scholarly journals Natural-Focal Viral Fevers in the South of the European Part of Russia. Crimean-Congo Hemorrhagic Fever

2021 ◽  
pp. 75-80
Author(s):  
O. V. Maletskaya ◽  
T. V. Taran ◽  
D. A. Prislegina ◽  
V. M. Dubyansky ◽  
A. S. Volynkina ◽  
...  
Keyword(s):  
Health Workers ◽  
Global Climate ◽  
Clinical Manifestations ◽  
Hemorrhagic Fever ◽  
Medical Personnel ◽  
Prevention Measures ◽  
The South ◽  
Natural Focus ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus

Objective of the study was to determine the modern epidemiological peculiarities of Crimean-Congo hemorrhagic fever in the south of the Russian Federation.Materials and methods. Data of statistical documentation (epidemiological survey of the infectious disease focus, annual summary reports dated 2010–2019) and epizootiologic monitoring data submitted by the Rospotrebnadzor Administrations and the Centers of Hygiene and Epidemiology in the constituent entities of the Southern and the North Caucasian Federal Districts were used. Descriptive, genetic, analytical methods and retrospective epidemiological analysis were applied.Results and discussion. The СCHF natural focus in the European south of Russia has an area of 815 thousand square kilometers and it is characterized by persistence, expansion of the territory, and circulation of CCHF virus European genotypes. CCHF virus genetic variants form the local overlapping populations. Over the period of 2010–2019 997 CCHF cases were registered. Moderate forms of the disease clinically prevailed (74.2 per cent). Hemorrhagic symptoms were noted in 29.3 % of patients. The lethal outcome of the disease was registered in 31 CCHF patients (3 %). Two cases of nosocomial infection were identified, nine health workers were infected by CCHF pathogen. The expansion of epizootically active territory of the CCHF natural focus is associated with the expansion of the Hyalomma marginatum ticks area northward due to the aridization of the steppes, in part because of global climate change. The stability of the CCHF virus population was noted. The epidemic core of the CCHF natural focus remains on the adjacent territory of the Rostov Region, Stavropol Territory and the Republic of Kalmykia. The higher efficiency of CCHF prevention measures on the territory of the core is stemming from the targetness and intensity of measures, contributing to the early seeking of medical care by patients, their early hospitalization which in its turn influenced the development of clinical manifestations and outcome of the disease, and also made it possible to minimize the CCHF nosocomial infections number, including those among the medical personnel. 

scholarly journals Epidemiological Situation on Crimean-Congo Hemorrhagic Fever in the Russian Federation in 2019 and Forecast for 2020

2020 ◽  
pp. 14-20
Author(s):  
A. S. Volynkina ◽  
E. S. Kotenev ◽  
O. V. Maletskaya ◽  
O. N. Skudareva ◽  
L. I. Shaposhnikova ◽  
...  
Keyword(s):  
Russian Federation ◽  
Hemorrhagic Fever ◽  
The South ◽  
Natural Focus ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
European Part Of Russia ◽  
Federal Districts ◽  
The Russian Federation ◽  
Epidemiological Situation

The review presents an analysis of epidemic and epizootic situation of Crimean-Congo hemorrhagic fever in the Russian Federation in 2010–2019, summarizes the results of epizootiological monitoring of the CCHF natural focus territory in the south of European part of Russia. An unfavorable epidemiological situation regarding CCHF is maintained in the Russian Federation. In 2010–2019, 999 CCHF cases were registered in nine regions of Southern and North-Caucasian Federal Districts. In 2019, an increase in the CCHF incidence level in the entities of the SFD and NCFD was observed as compared to 2017–2018. The expansion of the territory with registered epidemic manifestations of CCHF continues. In 2010–2019, the number of imago and pre-imaginal phases of Hyalomma marginatum – the main vector of the CCHF virus in Russia, remained consistently high. High numbers of H. marginatum ticks and their CCHFV infection rates can contribute to the development of an unfavorable epidemiological situation in the south of the Russian Federation with a possible increase in the CCHF incidence in 2020.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Virus-derived DNA forms mediate the persistent infection of tick cells by Hazara virus and Crimean-Congo hemorrhagic fever virus

