Type IX secretion system : characterization of an effector protein and an insight into the role of c-terminal domain dimeration in outer membrane translocation.

Pseudomonas aeruginosa is an opportunistic human pathogen implicated in nosocomial infection and infecting people with compromised immune systems such as cystic fibrosis patients. Although multiple genes involved in P. aeruginosa pathogenesis have been characterized, the overall mechanism of virulence is not fully understood. In this study, we identified a functional two-partner secretion (TPS) system, composed of the PdtA exoprotein and its cognate pore-forming β-barrel PdtB transporter, which is implicated in the virulence of P. aeruginosa. We found that the predicted PdtA exoprotein is related to the HMW-like adhesins subfamily TPS systems. We demonstrate here that limitation of inorganic phosphate (Pi) allows the production of PdtA protein. We show that PdtA is processed during its outer-membrane translocation, with an N-terminal domain released into the extracellular environment and a C-terminal domain associated with the outer membrane of the cell. We also obtained evidence that the transport of PdtA is strictly dependent on the production of PdtB, a result confirming that these proteins constitute a functional TPS system. Furthermore, using the Caenorhabditis elegans model of infection, we show that a pdtA mutant is less virulent than the wild-type strain.

Download Full-text

The Type IX Secretion System and Its Role in Bacterial Function and Pathogenesis

Journal of Dental Research ◽

10.1177/00220345211051599 ◽

2021 ◽

pp. 002203452110515

Author(s):

P.D. Veith ◽

M.D. Glew ◽

D.G. Gorasia ◽

E. Cascales ◽

E.C. Reynolds

Keyword(s):

Cell Surface ◽

Outer Membrane ◽

Virulence Factors ◽

Secretion System ◽

Outer Membrane Vesicles ◽

Molecular Structures ◽

Molecular Architecture ◽

Cargo Proteins ◽

Type Ix Secretion System ◽

Insight Into

Porphyromonas, Tannerella, and Prevotella species found in severe periodontitis use the Type IX Secretion System (T9SS) to load their outer membrane surface with an array of virulence factors. These virulence factors are then released on outer membrane vesicles (OMVs), which penetrate the host to dysregulate the immune response to establish a positive feedback loop of chronic, inflammatory destruction of the tooth’s supporting tissues. In this review, we present the latest information on the molecular architecture of the T9SS and provide mechanistic insight into its role in secretion and attachment of cargo proteins to produce a virulence coat on cells and OMVs. The recent molecular structures of the T9SS motor comprising PorL and PorM as well as the secretion pore Sov, together with advances in the overall interactome, have provided insight into the possible mechanisms of secretion. We propose the presence of PorL/M motors arranged in a circle at the inner membrane with bent periplasmic rotors interacting with the PorN protein. At the outer membrane, we envisage a slide carousel model where the PorN protein is driven around a circular track composed of PorK. Cargo proteins are transported by PorN to PorW and the Sov translocon just as slides are rotated to the projection window. Secreted proteins are proposed to then be shuttled along highways consisting of the PorV shuttle protein to an array of attachment complexes distributed around the cell. The cell surface attachment of cargo is a hallmark of the T9SS, and in Porphyromonas gingivalis and Tannerella forsythia, this attachment is achieved via covalent bonding to a linking sugar synthesized by the Wbp/Vim pathway. The cell-surface attached cargo are enriched on OMVs, which are then released from the cell.

Download Full-text

Author Correction: Crystal structure of Type IX secretion system PorE C-terminal domain from Porphyromonas gingivalis in complex with a peptidoglycan fragment

Scientific Reports ◽

10.1038/s41598-021-82414-x ◽

2021 ◽

Vol 11 (1) ◽

Author(s):

Nhung Thi Trang Trinh ◽

Hieu Quang Tran ◽

Quyen Van Dong ◽

Christian Cambillau ◽

Alain Roussel ◽

...

Keyword(s):

Crystal Structure ◽

Porphyromonas Gingivalis ◽

Secretion System ◽

Terminal Domain ◽

Type Ix Secretion System

An amendment to this paper has been published and can be accessed via a link at the top of the paper.

