scholarly journals Morphological and Molecular Characteristics of Pratylenchus coffeae from the Origin of Robusta Coffee Plantation in Malang, East Java

2019 ◽  
Vol 23 (2) ◽  
pp. 211
Author(s):  
Aris Budiman ◽  
Supramana Supramana ◽  
Giyanto Giyanto
Keyword(s):  
Phylogenetic Tree ◽  
Universal Primers ◽  
Molecular Characteristics ◽  
28S Rrna ◽  
Coffee Plantation ◽  
Phylogenetic Tree Analysis ◽  
Morphometric Characters ◽  
Pratylenchus Coffeae ◽  
Robusta Coffee ◽  
Molecular Characters

Pratylenchus coffeae is the most important plant-parasitic nematode in Robusta coffee plantations. Information regarding morphology, morphometric and molecular characters of P. coffeae has not been reported in Indonesia. This study is aimed to describe those characters of P. coffeae that attack Robusta coffee. Root samples were taken from Robusta coffee plantation in Malang, East Java. Nematode extractions was conducted using a mist chamber method. Morphology and morphometric characters were observed from the permanent nematode slides. Single nematode DNA extract was amplified at the D2D3 segment of 28S rRNA and ITS1-5.8S-ITS2 rRNA with universal primers. Amplicon was sequenced and analysed for phylogenetic tree relationships. Female morphological key character of P. coffeae observed are: lip with two annulations, four lateral lines, esophageal overlap with intestine ventrally, monodelphic, and truncated tail shape. Male spicules curved ventrally. Female morphometrics are: n=26, L = 556.4 μm, DGO = 2.4 μm, anterior gonad = 174.8 μm, a = 28.5, b = 6.1, b’ = 4.1, c = 20.1, c’ = 2.3, V = 81.7. A Male is smaller than a female with n=24, L = 505.9 μm,  a = 32.3, b = 5.5, b '= 3.9, c = 15.3, c' = 2.8 and T = 40.6. The molecular characters of P. coffeae were investigated for two isolates, namely SA1 and SA2.  Based on the D2D3 and ITS1-5.8S-ITS2 regions, isolate SA1 has similarity level of 99% and 97% to the P. coffeae  from NCBI. Similar result was shown by Isolate SA2 with similarity of 100% and 100% respectively. Phylogenetic tree analysis using Maximum Likelihood at the D2D3 segment of 28S rRNA and ITS1-5.8S-ITS2 regions showed that P. coffeae in this study was included in one clade with P. coffeae from several countries.

scholarly journals Distribution of Radopholus similisand Pratylenchus CoffeaeNematodes in Coffee Plantation

2006 ◽  
Vol 23 (3) ◽  
Author(s):  
Retno Hulupi ◽  
Mulyadi . ◽  
Bekti Andayani
Keyword(s):  
Soil Surface ◽  
Radopholus Similis ◽  
Type B ◽  
Coffee Plantation ◽  
Climate Type ◽  
Arabica Coffee ◽  
Pratylenchus Coffeae ◽  
Robusta Coffee ◽  
Type D ◽  
The Difference

A research to evaluate the difference of damage levels caused by two species nematodes, Radopholus similis and Pratylenchus coffeae on Arabica and Robusta coffee which were planted in the same endemic area have been conducted at Kalibendo (700 m asl. climate type B) and Blawan coffee estate (1200 m asl., climate type D) for two years. The results showed that in the medium highland (700 m asl.) R. similis attacked Arabica coffee with necrotic root scale higher than surface Robusta coffee. Distribution of R. similis population in the 50 cm depth below soil surface was likely with their root distribution. On the other hand P. coffeae in 30 cm depth below soil therefore their resistance to R. similis was more likely due to the escape reason, as result of their different distribution population of those species in different depth. Key words : Radopholus similis, Pratylenchus coffeae, Arabica coffee, Robusta coffee, distribution population.