2021 ◽  
Author(s):  
Maria Vittoria Salvati ◽  
Claudio Salaris ◽  
Vanessa Monteil ◽  
Claudia Del Vecchio ◽  
Giorgio Palù ◽  
...  
Keyword(s):  
Viral Replication ◽  
Cell Lines ◽  
Persistent Infection ◽  
Hemorrhagic Fever ◽  
Viral Reservoir ◽  
Tick Cell ◽  
Infected Tick ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
Model Virus

Crimean-Congo hemorrhagic fever (CCHF) is a severe disease of humans caused by CCHF virus (CCHFV), a biosafety level (BSL)-4 pathogen. Ticks of the genus Hyalomma are the viral reservoir and they represent the main vector transmitting the virus to its hosts during blood feeding. We have previously shown that CCHFV can persistently infect Hyalomma -derived tick cell lines. However, the mechanism allowing the establishment of persistent viral infections in ticks is still unknown. Hazara virus (HAZV) can be used as a BSL-2 model virus instead of CCHFV to study virus/vector interactions. To investigate the mechanism behind the establishment of a persistent infection, we developed an in vitro model with Hyalomma -derived tick cell lines and HAZV. As expected, HAZV, like CCHFV, persistently infects tick cells without any sign of cytopathic effect, and the infected cells can be cultured for more than three years. Most interestingly, we demonstrated the presence of short viral-derived DNA forms (vDNAs) after HAZV infection. Furthermore, we demonstrated that the antiretroviral drug AZT could inhibit the production of vDNAs, suggesting that vDNAs are produced by an endogenous retrotranscriptase activity in tick cells. Moreover, we collected evidence that vDNAs are continuously synthesized, thereby downregulating viral replication to promote cell survival. Finally, vDNAs were also detected in CCHFV-infected tick cells. In conclusion, vDNA synthesis might represent a strategy to control the replication of RNA viruses in ticks allowing their persistent infection. IMPORTANCE Crimean-Congo hemorrhagic fever (CCHF) is an emerging tick-borne viral disease caused by CCHF virus (CCHFV). Ticks of the genus Hyalomma can be persistently infected with CCHFV representing the viral reservoir, and the main vector for viral transmission. Here we showed that tick cells infected with Hazara virus, a nonpathogenic model virus closely related to CCHFV, contained short viral-derived DNA forms (vDNAs) produced by endogenous retrotranscriptase activity. vDNAs are transitory molecules requiring viral RNA replication for their continuous synthesis. Interestingly, vDNA synthesis seemed to be correlated with downregulation of viral replication and promotion of tick cell viability. We also detected vDNAs in CCHFV-infected tick cells suggesting that they could represent a key element in the cell response to nairovirus infection and might represent a more general mechanism of innate immunity against RNA viral infection.

scholarly journals An Outbreak of Crimean-Congo Hemorrhagic Fever in the South West of Iran

2016 ◽  
Vol 10 (1) ◽  
Author(s):  
Mostafa Salehi-Vaziri ◽  
Shokrollah Salmanzadeh ◽  
Vahid Baniasadi ◽  
Tahmineh Jalali ◽  
Tahereh Mohammadi ◽  
...  
Keyword(s):  
Hemorrhagic Fever ◽  
The South ◽  
Crimean Congo Hemorrhagic Fever ◽  
South West

scholarly journals Epidémiologie de la fièvre Hémorragique de Crimée-Congo (FHCC) chez les bovins dans le département de Boboye au Niger

2020 ◽  
Vol 14 (3) ◽  
pp. 698-705
Author(s):  
Alima Maïna ◽  
Abdoulkarim Issa Ibrahim ◽  
Abdou Alassane ◽  
Hassane Adakal
Keyword(s):  
Immunosorbent Assay ◽  
Disease Transmission ◽  
Local Governments ◽  
Indirect Elisa ◽  
Hemorrhagic Fever ◽  
Elisa Test ◽  
Enzyme Linked Immunosorbent Assay ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus ◽  
Made In

