scholarly journals Expression of Dentin Sialophosphoprotein in Non-mineralized Tissues

2011 ◽  
Vol 59 (11) ◽  
pp. 1009-1021 ◽  
Author(s):  
Monica Prasad ◽  
Qinglin Zhu ◽  
Yao Sun ◽  
Xiaofang Wang ◽  
Ashok Kulkarni ◽  
...  
Keyword(s):  
Salivary Glands ◽  
Real Time ◽  
Real Time Pcr ◽  
Soft Tissues ◽  
Dentin Sialophosphoprotein ◽  
Mineralized Tissues ◽  
Dentin Phosphoprotein ◽  
Liver And Kidney ◽  
Polymerase Chain ◽  
Dentin Sialoprotein

Dentin sialophosphoprotein (DSPP) and its cleaved products, dentin phosphoprotein (DPP) and dentin sialoprotein (DSP), play important roles in biomineralization. Believed to be tooth specific, the authors’ group revealed its expression in bone, and more recently, they and other groups also showed its expression in a few types of soft tissues. In this study, the authors systematically examined the expression of DSPP in a variety of non-mineralized tissues using reverse-transcription polymerase chain reaction (RT-PCR), real-time PCR, Western immunoblotting, and immunohistochemistry analyses in wild-type mice as well as β-galactosidase assays in the Dspp lacZ knock-in mice. These approaches showed the presence of DSPP in the salivary glands, cartilage, liver, kidney, and brain and its absence in the heart and spleen. Real-time PCR showed that the expression levels of DSPP mRNA in salivary glands, cartilage, liver, and kidney were higher than in the bone. Interestingly, DSPP was observed in the pericytes of blood vessels in the dental pulp, which are believed to be able to differentiate into odontoblasts. On the basis of these observations, the authors conclude that DSPP and/or its cleaved products may fulfill important functions in certain non-mineralized tissues in addition to its role in biomineralization.

The Expression of Dentin Sialophosphoprotein Gene in Bone

2002 ◽  
Vol 81 (6) ◽  
pp. 392-394 ◽  
Author(s):  
C. Qin ◽  
J.C. Brunn ◽  
E. Cadena ◽  
A. Ridall ◽  
H. Tsujigiwa ◽  
...  
Keyword(s):  
Specific Protein ◽  
Regulatory Mechanisms ◽  
Long Bone ◽  
Mrna Transcript ◽  
Rt Pcr ◽  
Chain Reaction ◽  
Dentin Sialophosphoprotein ◽  
Dentin Phosphoprotein ◽  
Polymerase Chain ◽  
Dentin Sialoprotein

Dentin sialoprotein (DSP) and dentin phosphoprotein (DPP) are expressed as a single mRNA transcript coding for a large precursor protein termed dentin sialophosphoprotein (DSPP). DSP, DPP, and DSPP have been considered to be tooth-specific. To test for the expression of the dspp gene in bone, we performed Western immunoblots and reverse-transcription polymerase chain-reaction (RT-PCR). With Western immunoblots, we detected DSP in the Gdm/EDTA extracts of rat long bone, at a level of about 1/400 of that in dentin. Using RT-PCR, we detected DSPP mRNA in mouse calvaria. Similar to Western immunoblots, the results of RT-PCR indicated that the dspp gene is expressed at a lower level in bone than in dentin and odontoblasts. Analysis of the data shows that DSPP is not a tooth-specific protein, and that dramatically different regulatory mechanisms governing DSPP expression are involved in the bone and dentin.

Diagnosis and Causative Species of Visceral Leishmaniasis in Southwest Saudi Arabia

2021 ◽  
Author(s):  
Aymen Abdelhaleem ◽  
Nabil Dhayhi ◽  
Mohamed Salih Mahfouz ◽  
Ommer Daffalla ◽  
Mansour Mubarki ◽  
...  
Keyword(s):  
Saudi Arabia ◽  
Visceral Leishmaniasis ◽  
Real Time ◽  
Real Time Pcr ◽  
Leishmania Donovani ◽  
Target Genes ◽  
Sample Volume ◽  
Pcr Products ◽  
Polymerase Chain ◽  
Robust Evidence