scholarly journals Phylogenetic analyses and genomic variation of the 2019-nCoV

2020 ◽  
Vol 2 (1) ◽  
pp. 126-130
Author(s):  
Faiz Ul Haq ◽  
◽  
Sidrah Saleem ◽  
Muhammad Imran ◽  
Ayesha Ghazal ◽  
...  
Keyword(s):  
Phylogenetic Tree ◽  
Sequence Similarity ◽  
Phylogenetic Analyses ◽  
Genomic Analysis ◽  
Genomic Variation ◽  
Molecular Characteristics ◽  
Phylogenetic Tree Analysis ◽  
High Sequence Similarity ◽  
Human Environment ◽  
Bat Coronavirus

There is a rising global concern about the SARS CoV-2 as a public health threat. Complete genome sequence have been released by the worldwide scientific community for understanding the molecular characteristics and evolutionary origin of this virus. Aim of the current context is to present phylogenetic relationship and genomic variation of 2019-nCoV. Based on availability of genomic information, we constructed a phylogenetic tree including also representatives of other coronaviridae, such as Middle East respiratory syndrome, severe acute respiratory syndrome and Bat coronavirus. The phylogenetic tree analysis suggested that SARS CoV-2 significantly clustered with bat SARS like coronavirus genome, however structural analysis revealed mutation in Spike Glycoprotein and nucleocapsid protein. However our phylogenetic and genomic analysis suggests that bats can be the reservoir for this virus. Lack of forest might be the fact in association of bats with human environment. It is also difficult to study on bats due to absence of proper reagent and availability of few species for research. We confirm high sequence similarity (>99%) among sequenced SARS CoV-2 genomes, and 96% genome identity with the bat coronavirus, confirming the notion of a zoonotic origin of SARS CoV-2.

scholarly journals First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 702-702 ◽  
Author(s):  
B. Gao ◽  
R. Y. Wang ◽  
S. L. Chen ◽  
X. H. Li ◽  
J. Ma
Keyword(s):  
Sweet Potato ◽  
Dna Sequences ◽  
Molecular Characteristics ◽  
28S Rrna ◽  
Storage Roots ◽  
Specific Primers ◽  
First Report ◽  
Meloidogyne Enterolobii ◽  
Meloidogyne Spp ◽  
Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals Phylogenetic Analysis of Kobuvirus and Astrovirus From Korean Wild Boars: 2016-2018

2021 ◽  
Author(s):  
Jihye Shin ◽  
SeEun Choe ◽  
Bang-Hun Hyun ◽  
Dong-Jun An
Keyword(s):  
Phylogenetic Analysis ◽  
Phylogenetic Tree ◽  
Porcine Kobuvirus ◽  
Phylogenetic Tree Analysis ◽  
Tree Analysis ◽  
Wild Boars ◽  
Porcine Astrovirus ◽  
The One

Abstract The prevalence of porcine kobuvirus (PKoV) and porcine astrovirus (PAstV) in 845 Korean wild boars (KWB) during 2016-2018 were 28.0% and 10.6%, respectively, and co-infection of two viruses showed 5.1%. Phylogenetic tree analysis also revealed that 236 PKoVs from KWB were divided to diverse lineages within Aichivirus C group but the one strain (WKoV16CN-8627) was included the same cluster with bovine kobuvirus (Achivirus B). Eighty-nine PAstVs from KWB was belonged predominantly to lineage PAstV4 and only one strain (WAst17JN-10931) included novel to lineage PAstV2. Two viruses are epidemic more in young (≤ 12 months) than in old pigs (> 12 months).

scholarly journals Karakteristik vegetatif dan taksasi produksi kopi robusta tahun 2018 dan 2019 (Survey pada perkebunan kopi rakyat di Dusun Mandang, Desa Sucen, Kecamatan Gemawang, Kabupaten Temanggung)