La distribution et la dynamique des populations des tiques est un élément clé dans la connaissance des maladies transmises par ces vecteurs. C’est ainsi que cette étude a été conduite afin de mieux connaître l’épidémiologie de la Fièvre Hémorragique de Crimée-Congo (FHCC) dans les 8 communes du département de Boboye au Niger, où 355 sérums de bovins ont été collectés. En plus des sérums, des tiques ont été collectées sur 144 bovins, soit 18 par commune. Les sérums ont été soumis à un test ELISA (Enzyme Linked Immunosorbent Assay) indirect pour la détection d’anticorps anti-FHCC. Soixante-douze (72) éleveurs ont été interviewés sur leur connaissance de l’écologie des tiques, vecteurs du virus de la FHCC. Les résultats de l’enquête ont révélé que les éleveurs n’ont pas recours aux acaricides et que, dans leur majorité (55/72 soit 76,4 %), ils pratiquent la transhumance. L’étude a permis l’identification de 1342 tiques réparties en trois genres : Hyalomma (91,7%), Amblyomma (5,7%) et Rhipicephalus (Boophilus) (2,6%). La séroprévalence globale a été de 9,1±0,03%. Les communes de Harikanassou et Kiota ont été celles où les fortes prévalences ont été observées de 26,7 ± 12,9% et 22,5 ±12,9%. Le virus de la FHCC est en circulation chez la population animale, alors des investigations doivent être faites chez la population humaine.Mots clés : Anticorps anti-FHCC, Enzyme Linked Immunosorbent Assay Indirecte, Prévalence, Sérums, Tiques.   English Title: Crimean-Congo Hemorrhagic Fever (CCHF) ’s Epidemiology in cattle in Boboye’s department of Niger Republic To understand disease transmission by ticks, knowledge of population dynamics and distribution of these vectors are essentials. To sought that, the epidemiology of Crimean-Congo Hemorrhagic Fever (CCHF) in Niger Republic was studied by sampling 355 bovines (sera and ticks) in eight (8) local governments in Boboye’s department. Eighteen (18) bovines were sampled for ticks collection per local government making them a total of 144 bovine. Indirect ELISA test (enzyme-linked immunosorbent assay) was used to detect anti- CCHF antibodies. Seventy-two (72) farmers were surveyed on their knowledge on ticks’ ecology, main vectors of CCHF virus. The results revealed that farmers are not using acaricides, and their majority (55/72 thus 76.4%) practice Transhumance. The study allowed the identification of 1342 ticks distributed in 3 genus: Hyalomma (91.7%), Amblyomma (5.7%) and Rhipicephalus (Boophilus) (2.6%). The global seroprevalence against CCHF was (9.1 ± 0.03) %. Harikanassou and Kiota were the most affected local governments with respectively (26.7±12.9) % and (22.5±12,9) % prevalence. CCHV virus is circulating in animal population, so investigations must be made in human population. Keywords: Anti-CCHF antibodies, Indirect Enzyme Linked Immunosorbent Assay, Prevalence, Sera, Ticks.

scholarly journals Detection of the RNA for new multicomponent virus in patients with Crimean-Congo hemorrhagic fever in southern Russia

2020 ◽  
Author(s):  
Vladimir Ternovoi ◽  
Anastasia Gladysheva ◽  
Alexandra Sementsova ◽  
Anna Zaykovskaya ◽  
Anna Volynkina ◽  
...  
Keyword(s):  
Phylogenetic Analyses ◽  
Hemorrhagic Fever ◽  
European Part ◽  
Viral Rna ◽  
Crimean Congo Hemorrhagic Fever ◽  
Viral Genomes ◽  
Cchf Virus ◽  
European Part Of Russia ◽  
Human Sera ◽  
Southern Russia

Background: Recently, a new multicomponent RNA-containing virus was described and called as Jingmen tick virus (JMTV) supposedly belonging to flaviviruses. A virus consists of four viral particles and JMTV was firstly isolated from ticks in China and South America. Aims: Detection viral RNA specific for JMTV complex, sequencing genome fragments and taxonomy identification novel virus from JMTV complex in patients with Crimean-Congo hemorrhagic fever (CCHF) from southern European part of Russia. Materials and methods: Panel of 20 randomly selected sera from patients with confirmed Crimean-Congo hemorrhagic fever was collected in 2016 and was used for detection JMTV and CCHF viral RNA by PCR with experimental primers. Subsequent sequencing of isolated fragments of viral genomes was used for identification JMTV and CCHF virus genetic materials and phylogenetic analyses. Results: The viral RNAs of the CCHF virus and JMTV were detected in blood of four patients. Sequencing of the isolated PCR fragment of S segment CCHF virus allowed identifying these RNA isolates as Europe 1 lineage, subgroups Va and Vb of the CCHF virus that is a typical for the southern European part of the Russia. The nucleotide sequences of segment 2 (GP glycoprotein) of the JMTV were also detected by RP PCR and sequencing in these human sera. The new JMTV isolates were clustered together by phylogenetic analysis. The level of nucleotide identity for newly discovered JMTV isolates was only about 81-82% with comparison to the previously described European variants (Kosovo) of the JMTV. Conclusions: The results suggest that viral genomic RNA for new multicomponent flavivirus named as Manych virus and related to the JMTV complex was discovered in sera of CCHF patients in Russia.

