Listeria monocytogenes utilizes the ClpP1/2 proteolytic machinery for fine-tuned substrate degradation under heat stress

Listeria monocytogenes exhibits two ClpP isoforms (ClpP1/ClpP2) which assemble into a heterooligomeric complex with enhanced proteolytic activity. Herein, we demonstrate that the formation of this complex depends on temperature and reaches a maximum ratio of about 1:1 at heat shock conditions, while almost no complex formation occurred below 4 °C. In order to decipher the role of the two isoforms at elevated temperatures, we constructed L. monocytogenes ClpP1, ClpP2 and ClpP1/2 knockout strains and analyzed their protein regulation in comparison to the wild type (WT) strain via whole proteome mass-spectrometry (MS) at 37 °C and 42 °C. While ΔclpP1 strain only altered the expression of very few proteins, ΔclpP2 and ΔclpP1/2 strains revealed the dysregulation of many proteins at both temperatures. These effects were corroborated by crosslinking co-immunoprecipitation MS analysis. Thus, while ClpP1 serves as a mere enhancer of protein degradation in the heterocomplex, ClpP2 is essential for ClpX binding and thus functions as a gatekeeper for substrate entry. Applying an integrated proteomic approach combining whole proteome and co immunoprecipitation datasets, several putative ClpP2 substrates were identified in the context of different temperatures and discussed with regards to their function in cellular pathways such as the SOS response.

Download Full-text

Abstract 10: The Matrix Crosslinking Enzyme Lysyl Oxidase Like-2 as a Target to Reverse Vascular Stiffness

Arteriosclerosis Thrombosis and Vascular Biology ◽

10.1161/atvb.36.suppl_1.10 ◽

2016 ◽

Vol 36 (suppl_1) ◽

Author(s):

Jochen Steppan ◽

Ivy Wang ◽

Yehudit Bergman ◽

Siqi Tan ◽

Sandeep Jandu ◽

...

Keyword(s):

Lysyl Oxidase ◽

Vascular Stiffness ◽

Matrix Composition ◽

Wild Type ◽

Matrix Deposition ◽

Proteomic Approach ◽

Vascular Stiffening ◽

Group 2 ◽

Novel Target

Introduction: Stiffening of the central vasculature is a strong and independent predictor of adverse cardiovascular events. Vascular stiffening is a complex process that involves changes in the vessel wall composition and smooth muscle cell (SMC) function. We recently used an unbiased proteomic approach to identify Lysyl oxidase like 2 (LOXL2) as a potential new target in vascular stiffness. The goal of this study is to characterize the role of LOXL2 in vascular stiffening and its potential as a target to reverse vascular stiffness associated with hypertension. Results: We demonstrate that decreased nitric oxide (NO) bioavailability results in increased secretion and activity of LOXL2 in SMCs. LOXL2 knockdown markedly attenuates SMC adhesion, motility, and proliferation and results in diminished matrix deposition. LOXL2 knockdown also results in striking changes in the stiffness and cytoskeletal remodeling events in CMSs. Tensile testing shows that intact aortas of LOXL2+/- animals are stiffer when compared with those from wild type mice, while there is no difference in decellularized vessels. We next investigated the role of LOXL2 in the development of hypertension using angiotensin II (AngII) infusion in LOXL2+/- (group 1) and wild type (WT; group 2) mice. BP and pulse wave velocity (PWV) increased significantly with AngII infusion in both groups during the study period, without a significant change in heart rate. Compared to WT animals, contractile responsiveness was markedly diminished in LOXL2+/- animals at baseline as well as with AngII infusion when compared with untreated controls. The NO- dependent vasodilatory response to acetylcholine was identical at baseline and diminished significantly with AngII infusion in both groups of animals. There was no difference between the groups in the endothelium-independent response to sodium nitroprusside. Conclusion: In this study, we demonstrated the role of NO in the regulation of LOXL2. Interestingly, LOXL2 appears to have a dual role in vascular stiffness by affecting both SMC function as well as matrix composition. We therefore conclude that LOXL2 is a novel target involved in vascular stiffness that requires further characterization to elicit the possibility of therapeutic intervention.

