription factor regulating the frtP expression in S. mutans, thus affecting the intrinsic fluoride tolerance. Therefore, this study provides novel insights into a potential target to increase the S. mutans sensitivity to fluoride for a better prevention of dental caries.

Screening for trans-acting factors and other factors involved in the activating or silencing of the γ-globin gene during human ontogeny

2007 ◽  
Vol 85 (3) ◽  
pp. 347-357
Author(s):  
Yan-Ni Ma ◽  
Xin Zhang ◽  
Jun-Wu Zhang ◽  
Xin-Hua Zhang ◽  
Rong-Xin Wang
Keyword(s):  
Bone Marrow ◽  
Differential Expression ◽  
Globin Gene ◽  
Fetal Hemoglobin ◽  
Pcr Analysis ◽  
Reverse Transcription Pcr ◽  
Genes Encoding ◽  
Hereditary Persistence ◽  
Differential Display Reverse Transcription ◽  
Human Ontogeny

Researchers hope to increase γ-globin expression by controlling potential trans-acting factors that specifically activate the γ-globin gene in fetuses or silence this gene in adults to potentially treat sickle cell disease and β-thalassemias. To characterize genes encoding such factors, we analyzed the differential expression of mRNAs in erythroid induction cultures of CD34+ cells derived from normal adult bone marrow, umbilical cord blood, and bone marrow from a patient with heterocellular hereditary persistence of fetal hemoglobin. Using differential-display – reverse-transcription PCR analysis, we identified a number of genes with differential expression in the above-mentioned cells. The differential expression of some genes was also confirmed by quantitative real-time PCR. Our data provide important clues for identifying and validating trans-activators that activate the γ-globin gene in fetuses, and trans-acting factors involved in silencing the γ-globin gene in adults.

scholarly journals Genetic and Functional Investigation of Zn 2 Cys 6 Transcription Factors RSE2 and RSE3 in Podospora anserina

2013 ◽  
Vol 13 (1) ◽  
pp. 53-65 ◽  
Author(s):  
Elodie Bovier ◽  
Carole H. Sellem ◽  
Adeline Humbert ◽  
Annie Sainsard-Chanet
Keyword(s):  
Transcription Factors ◽  
Phosphoenolpyruvate Carboxykinase ◽  
Constitutive Expression ◽  
Podospora Anserina ◽  
Loss Of Function ◽  
Gene Encoding ◽  
Content Type ◽  
Zinc Cluster ◽  
Wide Range ◽  
Genes Encoding

ABSTRACT In Podospora anserina , the two zinc cluster proteins RSE2 and RSE3 are essential for the expression of the gene encoding the alternative oxidase ( aox ) when the mitochondrial electron transport chain is impaired. In parallel, they activated the expression of gluconeogenic genes encoding phosphoenolpyruvate carboxykinase ( pck ) and fructose-1,6-biphosphatase ( fbp ). Orthologues of these transcription factors are present in a wide range of filamentous fungi, and no other role than the regulation of these three genes has been evidenced so far. In order to better understand the function and the organization of RSE2 and RSE3, we conducted a saturated genetic screen based on the constitutive expression of the aox gene. We identified 10 independent mutations in 9 positions in rse2 and 11 mutations in 5 positions in rse3 . Deletions were generated at some of these positions and the effects analyzed. This analysis suggests the presence of central regulatory domains and a C-terminal activation domain in both proteins. Microarray analysis revealed 598 genes that were differentially expressed in the strains containing gain- or loss-of-function mutations in rse2 or rse3 . It showed that in addition to aox , fbp , and pck , RSE2 and RSE3 regulate the expression of genes encoding the alternative NADH dehydrogenase, a Zn 2 Cys 6 transcription factor, a flavohemoglobin, and various hydrolases. As a complement to expression data, a metabolome profiling approach revealed that both an rse2 gain-of-function mutation and growth on antimycin result in similar metabolic alterations in amino acids, fatty acids, and α-ketoglutarate pools.

scholarly journals Dissolved Oxygen Levels Alter Gene Expression and Antigen Profiles in Borrelia burgdorferi