scholarly journals Molecular Assay on Detection of Crimean Congo Hemorrhagic Fever (CCHF) Virus in Ixodid Ticks Collected from Livestock in Slaughterhouse from South of Iran

2020 ◽  
Author(s):  
Mostafa Salehi-Vaziri ◽  
Hassan Vatandoos ◽  
Alireza Sanei-Dehkordi ◽  
Mehdi Fazlalipour ◽  
Mohammad Hassan Pouriayevali ◽  
...  
Keyword(s):  
Tick Infestation ◽  
Hemorrhagic Fever ◽  
The Body ◽  
Ixodid Ticks ◽  
Public Health Issue ◽  
Hard Tick ◽  
Crimean Congo Hemorrhagic Fever ◽  
Hard Ticks ◽  
Slaughter House ◽  
Cchf Virus

Background: Ticks are vectors of a wide variety of pathogens that can be transmitted to humans, and tick-borne diseas­es are a significant public health issue worldwide. The present study was carried out on the hard tick infestation of live­stock transported to Rafsanjan slaughter house in the southeast of Iran. Methods: A cross-sectional survey was carried out biweekly from April to September 2016 to determine tick infesta­tion of the meat-producing animals. All the livestock included in our study were thoroughly inspected for the presence of hard ticks on different parts of their bodies. Results: A total of 258 hard ticks were collected from the body of livestock hosts. The ticks that were sampled were classified into two genera and five species: Hyalomma marginatum, Hy. anatolicum, Hy. asiaticum, Hy. dromedarii, and Rhipicephalus sanguineus. Hyalomma dromedarii was the most abundant species in the study area. More than 50 per­cent of the sampled ticks were collected from the body of camels brought to the slaughter house however molecular analysis showed no Crimean Congo Hemorrhagic Fever (CCHF) virus infection in tick specimens. The Sex ratio of the sampled hard ticks shows that female tick infestation was more common among the study livestock. Conclusion: Due to the crucial role of hard ticks in the transmission of different pathogens to humans, additional inves­tigations are necessary to determine the risk of consumption of infested meat-producing animals in the study area.

scholarly journals Crimean-Congo Hemorrhagic Fever in Iraq During 2010

2012 ◽  
Vol 36 (0E) ◽  
pp. 99-103
Author(s):  
Emad S. Abul-Eis ,
Keyword(s):  
Human Serum ◽  
Hemorrhagic Fever ◽  
Zoonotic Disease ◽  
Immunoglobulin M ◽  
Serum Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Human Serum Samples ◽  
Specific Immunoglobulin ◽  
Cchf Virus

Crimean-Congo hemorrhagic fever (CCHF) is a viral zoonotic disease with a highmortality rate in humans. CCHF is caused by genus Nairovirus, in family of Bunyaviridae,and is transmitted to humans through the bite of ticks Hyalomma spp or contact with blood ortissues of CCHF patients or infected livestock.The total numbers of positive patients to CCHF virus was 11 out of 44 suspected sampleswere examined from eight provinces during the period from January to December 2010 . Theway of transmission is due to contact with blood and tissues of infected animals, and onepatient slaughtered sheep in his house. ELISA was used to detect Crimean-Congohemorrhagic fever (CCHF) virus-specific immunoglobulin M (IgM) in human serum samples.

scholarly journals Emerging diseases: Crimean-Congo hemorrhagic fever

2004 ◽  
Vol 57 (9-10) ◽  
pp. 453-456 ◽  
Author(s):  
Nada Kuljic-Kapulica
Keyword(s):  
Eastern Europe ◽  
Central Asia ◽  
Hemorrhagic Fever ◽  
Emerging Diseases ◽  
Control Measures ◽  
Ixodid Ticks ◽  
Sub Saharan Africa ◽  
Antibody Detection ◽  
Crimean Congo Hemorrhagic Fever ◽  
Cchf Virus

