scholarly journals Perancangan primer gen lktB pada Fusobacterium necrophorum untuk analisis PCR

2021 ◽  
Vol 2 (2) ◽  
pp. 47-55
Author(s):  
Rian Ka Praja ◽  
Reny Rosalina
Keyword(s):  
Secondary Structure ◽  
Laboratory Experiments ◽  
Gene Sequence ◽  
Fusobacterium Necrophorum ◽  
Optimal Conditions ◽  
Accession Number ◽  
Product Size ◽  
Reverse Primer ◽  
Forward Primer ◽  
Diagnostic Support

Fusobacterium necrophorum is a pathogen causing disease in animals, especially cattle, goats, and sheep. F. necrophorum infection can result in a variety of necrotic conditions (necrobacillosis). This study aimed to design a pair of primers for detecting the leukotoxin B (lktB) gene expressed by F. necrophorum as diagnostic support. The lktB gene sequence was obtained from GenBank NCBI with accession number AF312861.3:685-2337. Furthermore, the sequence was used as a template for in silico primer design using Primer-BLAST. Primer candidates successfully designed were then analyzed for their secondary structure using NetPrimer. The results showed that forward primer set 6 (5'-TCGGATGCTGGAATGCTACTT-3') and reverse primer set 6 (5'-GGGCTCCCAAATCCTTACGA-3') were a favorable primer set with a product size of 228 bp. However, laboratory experiments need to be carried out to determine the optimal conditions for this primer set.

scholarly journals Primer Design and Analysis for Detection of mecA gene

2021 ◽  
Vol 5 (3) ◽  
pp. 245-253
Author(s):  
Armini Syamsidi ◽  
Nuur Aanisah ◽  
Reyhan Fiqram ◽  
Imanuel Al Jultri
Keyword(s):  
Secondary Structure ◽  
Dna Polymerase ◽  
Base Pair ◽  
Meca Gene ◽  
Chain Reaction ◽  
Base Sequences ◽  
Reverse Primer ◽  
Pcr Method ◽  
Polymerase Chain ◽  
Forward Primer

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method

scholarly journals In vitro evaluation of the effect of mutations in primer binding sites on detection of SARS-CoV-2 by RT-qPCR

2021 ◽  
Author(s):  
Fee Zimmermann ◽  
Maria Urban ◽  
Christian Krueger ◽  
Mathias Walter ◽  
Roman Woelfel ◽  
...  
Keyword(s):  
Binding Sites ◽  
Detrimental Effect ◽  
In Vitro Evaluation ◽  
In Vitro Transcripts ◽  
Nucleotide Mismatch ◽  
Reverse Primer ◽  
Forward Primer

A number of RT-qPCR assays for the detection of SARS-CoV-2 have been published and are listed by the WHO as recommended assays. Furthermore, numerous commercial assays with undisclosed primer and probe sequences are on the market. As the SARS-CoV-2 pandemic progresses, the virus accrues mutations, which in some cases - as seen with the B.1.1.7 variant - can outperform and push back other strains of SARS-CoV-2. If mutations occur in primer or probe binding sites, this can impact RT-qPCR results and impede SARS-CoV-2 diagnostics. Here we tested the effect of primer mismatches on RT-qPCR performance in vitro using synthetic mismatch in vitro transcripts. The effects of the mismatches ranged from a shift in ct values from -0.13 to +7.61. Crucially, we found that a mismatch in the forward primer has a more detrimental effect for PCR performance than a mismatch in the reverse primer. Furthermore, we compared the performance of the original Charite RdRP primer set, which has several ambiguities, with a primer version without ambiguities and found that without ambiguities the ct values are ca. 3 ct lower. Finally, we investigated the shift in ct values observed with the Seegene Allplex kit with the B.1.1.7 SARS-CoV-2 variant and found a three-nucleotide mismatch in the forward primer of the N target.

scholarly journals IDENTIFICATION OF CITRUS WHITEFLY, HOST OF ENTOMOPATHOGENIC FUNGI (ASCHERSONIA PLACENTA) IN BALI INDONESIA