Download Full-text

The Effect of Octapeptide Repeats on Prion Folding and Misfolding

International Journal of Molecular Sciences ◽

10.3390/ijms22041800 ◽

2021 ◽

Vol 22 (4) ◽

pp. 1800

Author(s):

Kun-Hua Yu ◽

Mei-Yu Huang ◽

Yi-Ru Lee ◽

Yu-Kie Lin ◽

Hau-Ren Chen ◽

...

Keyword(s):

Amyloid Fibrils ◽

Age Of Onset ◽

Prion Diseases ◽

Critical Role ◽

Threshold Effect ◽

Central Feature ◽

Terminal Domain ◽

Amyloid Aggregates

Misfolding of prion protein (PrP) into amyloid aggregates is the central feature of prion diseases. PrP has an amyloidogenic C-terminal domain with three α-helices and a flexible tail in the N-terminal domain in which multiple octapeptide repeats are present in most mammals. The role of the octapeptides in prion diseases has previously been underestimated because the octapeptides are not located in the amyloidogenic domain. Correlation between the number of octapeptide repeats and age of onset suggests the critical role of octapeptide repeats in prion diseases. In this study, we have investigated four PrP variants without any octapeptides and with 1, 5 and 8 octapeptide repeats. From the comparison of the protein structure and the thermal stability of these proteins, as well as the characterization of amyloids converted from these PrP variants, we found that octapeptide repeats affect both folding and misfolding of PrP creating amyloid fibrils with distinct structures. Deletion of octapeptides forms fewer twisted fibrils and weakens the cytotoxicity. Insertion of octapeptides enhances the formation of typical silk-like fibrils but it does not increase the cytotoxicity. There might be some threshold effect and increasing the number of peptides beyond a certain limit has no further effect on the cell viability, though the reasons are unclear at this stage. Overall, the results of this study elucidate the molecular mechanism of octapeptides at the onset of prion diseases.

Download Full-text

A new chemoenzymatic semisynthetic approach provides novel insight into the role of phosphorylation beyond exon1 of Huntingtin and reveals N-terminal fragment length-dependent distinct mechanisms of aggregation

10.1101/2021.03.24.436743 ◽

2021 ◽

Author(s):

Rajasekhar Kolla ◽

Pushparathinam Gopinath ◽

Jonathan Ricci ◽

Andreas Reif ◽

Iman Rostami ◽

...

Keyword(s):

Disease Progression ◽

Fragment Length ◽

Neurodegenerative Disorder ◽

Morphological Properties ◽

Structural Determinants ◽

Site Specific ◽

Terminal Domain ◽

Fibril Morphology ◽

Insight Into

AbstractHuntington’s disease is a neurodegenerative disorder caused by the expansion of a polyglutamine (poly Q) repeat (>36Q) in the N-terminal domain of the huntingtin protein (Htt), which renders the protein or fragments thereof more prone to aggregate and form inclusions. Although several Htt N-terminal fragments of different lengths have been identified within Htt inclusions, most studies on the mechanisms, sequence, and structural determinants of Htt aggregation have focused on the Htt exon1 (Httex1). Herein, we investigated the aggregation properties of mutant N-terminal Htt fragments of various lengths (Htt171, Htt140, and Htt104) in comparison to mutant Httex1. We also present a new chemoenzymatic semisynthetic strategy that enables site-specific phosphorylation of Htt beyond Httex1. These advances yielded novel insights into how PTMs and structured domains beyond Httex1 influence aggregation mechanisms, kinetics, and fibril morphology of longer N-terminal Htt fragments. We demonstrate that phosphorylation at T107 significantly slowed its aggregation, whereases phosphorylation at T107 and S116 accelerated the aggregation of Htt171, underscoring the importance of crosstalk between different PTMs. We demonstrate that mutant Htt171 proteins aggregate via a different mechanism and form oligomers and fibrillar aggregates with morphological properties that are distinct from that of mutant Httex1. These observations suggest that different N-terminal fragments could have distinct mechanisms of aggregation and that a single polyQ-targeting anti-aggregation strategy may not effectively inhibit the aggregation of all N-terminal Htt fragments. Finally, our results underscore the importance of further studies to investigate the aggregation mechanisms of Htt fragments and how the various fragments interact with each other and influence Htt toxicity, pathology formation, and disease progression.Table of content