Visceral leishmaniasis (VL) is the most severe clinical form of the disease and has been reported in the Jazan region of southwest Saudi Arabia. This study aimed to diagnose VL by real-time polymerase chain reaction (PCR) and the direct agglutination test (DAT) and to identify the causative Leishmania species. A total of 80 participants, including 30 suspected VL patients, 30 healthy endemic control individuals, and 20 malaria disease controls, were enrolled in this study. Blood samples were collected and tested for Leishmania DNA by real-time PCR and for antibody by the DAT. Sequencing of some amplified PCR products was used to identify the causative Leishmania species. The diagnosis of VL was successfully achieved by both real-time PCR and by DAT with 100% sensitivity. Leishmania donovani and Leishmania infantum species were detected by sequencing both by the kDNA and ITS1 target genes, followed a BLASTn search. The detection of VL antibody by the DAT followed by the confirmatory detection of Leishmania DNA in patient blood by PCR could promote the adoption of the much less invasive and more sensitive methods for the routine diagnosis of VL. Further study with high sample volume to evaluate the PCR and the DAT are needed, to generate more robust evidence. Based on the sequencing results, emerging studies on VL should focus on the causative Leishmania species, reservoirs, and vectors that are important in the study area.

scholarly journals DETEKSI CLOSTRIDIUM DIFFICILE TOKSIGENIK MENGGUNAKAN UJI CEPAT TOKSIN DAN REAL TIME POLYMERASE CHAIN REACTION (Toxigenic Clostridium Difficile Detection Using Toxin Rapid Test and Real Time Polymerase Chain Reaction)

2018 ◽  
Vol 22 (1) ◽  
pp. 22
Author(s):  
Ika Yasma Yanti ◽  
Dalima Ari Wahono Astrawinata
Keyword(s):  
Polymerase Chain Reaction ◽  
Clostridium Difficile ◽  
Antibiotic Therapy ◽  
Real Time ◽  
Real Time Pcr ◽  
Rapid Test ◽  
Chain Reaction ◽  
Chi Square ◽  
Polymerase Chain ◽  
Clostridium Difficile Associated Diarrhea

Toxigenic Clostridium difficile infection, causing a Pseudo Membrane Colitis (PMC) and Clostridium Difficile Associated Diarrhea(CDAD) has increased sharply. The largest risk factor is the use of antibiotics. The purpose of this study was to know how to determinethe prevalence and characteristics of subjects with Toxigenic Clostridium difficile and to assess the ability of the toxin rapid test comparedto real-time PCR. Ninety adult subjects with antibiotic therapy more than two (2) weeks were enrolled in this study. The results of toxinrapid test and real-time PCR were presented in a 2x2 table, statistical test used was Chi square. The prevalence of Toxigenic Clostridiumdifficile based on the toxin rapid test and by real-time PCR was 27.3% and 37.5%, respectively. There were significant differences betweenstool consistency and number of antibiotics used with the detection of Toxigenic Clostridium difficile. There was a relationship betweenthe duration of antibiotic therapy with the detection of Toxigenic Clostridium difficile using real-time PCR (p=0.010, RR=2.116). Thesensitivity, specificity, PPV, NPV, PLR and NLR rapid test against real-time PCR were 69.7%; 98.2%; 95.8%; 84.4%; 39.2 and 0.31,respectively. This study concluded that the prevalence of Clostridium difficile in RSCM was higher compared to that in Malaysia, Thailandand India; the subjects with antibiotic therapy for more than four (4) weeks had a double risk to have Toxigenic Clostridium difficilethan subjects with antibiotic therapy for less than that time (4 weeks). Thus, in this study, toxin rapid test could be used as a tool todetect Toxigenic Clostridium difficile.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Quantitative Real-Time Polymerase Chain Reaction Detection of BK Virus Using Labeled Primers

2010 ◽  
Vol 134 (3) ◽  
pp. 444-448 ◽  
Author(s):  
Zhengming Gu ◽  
Jianmin Pan ◽  
Matthew J. Bankowski ◽  
Randall T. Hayden
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Quantitative Polymerase Chain Reaction ◽  
Bk Virus ◽  
Clinical Samples ◽  
Quantitative Detection ◽  
Chain Reaction ◽  
Pcr Method ◽  
Polymerase Chain

Abstract Context.—BK virus infections among immunocompromised patients are associated with disease of the kidney or urinary bladder. High viral loads, determined by quantitative polymerase chain reaction (PCR), have been correlated with clinical disease. Objective.—To develop and evaluate a novel method for real-time PCR detection and quantification of BK virus using labeled primers. Design.—Patient specimens (n = 54) included 17 plasma, 12 whole blood, and 25 urine samples. DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science, Indianapolis, Indiana); sample eluate was PCR-amplified using the labeled primer PCR method. Results were compared with those of a user-developed quantitative real-time PCR method (fluorescence resonance energy transfer probe hybridization). Results.—Labeled primer PCR detected less than 10 copies per reaction and showed quantitative linearity from 101 to 107 copies per reaction. Analytical specificity of labeled primer PCR was 100%. With clinical samples, labeled primer PCR demonstrated a trend toward improved sensitivity compared with the reference method. Quantitative assay comparison showed an R2 value of 0.96 between the 2 assays. Conclusions.—Real-time PCR using labeled primers is highly sensitive and specific for the quantitative detection of BK virus from a variety of clinical specimens. These data demonstrate the applicability of labeled primer PCR for quantitative viral detection and offer a simplified method that removes the need for separate oligonucleotide probes.