Download Full-text

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

Microbiology ◽

10.1099/mic.0.035196-0 ◽

2010 ◽

Vol 156 (2) ◽

pp. 374-384 ◽

Cited By ~ 61

Author(s):

Stijn van der Veen ◽

Saskia van Schalkwijk ◽

Douwe Molenaar ◽

Willem M. de Vos ◽

Tjakko Abee ◽

...

Keyword(s):

Listeria Monocytogenes ◽

Sos Response ◽

Wild Type ◽

Translesion Dna Synthesis ◽

Transcription Profiles ◽

Food Borne ◽

Operator Sequence ◽

Survival Studies ◽

Mutant Cells ◽

Imperfect Palindrome

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a ΔrecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; ΔrecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed ΔrecA mutant cells to be less resistant to heat, H2O2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

Download Full-text

Contribution of cysteine residue to the properties of Listeria monocytogenes listeriolysin O

Canadian Journal of Microbiology ◽

10.1139/w09-070 ◽

2009 ◽

Vol 55 (10) ◽

pp. 1153-1159 ◽

Cited By ~ 6

Author(s):

Radosław Stachowiak ◽

Jarosław Wiśniewski ◽

Olga Osińska ◽

Jacek Bielecki

Keyword(s):

Listeria Monocytogenes ◽

Hemolytic Activity ◽

Cysteine Residue ◽

Listeriolysin O ◽

Wild Type ◽

Gram Positive Bacteria ◽

Culture Model ◽

The Family ◽

Kinetics Of

Listeriolysin (LLO) is the key virulence factor critical for Listeria monocytogenes pathogenesis. Listerial cytolysin belongs to the family of cholesterol-dependent cytolysins (CDCs), a group of pore-forming toxins produced by related gram-positive bacteria. Most CDCs contain a cysteine residue in the conserved undecapeptide — a sequence that is highly preserved among this group of proteins. Substitutions of cysteine do not always lead to loss of hemolytic activity, questioning the purpose of such strong conservation of this amino acid in the sequence of CDC. The properties of 3 L. monocytogenes strains, a wild type and 2 mutants expressing modified LLO within the cysteine residue, were analyzed in this work. The first of these mutants producing a toxin with cysteine to alanine substitution showed similar features to the wild type except that a thiol-reducing agent was not necessary for hemolytic activity. Another strain secreting LLO containing serine instead of cysteine exhibited strikingly different properties than the wild type. Modified toxin is independent of the reducing reagents, less stable, and shows accelerated kinetics of cytolysis in comparison with the unchanged protein. However, both mutant strains are less invasive in the cell culture model showing the important role of cysteine in L. monocytogenes virulence.

Download Full-text

Recombinant Listeria monocytogenes Expressing a Cell Wall-Associated Listeriolysin O Is Weakly Virulent but Immunogenic

Infection and Immunity ◽

10.1128/iai.00419-09 ◽

2009 ◽

Vol 77 (10) ◽

pp. 4371-4382 ◽

Cited By ~ 5

Author(s):

Javier A. Carrero ◽

Boris Calderon ◽

Hector Vivanco-Cid ◽

Emil R. Unanue

Keyword(s):

Listeria Monocytogenes ◽

Listeriolysin O ◽

Wild Type ◽

Positive Bacterium ◽

Cell Responses ◽

A Cell ◽

Weakly Virulent

ABSTRACT Listeriolysin O (LLO) is an essential virulence factor for the gram-positive bacterium Listeria monocytogenes. Our goal was to determine if altering the topology of LLO would alter the virulence and toxicity of L. monocytogenes in vivo. A recombinant strain was generated that expressed a surface-associated LLO (sLLO) variant secreted at 40-fold-lower levels than the wild type. In culture, the sLLO strain grew in macrophages, translocated to the cytosol, and induced cell death. However, the sLLO strain showed decreased infectivity, reduced lymphocyte apoptosis, and decreased virulence despite a normal in vitro phenotype. Thus, the topology of LLO in L. monocytogenes was a factor in the pathogenesis of the infection and points to a role of LLO secretion during in vivo infection. The sLLO strain was cleared by severe combined immunodeficient (SCID) mice. Despite the attenuation of virulence, the sLLO strain was immunogenic and capable of eliciting protective T-cell responses.