2020 ◽  
Vol 7 (2) ◽  
pp. 57
Author(s):  
Ni Putu Merthaningsih ◽  
I Putu Sudiarta ◽  
Gusti Ngurah Alit Susanta Wirya
Keyword(s):  
Entomopathogenic Fungi ◽  
Natural Enemies ◽  
Evolutionary Genetics ◽  
Morphological Identification ◽  
Chemical Insecticide ◽  
Negative Effect ◽  
Citrus Production ◽  
Reverse Primer ◽  
Environmentally Friendly Method ◽  
Forward Primer

One of the pests of citrus is whitefly that, causes damage directly or/and indirectly to the citrus production. To control whitefly the farmer usually use chemical insecticide, however the utilization of chemical insecticide has been reported to haves many negative effect. To minimize the utilization of chemical insecticide, the environmentally friendly method is needed. One of the method is to utilize the natural enemies. Natural enemies are including, parasitiod, predator as well as insect pathogen (entomopathogen). In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia. However the species of whitefly has not been identified. In this research the identification of whitefly, the host insect of A. placenta was conducted based on morphological and molecular identification. Morphological identification of whitefly use puparial stage, started with sample preparation by Slide Mounting Protocol. The target  of mitochondrial cytochrome c oxidase subunit I (mtCOI) gen was successfully amplified (700 bp) by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The result shows that the mtCOI sequence of P. minei from Bali (LC491421) has the highest percentage among others with MK421974 P. minei (score homology 96%). The morphological recognition and sequence analysis show that the species of citrus whitefly is  Paraleyrodes minei.

scholarly journals PCR Analysis of the Distribution of Unicellular Cyanobacterial Diazotrophs in the Arabian Sea

2004 ◽  
Vol 70 (12) ◽  
pp. 7355-7364 ◽  
Author(s):  
Sophie L. Mazard ◽  
Nicholas J. Fuller ◽  
Karen M. Orcutt ◽  
Oliver Bridle ◽  
Dave J. Scanlan
Keyword(s):  
Arabian Sea ◽  
Marine Diatom ◽  
Pcr Analysis ◽  
Oligonucleotide Primer ◽  
Rrna Gene ◽  
Key Factor ◽  
Subsurface Waters ◽  
Reverse Primer ◽  
The 16S Rrna Gene ◽  
Forward Primer

ABSTRACT An oligonucleotide primer, NITRO821R, targeting the 16S rRNA gene of unicellular cyanobacterial N2 fixers was developed based on newly derived sequences from Crocosphaera sp. strain WH 8501 and Cyanothece sp. strains WH 8902 and WH 8904 as well as several previously described sequences of Cyanothece sp. and sequences of intracellular cyanobacterial symbionts of the marine diatom Climacodium frauenfeldianum. This oligonucleotide is specific for the targeted organisms, which represent a well-defined phylogenetic lineage, and can detect as few as 50 cells in a standard PCR when it is used as a reverse primer together with the cyanobacterium- and plastid-specific forward primer CYA359F (U. Nübel, F. Garcia-Pichel, and G. Muyzer, Appl. Environ. Microbiol. 63:3327-3332, 1997). Use of this primer pair in the PCR allowed analysis of the distribution of marine unicellular cyanobacterial diazotrophs along a transect following the 67°E meridian from Victoria, Seychelles, to Muscat, Oman (0.5°S to 26°N) in the Arabian Sea. These organisms were found to be preferentially located in warm (>29°C) oligotrophic subsurface waters between 0 and 7°N, but they were also found at a station north of Oman at 26°N, 56°35′E, where similar water column conditions prevailed. Slightly cooler oligotrophic waters (<29°C) did not contain these organisms or the numbers were considerably reduced, suggesting that temperature is a key factor in dictating the abundance of this unicellular cyanobacterial diazotroph lineage in marine environments.