Download Full-text

The Mutation of Conservative Asp268 Residue in the Peptidoglycan-Associated Domain of the OmpA Protein Affects Multiple Acinetobacter baumannii Virulence Characteristics

Molecules ◽

10.3390/molecules24101972 ◽

2019 ◽

Vol 24 (10) ◽

pp. 1972 ◽

Cited By ~ 2

Author(s):

Jūratė Skerniškytė ◽

Emilija Karazijaitė ◽

Julien Deschamps ◽

Renatas Krasauskas ◽

Romain Briandet ◽

...

Keyword(s):

Acinetobacter Baumannii ◽

Outer Membrane ◽

Protein A ◽

Membrane Vesicles ◽

Outer Membrane Vesicles ◽

Clinical Strain ◽

Infection Model ◽

Terminal Domain ◽

Ompa Protein

Acinetobacter baumannii is a nosocomial human pathogen of increasing concern due to its multidrug resistance profile. The outer membrane protein A (OmpA) is an abundant bacterial cell surface component involved in A. baumannii pathogenesis. It has been shown that the C-terminal domain of OmpA is located in the periplasm and non-covalently associates with the peptidoglycan layer via two conserved amino acids, thereby anchoring OmpA to the cell wall. Here, we investigated the role of one of the respective residues, D268 in OmpA of A. baumannii clinical strain Ab169, on its virulence characteristics by complementing the ΔompA mutant with the plasmid-borne ompAD268A allele. We show that while restoring the impaired biofilm formation of the ΔompA strain, the Ab169ompAD268A mutant tended to form bacterial filaments, indicating the abnormalities in cell division. Moreover, the Ab169 OmpA D268-mediated association to peptidoglycan was required for the manifestation of twitching motility, desiccation resistance, serum-induced killing, adhesion to epithelial cells and virulence in a nematode infection model, although it was dispensable for the uptake of β-lactam antibiotics by outer membrane vesicles. Overall, the results of this study demonstrate that the OmpA C-terminal domain-mediated association to peptidoglycan is critical for a number of virulent properties displayed by A. baumannii outside and within the host.

Download Full-text

Insight into the essential role of the Helicobacter pylori HP1043 orphan response regulator: genome-wide identification and characterization of the DNA-binding sites

Scientific Reports ◽

10.1038/srep41063 ◽

2017 ◽

Vol 7 (1) ◽

Cited By ~ 14

Author(s):

Simone Pelliciari ◽

Eva Pinatel ◽

Andrea Vannini ◽

Clelia Peano ◽

Simone Puccio ◽

...

Keyword(s):

Helicobacter Pylori ◽

Binding Sites ◽

Essential Role ◽

Response Regulator ◽

Dna Binding Sites ◽

Genome Wide ◽

Identification And Characterization ◽

Insight Into

Download Full-text

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis

Microbiology ◽

10.1099/mic.0.049213-0 ◽

2011 ◽

Vol 157 (9) ◽

pp. 2670-2680 ◽

Cited By ~ 19

Author(s):

Iria Uhía ◽

Beatriz Galán ◽

Francisco Javier Medrano ◽

José Luis García

Keyword(s):

Mycobacterium Smegmatis ◽

Transcription Start ◽

Promoter Regions ◽

Degradative Pathway ◽

Terminal Domain ◽

Heterologous System ◽

Highly Hydrophobic ◽

Extension Analysis

The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSDMS) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P5228 promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5′ untranslated region (5′UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the −5 and −35 positions with respect to the transcription start site. This region overlaps with the −10 and −35 boxes of the P5228 promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P5228 –β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P5228 promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism.

Download Full-text