Download Full-text

Role of Flagellin and the Two-Component CheA/CheY System of Listeria monocytogenes in Host Cell Invasion and Virulence

Infection and Immunity ◽

10.1128/iai.72.6.3237-3244.2004 ◽

2004 ◽

Vol 72 (6) ◽

pp. 3237-3244 ◽

Cited By ~ 88

Author(s):

Lone Dons ◽

Emma Eriksson ◽

Yuxuan Jin ◽

Martin E. Rottenberg ◽

Krister Kristensson ◽

...

Keyword(s):

Listeria Monocytogenes ◽

Wild Type Strain ◽

Tumor Necrosis Factor Receptor ◽

Soft Agar ◽

Initial Contact ◽

Wild Type ◽

Chemotaxis Proteins ◽

Deficient Mice ◽

Necrosis Factor

ABSTRACT The flagellum protein flagellin of Listeria monocytogenes is encoded by the flaA gene. Immediately downstream of flaA, two genes, cheY and cheA, encoding products with homology to chemotaxis proteins of other bacteria, are located. In this study we constructed deletion mutants with mutations in flaA. cheY, and cheA to elucidate their role in the biology of infection with L. monocytogenes. The ΔcheY, ΔcheA, and double-mutant ΔcheYA mutants, but not ΔflaA mutant, were motile in liquid media. However, the ΔcheA mutant had impaired swarming and the ΔcheY and ΔcheYA mutants were unable to swarm on soft agar plates, suggesting that cheY and cheA genes encode proteins involved in chemotaxis. The ΔflaA, ΔcheY, ΔcheA, and ΔcheYA mutants (grown at 24°C) showed reduced association with and invasion of Caco-2 cells compared to the wild-type strain. However, spleens from intragastrically infected BALB/c and C57BL/6 mice showed larger and similar numbers of the ΔflaA and ΔcheYA mutants, respectively, compared to the wild-type controls. Such a discrepancy could be explained by the fact that tumor necrosis factor receptor p55 deficient mice showed dramatically exacerbated susceptibility to the wild-type but unchanged or only slightly increased levels of the ΔflaA or ΔcheYA mutant. In summary, we show that listerial flaA. cheY, and cheA gene products facilitate the initial contact with epithelial cells and contribute to effective invasion but that flaA could also be involved in the triggering of immune responses.

Download Full-text

Proteomic responses to hypoxia at different temperatures in the Great Scallop (Pecten maximus)

10.7287/peerj.preprints.736 ◽

2014 ◽

Author(s):

Sébastien SA Artigaud ◽

Camille CL Lacroix ◽

Joëlle JR Richard ◽

Jonathan Flye-Sainte-Marie ◽

Luca LB Bargelloni ◽

...

Keyword(s):