Introduction Recognized for many years in central Asia and Eastern Europe, Crimean-Congo hemorrhagic fever (CCHF) is a severe zoonotic disease which affects people coming into contact with livestock or ticks. The range of the CCHF virus is now known to extend form central Asia to India, Pakistan, Afghanistan, Iran, Iraq, the Middle East, Eastern Europe, and to most of Saharan and sub-Saharan Africa. Etiology CCHF virus is a member of the Bunyavirus family, and is classified as a Nairovirus. Clinical features After an incubation period of approximately 3 to 6 days the abrupt onset of acute febrile illness occurs. The first symptoms are similar to severe influenza and include fever, headache, severe back and abdominal pain. The hemorrhagic fever manifestations occur after several days of illnesses and include petechial rash, ecchymoses, hematemmesis, and melenna. Cases typically present with some form of hepatitis. The mortality rate is 10-50% in different outbreaks with deaths typically occurring during the second week of illness. Epidemiology The genus Hyalomma of ixodid ticks is the most important vector of the CCHF virus. Vertebrates including birds and small animals provide excellent amplifier hosts of both the virus and the tick. The virus can be transmitted to humans by direct contact with infected animals and from person to person. Diagnosis Early diagnosis is possible in special laboratories using antigen detection by imunofluorescence or ELISA tests or molecular methods as PCR and antibody detection. Control Tick control measures need to be emphasized and utilized to prevent CCHF. This includes spraying camp sites, clothing and danger areas with acaricides or repellent. Strict isolation of patients with CCHF and a focus on barrier nursing would help to prevent nosocomial spread. Presently the vaccine is a dangerous mouse brain-derived version. Future development of a vaccine would help to prevent human infection.

scholarly journals Characterization of the Glycoproteins of Crimean-Congo Hemorrhagic Fever Virus

2002 ◽  
Vol 76 (14) ◽  
pp. 7263-7275 ◽  
Author(s):  
Angela J. Sanchez ◽  
Martin J. Vincent ◽  
Stuart T. Nichol
Keyword(s):  
Hemorrhagic Fever ◽  
Lassa Fever ◽  
Amino Acid Sequences ◽  
Fever Virus ◽  
Virus Protein ◽  
Glycoprotein Precursor ◽  
Crimean Congo Hemorrhagic Fever ◽  
Amino Terminal ◽  
Cchf Virus ◽  
Virus Strains

ABSTRACT Crimean-Congo hemorrhagic fever (CCHF) virus is the cause of an important tick-borne disease of humans throughout regions of Africa, Europe, and Asia. Like other members of the genus Nairovirus, family Bunyaviridae, the CCHF virus M genome RNA segment encodes the virus glycoproteins. Sequence analysis of the CCHF virus (Matin strain) M RNA segment revealed one major open reading frame that potentially encodes a precursor polyprotein 1,689 amino acids (aa) in length. Comparison of the deduced amino acid sequences of the M-encoded polyproteins of Nigerian, Pakistani, and Chinese CCHF virus strains revealed two distinct protein regions. The carboxyl-terminal 1,441 aa are relatively highly conserved (up to 8.4% identity difference), whereas the amino-terminal 243 to 248 aa are highly variable (up to 56.4% identity difference) and have mucin-like features, including a high serine, threonine, and proline content (up to 47.3%) and a potential for extensive O-glycosylation. Analysis of released virus revealed two major structural glycoproteins, G2 (37 kDa) and G1 (75 kDa). Virus protein analysis by various techniques, including pulse-chase analysis and/or reactivity with CCHF virus-specific polyclonal and antipeptide antibodies, demonstrated that the 140-kDa (which contains the mucin-like region) and 85-kDa nonstructural proteins are the precursors of the mature G2 and G1 proteins, respectively. The amino termini of the CCHF virus (Matin strain) G2 and G1 proteins were established by microsequencing to be equivalent to aa 525 and 1046, respectively, of the encoded polyprotein precursor. The tetrapeptides RRLL and RKPL are immediately upstream of the cleavage site for mature G2 and G1, respectively. These are completely conserved among the predicted polyprotein sequences of all the CCHF virus strains and closely resemble the tetrapeptides that represent the major cleavage recognition sites present in the glycoprotein precursors of arenaviruses, such as Lassa fever virus (RRLL) and Pichinde virus (RKLL). These results strongly suggest that CCHF viruses (and other members of the genus Nairovirus) likely utilize the subtilase SKI-1/S1P-like cellular proteases for the major glycoprotein precursor cleavage events, as has recently been demonstrated for the arenaviruses.

Sign in / Sign up

Export Citation Format

Share Document