scholarly journals First Molecular Identification of Sunfish in North Bali Water

2019 ◽  
Vol 3 (1) ◽  
pp. 12
Author(s):  
I Made Oka Riawan ◽  
Gede Iwan Setiabudi ◽  
I Made Merdana ◽  
I Putu Mangku Mariasa ◽  
Kadek Teguh Wirasastra
Keyword(s):  
Polymerase Chain Reaction ◽  
Molecular Identification ◽  
Polymerase Chain Reaction Method ◽  
Accession Number ◽  
Chain Reaction ◽  
Reaction Method ◽  
D Loop ◽  
Reverse Primer ◽  
Polymerase Chain ◽  
Full Body

Stranded Sunfish in North Bali with full body we collect to do molecular identification. Samples were amplified at the d-loop locus (control region) using the PCR (Polymerase Chain Reaction) method. Primers used in PCR are H16498 as primary front (forward) and L15812 as reverse primer. Similarity value of 95% after alignment with Mola ramsayi (accession number accession AY940824) on GenBank, and the gaps of the nucleotide just 1%. The stranded sunfish identified using partial sequence mtDNA is the same species as the species Mola ramsayi.

Identification and Characterization of L1-Mediated Large Tandem Duplication, Spanning Exon 4 to 10 of the F13A1, In a Patient with Congenital Factor XIII Deficiency.

Blood ◽  
2010 ◽  
Vol 116 (21) ◽  
pp. 3659-3659 ◽  
Author(s):  
Hiroshi Inaba ◽  
Keiko Shinozawa ◽  
Kagehiro Amano ◽  
Katsuyuki Fukutake
Keyword(s):  
Factor Xiii ◽  
Tandem Duplication ◽  
Mrna Level ◽  
Pcr Product ◽  
Reverse Primer ◽  
Exon 9 ◽  
Exon 4 ◽  
L1 Element ◽  
Exon 10 ◽  
Forward Primer

Abstract Abstract 3659 Blood coagulation factor XIII (FXIII) is a plasma glycoprotein that plays an important role in the stabilization of fibrin clot in the final stage of blood coagulation. The FXIII circulates as a heterotetramer composed of two A and two B subunits in plasma. The A subunit (FXIIIA) possesses catalytic activity and this catalytic subunit is carried and protected by the B subunit (FXIIIB). Inherited deficiency of FXIII is a rare autosomal recessive bleeding disorder. Based on the genotype, it is classified into two types: FXIIIA deficiency (>95% of all cases), characterized by mutations in the F13A1 gene, and FXIIIB deficiency, characterized by mutations in the F13B gene. At the time of writing, at least 86 different mutations, most of which are point mutations, have been identified and registered in the F13-database. Here we show a novel, large tandem duplication in the F13A1 gene of a patient with congenital factor XIII deficiency. A female patient, born to consanguineous parents, suffered from severe bleeding diathesis, including menorrhagia, intracranial hemorrhage and ovarian hemorrhage, from childhood. Bleeding manifestations had been successfully controlled by monthly prophylactic replacement therapy using factor XIII concentrate (Fibrogammin). Trough levels of both factor XIII activity and antigen were 19% (Berichrom FXIII) and <10% (ELISA method), respectively. No pathogenic mutations associated with FXIII deficiency were detected from nucleotide sequencing of the coding region, 5′-UTR and 3′-UTR of both F13A1 and F13B. However, from an observation of the RT-PCR amplification state, the F13A1 mRNA level of the patient was apparently lower than that of healthy individuals. This result suggested the existence of abnormalities in the patient's F13A1. Relative exon copy number analysis using real-time PCR revealed two times as many of the continuing 7 exons (exon 4–10) as in the remaining region of the F13A1. This is likely due to some genomic rearrangement, probably homologous recombination in the F13A1 gene. IVS-3 and IVS-10 of F13A1 were very large and contained many repetitive sequences. The existence of an almost full-length (≂f6kb) L1 element, a well known long interspersed repetitive element (LINE) in humans, in both introns suggests that the recombination might arise from the L1 element. The provision of the PCR product (amplified by an IVS-10 specific forward primer and an IVS-3 specific reverse primer) confirmed that IVS-10 connected to IVS-3 with L1 as the boundary. Furthermore, sequencing this PCR product identified the 15bp sequence in the L1 element as an actual breakpoint. Taken together with the results of the analysis of the genomic DNA, this confirmed that the L1-mediated large (≂f109kb) tandem duplication was located in the patient's F13A1. In order to quantify the F13A1 mRNA, a relative real-time PCR quantification was performed using TaqMan Gene Expression Assays. Three different positions: one upstream of duplication (Exon2-3), one at duplication (Exon5-6) and one downstream of the duplication (Exon13-14) were used. The mRNA level of the patient was a markedly low compared to the normal control and the duplicated region (28% of normal) was clearly higher than both the upstream and downstream positions (9% of normal for each). This result reflected that the mRNA was probably maintaining the duplication. In order to analyze the mRNA splicing of the joint between the two duplicated regions, RT-PCR using a forward primer in exon 9 and a reverse primer in exon 4 of F13A1 was performed. Two major transcripts were amplified. The larger transcript was the product that keeps the genomic exon order and connects exon 10 to 4. However, the transcript is thought to lead to frameshift and to generate premature termination codon in exon 4. The other was the product that was skipping exon 10 and connected exon 9 to 4. This transcript is thought to escape frameshift and may translate to the unusual extra large FXIIIA. However, it is unlikely that the protein translated from the extra large mRNA circulates in blood. In conclusion, we identified an L1-mediated large tandem duplication, spanning exon 4 to 10 of the F13A1 gene, as an etiology of the congenital FXIII deficiency. Disclosures: No relevant conflicts of interest to declare.