Mass Spectrometry ◽

Anaerobic Metabolism ◽

Pecten Maximus ◽

Thermal Window ◽

Great Scallop ◽

Coastal Marine ◽

Proteomic Approach ◽

Different Temperatures ◽

Proteomic Responses ◽

Octopine Dehydrogenase

Hypoxia and hyperthermia are two connected consequences of the ongoing global change that constitute major threats for coastal marine organisms. In the present study, we used a proteomic approach to characterize the changes induced by hypoxia in individuals of the great scallop, Pecten maximus, subjected to three different temperatures, i.e. 10°C, 18°C and 25°C. We did not observe any significant change induced by hypoxia in animals acclimated at 10°C. Contrastingly at 18°C and 25°C, 16 and 11 protein spots were differentially accumulated between normoxia and hypoxia, respectively. Moreover, biochemical data, i.e. octopine dehydrogenase activity and arginine assays suggests that animals grown at 25°C switched their metabolism towards anaerobic metabolism when exposed to either normoxia or hypoxia, suggesting that this temperature is out of the scallops’ optimal thermal window. In all, 11 proteins could be unambiguously identified by mass spectrometry, involved in protein modifications and signaling (e.g. CK2, TBK1), metabolism (e.g. ENO3) or cytoskeleton (GSN). The potential roles of these proteins in the thermal-dependent response of scallops to hypoxia are discussed.

Download Full-text

Mice Lacking the Type I Interferon Receptor Are Resistant to Listeria monocytogenes

Journal of Experimental Medicine ◽

10.1084/jem.20040976 ◽

2004 ◽

Vol 200 (4) ◽

pp. 527-533 ◽

Cited By ~ 325

Author(s):

Victoria Auerbuch ◽

Dirk G. Brockstedt ◽

Nicole Meyer-Morse ◽

Mary O'Riordan ◽

Daniel A. Portnoy

Keyword(s):

Listeria Monocytogenes ◽

High Dose ◽

Type I ◽

Wild Type ◽

Type I Ifns ◽

Infection Resistance ◽

Innate Antiviral Response ◽

Factor Α

Listeria monocytogenes is a facultative intracellular pathogen that induces a cytosolic signaling cascade resulting in expression of interferon (IFN)-β. Although type I IFNs are critical in viral defense, their role in immunity to bacterial pathogens is much less clear. In this study, we addressed the role of type I IFNs by examining the infection of L. monocytogenes in BALB/c mice lacking the type I IFN receptor (IFN-α/βR−/−). During the first 24 h of infection in vivo, IFN-α/βR−/− and wild-type mice were similar in terms of L. monocytogenes survival. In addition, the intracellular fate of L. monocytogenes in macrophages cultured from IFN-α/βR−/− and wild-type mice was indistinguishable. However, by 72 h after inoculation in vivo, IFN-α/βR−/− mice were ∼1,000-fold more resistant to a high dose L. monocytogenes infection. Resistance was correlated with elevated levels of interleukin 12p70 in the blood and increased numbers of CD11b+ macrophages producing tumor necrosis factor α in the spleen of IFN-α/βR−/− mice. The results of this study suggest that L. monocytogenes might be exploiting an innate antiviral response to promote its pathogenesis.

Download Full-text

Role of Stress Response Sigma Factor SigG in Mycobacterium tuberculosis

Journal of Bacteriology ◽

10.1128/jb.00511-07 ◽

2007 ◽

Vol 190 (3) ◽

pp. 1128-1133 ◽

Cited By ~ 37

Author(s):

Jong-Hee Lee ◽

Deborah E. Geiman ◽

William R. Bishai

Keyword(s):

Mycobacterium Tuberculosis ◽

Type Strain ◽

Wild Type Strain ◽

Sos Response ◽

Wild Type ◽

Recognition Sequence ◽

Reverse Transcription Pcr ◽

Promoter Recognition ◽

Microarray Studies

ABSTRACT The sigG gene of Mycobacterium tuberculosis was disrupted by homologous recombination, and the genes regulated by SigG were examined by real-time reverse-transcription PCR and microarray studies. The SigG consensus promoter recognition sequence was identified as GCGNGT-N15-18-CGANCA. A ΔsigG mutant was found to be more resistant to mitomycin C treatment than the wild-type strain, indicating that it may be involved in the SOS response in M. tuberculosis.