Rapid, specific and quantitative polymerase chain reaction (PCR) detection of pathogenic protozoa Entamoeba histolytica for drinking water supply

2011 ◽  
Vol 11 (4) ◽  
pp. 418-425 ◽  
Author(s):  
S. W. Lam ◽  
H. B. Zhang ◽  
L. Yu ◽  
C. H. Woo ◽  
K. N. Tiew ◽  
...  
Keyword(s):  
Real Time ◽  
Water Samples ◽  
Real Time Pcr ◽  
Genomic Dna ◽  
Tap Water ◽  
Pcr Detection ◽  
Raw Water ◽  
Conventional Pcr ◽  
Polymerase Chain ◽  
Species Specific

In this study, a quantitative species-specific polymerase chain reaction (PCR) method to rapidly detect E. histolytica in water is developed. First, the specificity of E. histolytica PCR detection was verified by using species-specific primers of 16S-like rRNA genes to clearly differentiate it from the closely related amoebae species E. dispar and E. moshkovskii. The sensitivity of this method was subsequently determined using purified E. histolytica genomic DNA and culture cells as PCR reaction templates. Results indicated that conventional PCR visualized on 1% agarose gel was able to detect as low as 0.02 pg genomic DNA and 5 cells, while real-time PCR could detect 0.01 pg genomic DNA and 2 cells of E. histolytica. The protocols for E. histolytica PCR detection in real water samples were then optimized by spiking E. histolytica cells into tap water and reservoir raw water samples. A two-round centrifugation treatment to concentrate amoeba cells directly as a PCR template was the most effective way to detect E. histolytica in spiked tap water samples, while DNA extraction after concentrating amoeba cells was required for spiked reservoir raw water samples. The detection limit of 50 E. histolytica cells in 100 ml tap water was achieved in 2 h from sample collection to real-time PCR data readout. With these established protocols, 78 tap water samples, 11 reservoir raw water samples and 4 feed water samples from Singapore water supply systems were analyzed by both conventional PCR and real-time PCR methods. No E. histolytica cell was detected in tested samples.

scholarly journals In Planta Distribution of ‘Candidatus Liberibacter asiaticus’ as Revealed by Polymerase Chain Reaction (PCR) and Real-Time PCR

2008 ◽  
Vol 98 (5) ◽  
pp. 592-599 ◽  
Author(s):  
Satyanarayana Tatineni ◽  
Uma Shankar Sagaram ◽  
Siddarame Gowda ◽  
Cecile J. Robertson ◽  
William O. Dawson ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Citrus Tree ◽  
Candidatus Liberibacter Asiaticus ◽  
In Planta ◽  
Chain Reaction ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Polymerase Chain

Huanglongbing (HLB) is one of the most devastating diseases of citrus worldwide, and is caused by a phloem-limited fastidious prokaryotic α-proteobacterium that is yet to be cultured. In this study, a combination of traditional polymerase chain reaction (PCR) and real-time PCR targeting the putative DNA polymerase and 16S rDNA sequence of ‘Candidatus Liberibacter asiaticus,’ respectively, were used to examine the distribution and movement of the HLB pathogen in the infected citrus tree. We found that ‘Ca. Liberibacter asiaticus’ was distributed in bark tissue, leaf midrib, roots, and different floral and fruit parts, but not in endosperm and embryo, of infected citrus trees. Quantification analysis of the HLB bacterium indicated that it was distributed unevenly in planta and ranged from 14 to 137,031 cells/μg of total DNA in different tissues. A relatively high concentration of ‘Ca. Liberibacter asiaticus’ was observed in fruit peduncles. Our data from greenhouse-infected plants also indicated that ‘Ca. Liberibacter asiaticus’ was transmitted systemically from infection site to different parts of the plant. Understanding the distribution and movement of the HLB bacterium inside an individual citrus tree is critical for discerning its virulence mechanism and to develop management strategies for HLB.

Sign in / Sign up

Export Citation Format

Share Document