Agromix ◽  
2020 ◽  
Vol 11 (2) ◽  
pp. 125-135
Author(s):  
Yohana Theresia Maria Astuti ◽  
Tri Nugraha Budi Santosa ◽  
Dian Pratama Putra ◽  
Enny Rahayu ◽  
Agus Solifudin ◽  
...  
Keyword(s):  
Survey Methods ◽  
Sampling Technique ◽  
Suitability Analysis ◽  
Coffee Plantation ◽  
Coffee Production ◽  
Land Suitability Analysis ◽  
Purposive Sampling ◽  
Robusta Coffee ◽  
Number Of Leaves ◽  
Better Than

This study aims to evaluate the dinamics of coffee production  in Mandang, Sucen Village, Gemawang District, Temanggung on 2018 and 2019. The research was carried out at  people coffee plantation in Mandang Hamlet, Sucen Village, Temanggung. Research using survey methods. Observation of performance with 30 samples taken by purposive sampling technique on 3 clones. Land suitability analysis was carried out at 3 observation points. The results obtained are: The vegetative characteristics  of robusta coffee BP 288 and BP 409 are better than  BP 358 clones, while the robusta coffee production is the same  on various clones and  plantation location.  The long dry season  in 2018 and 2019 has an effect on the decline of the number of leaves and coffee production in 2019 compared to 2018 in Mandang Hamlet, Sucen  Village, Gemawang district, Temanggung.

Molecular Analysis of Hepatitis B Virus in Mothers-Children Pairs

2021 ◽  
Vol 8 (1) ◽  
Author(s):  
Chatzidaki V ◽  
◽  
Perdikogianni C ◽  
Galanakis E ◽  
Paraskevis D ◽  
...  
Keyword(s):  
Hepatitis B Virus ◽  
Hepatitis B ◽  
Phylogenetic Tree ◽  
Surface Glycoprotein ◽  
Phylogenetic Tree Analysis ◽  
Source Of Infection ◽  
B Virus ◽  
Maximum Likelihood Methods ◽  
Infection Source ◽  
Relationship Of

ackground: Vertical transmission of Hepatitis B Virus (HBV) is the primary infection source for infants, but little is known on the proportion of children that have acquired HBV from their mothers. Objective: We investigated the relationship of HBV sequencing in HBVpositive children and their mothers and explored the HBV phylogenetic tree. Methods: Serum-extracted HBV-DNA from 38 individuals (13 children paired to nine mothers, 16 unpaired infected children) was amplified by polymerase chain reaction and the target region HBV surface glycoprotein (amino acids 40-171) was directly sequenced. Following editing and alignment of these sequences, phylogenetic tree analysis was performed using the neighbourjoining and maximum-likelihood methods. Results: Analysis was successfully performed in 29 subjects (23 children and six mothers), including six mother-child pairs. All individuals were infected by genotype D. Subgenotype adw3 prevailed (21, 72.4%), followed by ayw2 (4, 13.8%) and ayw3 (4, 13.8%). Among six mother-child pairs, three had identical and three had different subgenotypes. Phylogenetic analysis revealed that HBV sequences from three children did not cluster with their siblings suggesting a different source of infection. Conclusion: Our findings suggest that HBV subgenotypes in infected children may not be identical to their mothers’ and point to non-vertical HBV transmission in childhood.

Integrative description of Hypsibius repentinus sp. nov. (Eutardigrada: Hypsibiidae) from Sweden

2021 ◽  
Vol 30 (1) ◽  
pp. 101-115
Author(s):  
D.V. Tumanov ◽  
G.S. Avdeeva
Keyword(s):  
18S Rrna ◽  
Species Group ◽  
Integrative Approach ◽  
Similar Species ◽  
28S Rrna ◽  
Morphometric Characters ◽  
Morphological Diagnosis ◽  
A New Species ◽  
Scanning Electron ◽  
Hypsibius Dujardini