Download Full-text

A marked Copy of the Manuscriptinfluence of Oxyr on Susceptibility of Planktonic and Sessile Escherichia Coli Cultures to Ciprofloxacin and Cefotaxime

Iraqi Journal of Science ◽

10.24996/ijs.2020.61.11.5 ◽

2020 ◽

pp. 2812-2819

Author(s):

Zoya Samoilova ◽

Nadezhda Muzyka ◽

Galina Smirnova ◽

Oleg Oktyabrsky

Keyword(s):

Oxidative Stress ◽

Escherichia Coli ◽

Antioxidant Defense ◽

Sos Response ◽

Low Doses ◽

Wild Type ◽

Persister Cells ◽

Killing Rate ◽

Crystal Violet Assay

Alternation of bacterial antioxidant defense pathways might affect susceptibility to antibiotics in dual ways. Using a relatively simple model based on wild-type and oxyR Escherichia coli mature biofilms, their counterpart planktonic cultures and exponentially growing planktonic cultures, we explored the role of OxyR-mediated metabolism alternations in modulation of susceptibility to antibiotics ciprofloxacin and cefotaxime. All three types of cultures were placed in fresh medium,1 h after antibiotics were added and incubation continued further for 2 h. Killing rates of antibiotics were determined, biofilm eradication using crystal violet assay was estimated, expression of rpoS, katG, sulA genes as well as HPI and HPII catalase activity were measured. Biofilms of both strains were more recalcitrant to ciprofloxacin and cefotaxime at all tested concentrations compared to exponentially growing planktonic cultures. In oxyR biofilms killing rate of ciprofloxacin was lower, and killing rate of cefotaxime was higher compared to the parental strain. Compared to biofilms, wild-type biofilm counterpart planktonic cultures showed higher tolerance to low doses of ciprofloxacin, while oxyR plankton demonstrated higher tolerance to cefotaxime. Higher recalcitrance of oxyR biofilms to ciprofloxacin may be caused by an increase in persister cells under conditions of enhanced oxidative stress and activated SOS response.

Download Full-text

The Propeptide of the Metalloprotease of Listeria monocytogenes Controls Compartmentalization of the Zymogen during Intracellular Infection

Journal of Bacteriology ◽

10.1128/jb.01168-08 ◽

2009 ◽

Vol 191 (11) ◽

pp. 3594-3603 ◽

Cited By ~ 10

Author(s):

Heather S. O'Neil ◽

Brian M. Forster ◽

Kari L. Roberts ◽

Andrew J. Chambers ◽

Alan Pavinski Bitar ◽

...

Keyword(s):

Listeria Monocytogenes ◽

Catalytic Domain ◽

Bacterial Pathogen ◽

Folding Kinetics ◽

Wild Type ◽

Semisolid Medium ◽

Mutant Proteins ◽

Intracellular Infection ◽

Infected Cells

ABSTRACT Integral to the virulence of the intracellular bacterial pathogen Listeria monocytogenes is its metalloprotease (Mpl). Mpl regulates the activity and compartmentalization of the bacterial broad-range phospholipase C (PC-PLC). Mpl is secreted as a proprotein that undergoes intramolecular autocatalysis to release its catalytic domain. In related proteases, the propeptide serves as a folding catalyst and can act either in cis or in trans. Propeptides can also influence protein compartmentalization and intracellular trafficking or decrease folding kinetics. In this study, we aimed to determine the role of the Mpl propeptide by monitoring the behavior of Mpl synthesized in the absence of its propeptide (MplΔpro) and of two Mpl single-site mutants with unstable propeptides: Mpl(H75V) and Mpl(H95L). We observed that all three Mpl mutants mediate PC-PLC activation when bacteria are grown on semisolid medium, but to a lesser extent than wild-type Mpl, indicating that, although not essential, the propeptide enhances the production of active Mpl. However, the mutant proteins were not functional in infected cells, as determined by monitoring PC-PLC maturation and compartmentalization. This defect could not be rescued by providing the propeptide in trans to the mplΔpro mutant. We tested the compartmentalization of Mpl during intracellular infection and observed that the mutant Mpl species were aberrantly secreted in the cytosol of infected cells. These data indicated that the propeptide of Mpl serves to maintain bacterium-associated Mpl and that this localization is essential to the function of Mpl during intracellular infection.

Download Full-text