2004 ◽  
Vol 72 (3) ◽  
pp. 1580-1586 ◽  
Author(s):  
J. Seshu ◽  
Julie A. Boylan ◽  
Frank C. Gherardini ◽  
Jonathan T. Skare
Keyword(s):  
Gene Expression ◽  
Borrelia Burgdorferi ◽  
Dissolved Oxygen ◽  
Reverse Transcription ◽  
Host Factors ◽  
Pcr Analysis ◽  
Transcriptional Level ◽  
Environmental Signals ◽  
Reverse Transcription Pcr ◽  
Genes Encoding

ABSTRACT The Lyme disease spirochete, Borrelia burgdorferi, encounters many environmental signals as it cycles between the arthropod vector and mammalian hosts, including temperature, pH, and other host factors. To test the possibility that dissolved oxygen modulates gene expression in B. burgdorferi, spirochetes were exposed to differential levels of dissolved oxygen, and distinct alterations were observed at both the transcriptional and translational levels. Specifically NapA, a Dps/Dpr homologue involved in the oxidative stress response in other bacteria, was reduced when B. burgdorferi was grown under oxygen-limiting conditions. In contrast, several immunoreactive proteins were altered when tested with infection-derived sera from different hosts. Specifically, OspC, DbpA, and VlsE were synthesized at greater levels when cells were grown in limiting oxygen, whereas VraA was reduced. The levels of oxygen in the medium did not affect OspA production. Real-time reverse transcription-PCR analysis of RNA isolated from infectious isolates of strains B31 and cN40 indicated that the expression of ospC, dbpA, and vlsE increased while napA expression decreased under dissolved-oxygen-limiting conditions, whereas flaB was not affected. The reverse transcription-PCR results corroborated the immunoblot analyses and indicated that the increase in OspC, DbpA, and VlsE was due to regulation at the transcriptional level of the genes encoding these antigens. These results indicate that dissolved oxygen modulates gene expression in B. burgdorferi and imply that the redox environment may be an additional regulatory cue that spirochetes exploit to adapt to the disparate niches that they occupy in nature.

scholarly journals Involvement of the C-Terminal Extension of the α Polypeptide and of the PucC Protein in LH2 Complex Biosynthesis in Rubrivivax gelatinosus

2004 ◽  
Vol 186 (10) ◽  
pp. 3143-3152 ◽  
Author(s):  
Anne-Soisig Steunou ◽  
Soufian Ouchane ◽  
Françoise Reiss-Husson ◽  
Chantal Astier
Keyword(s):  
Purple Bacteria ◽  
Growth Conditions ◽  
Initiation Site ◽  
Northern Blotting ◽  
Pcr Analysis ◽  
Reverse Transcription Pcr ◽  
Genes Encoding ◽  
Rubrivivax Gelatinosus

ABSTRACT The facultative phototrophic nonsulfur bacterium Rubrivivax gelatinosus exhibits several differences from other species of purple bacteria in the organization of its photosynthetic genes. In particular, the puc operon contains only the pucB and pucA genes encoding the β and α polypeptides of the light-harvesting 2 (LH2) complex. Downstream of the pucBA operon is the pucC gene in the opposite transcriptional orientation. The transcription of pucBA and pucC has been studied. No pucC transcript was detected either by Northern blotting or by reverse transcription-PCR analysis. The initiation site of pucBA transcription was determined by primer extension, and Northern blot analysis revealed the presence of two transcripts of 0.8 and 0.65 kb. The half-lives of both transcripts are longer in cells grown semiaerobically than in photosynthetically grown cells, and the small transcript is the less stable. It was reported that the α polypeptide, encoded by the pucA gene, presents a C-terminal extension which is not essential for LH2 function in vitro. The biological role of this alanine- and proline-rich C-terminal extension in vivo has been investigated. Two mutants with C-terminal deletions of 13 and 18 residues have been constructed. Both present the two pucBA transcripts, while their phenotypes are, respectively, LH2+ and LH2−, suggesting that a minimal length of the C-terminal extension is required for LH2 biogenesis. Another important factor involved in the LH2 biogenesis is the PucC protein. To gain insight into the function of this protein in R. gelatinosus, we constructed and characterized a PucC mutant. The mutant is devoid of LH2 complex under semiaerobiosis but still produces a small amount of these antennae under photosynthetic growth conditions. This conditional phenotype suggests the involvement of another factor in LH2 biogenesis.

Sign in / Sign up

Export Citation Format

Share Document