A new species of tardigrade from the genus Hypsibius Ehrenberg, 1848 is described from the bottom sediments of a small lake in the central part of Scandinavian Peninsula (Sweden), using an integrative approach, i.e. morphological techniques (light and scanning electron microscopy) combined with a molecular analysis (18S rRNA, 28S rRNA, ITS-2 and COI markers). Hypsibius repentinus sp. nov. belongs to the Hypsibius dujardini species–group and differs from the most similar species of this group in having a second macroplacoid with a definite constriction and in some other morphometric characters. Morphological diagnosis for the Hypsibius dujardini species–group is proposed, and its composition is discussed.

Morphological and molecular characterisation of Helicotylenchus ciceri n. sp. and H. scoticus Boag & Jairajpuri, 1985 (Nematoda: Hoplolaimidae) from Iran

Nematology ◽  
2020 ◽  
Vol 22 (6) ◽  
pp. 611-626
Author(s):  
Fariba Mohammadi Zameleh ◽  
Akbar Karegar ◽  
Reza Ghaderi ◽  
Abbas Mokaram Hesar
Keyword(s):  
New Species ◽  
Excretory Pore ◽  
18S Rrna ◽  
Phylogenetic Analyses ◽  
Rrna Genes ◽  
28S Rrna ◽  
Molecular Characterisation ◽  
Closely Related Species ◽  
Partial 18S ◽  
Molecular Characters

Summary Helicotylenchus ciceri n. sp. and H. scoticus are described and illustrated based on morphological, morphometric and molecular characters. The new species is characterised by a conical and truncated lip region with five or six distinct annuli, stylet 32-37 μm long with anteriorly concave knobs, secretory-excretory pore posterior to the pharyngo-intestinal valve, dorsally convex-conoid tail with a terminal projection, phasmids 14 (7-20) annuli anterior to the level of anus, empty spermatheca and absence of males. Intraspecific variation of 16 populations of H. scoticus, collected from chickpea and lentil fields in Kermanshah province, western Iran, is discussed. The results of the phylogenetic analyses based on the sequences of the partial 18S rRNA, D2-D3 expansion segments of 28S rRNA and ITS rRNA genes are provided for the studied species, confirming their differences from each other and determining the position of them and their relationships with closely related species.

Morphological variation in Xenoxybelis boulengeri (Procter, 1923) (Serpentes, Xenodontinae, Philodryadini)

Zootaxa ◽  
2008 ◽  
Vol 1743 (1) ◽  
pp. 53 ◽  
Author(s):  
ANA LÚCIA DA COSTA PRUDENTE ◽  
MÁRCIO ANDRÉ AMORIM DA SILVA ◽  
WÁLDIMA ALVES DA ROCHA ◽  
FRANCISCO LUÍS FRANCO
Keyword(s):  
Morphological Variation ◽  
Rare Species ◽  
Original Description ◽  
External Morphology ◽  
Time Analysis ◽  
Morphometric Characters ◽  
Permit Allocation ◽  
Scientific Collections ◽  
First Time ◽  
Molecular Characters

The genus Xenoxybelis contains two species, X. argenteus and X. boulengeri, characterized by semi-arboreal habits and an extremely thin rostral area, classified in the subfamily Xenodontinae (Colubridae). Xenoxybelis boulengeri is considered a rare species and is poorly represented in scientific collections. Its external morphology is known only from the original description and seven other specimens. In this study, twenty additional specimens were examined from the Brazilian states of Acre, Amazonas and Rondônia. Variation in meristic and morphometric characters are described, and new characters are incorporated in a revised diagnosis of the species. Illustrations and a description of the hemipenes of X. boulengeri are presented for the first time. Analysis of morphological and molecular characters permit allocation of Xenoxybelis to the tribe Phylodryadini, together with Ditaxodon, Philodryas, Pseudablabes and Tropidodryas.

Sign in / Sign up

Export Citation Format

Share Document