scholarly journals ISOLATION OF FLAVONOID 3’5’HYDROXILASE GENE FROM SNAKEWEED (Stachytarpheta indica auct. non. (L.) Vahl)

2015 ◽  
Vol 2 (1) ◽  
pp. 41
Author(s):  
Mega H Dewi ◽  
Riska Anggraini ◽  
Laily M K Mastika ◽  
Murni Saptasari ◽  
Dwi Listyorini
Keyword(s):  
Petunia Hybrida ◽  
Gene Locus ◽  
Consensus Sequences ◽  
Bioactive Component ◽  
Phenyl Propanoid ◽  
H Gene ◽  
Reverse Primer ◽  
I Gene ◽  
Forward Primer ◽  
Conserve Region

Stachytarpheta is one of Indonesian medicinal plants which have a wide species diversity. The bioactive component in snakeweed herb including naringenin, flavonol, and flavon are mainly derivate from phenyl propanoid (flavonoid). The gene encodes F3’5’Hydroxilation (F3’5H) involved in the biosynthesis of flavonoid product, by means of catalysis hydroxylation on the C atom #3 and #5 of benzene ring. Recently, has not yet meet publication about F3’5’H from snakeweed herb. The aim of this study was to isolate F3’5H gene from Stachytarpheta indica, using primers which were designed from conserve region of Petunia hybrida F3’5’H gene; HF1 and HF2 alleles. Forward primer is 5'-TGATGCTGCTAAAGCATTCT-3' and reverse primer is 5’GTGCACGCAGGTGACATATG-3’. The amplified fragments were un-specific non-consensus sequences, suggested that two homolog gene locus were isolated. Sequence analysis showed that both share two different domains; conserve-upstream and homolog-downstream domains. It is suggested that Stachytarpheta indica may possesses different alleles for F3’5’H, i.e. HF1 and HF2, as of Petunia hybrida. Keywords: F3’5’H gene, Stachytarpheta indica, snakeweed 

scholarly journals Isolation of Flower Development Regulator Gene SEPALLATA 1 in Phalaenopsis amabilis (L.) Blume

2017 ◽  
Vol 3 (4) ◽  
pp. 54
Author(s):  
Ayu Linda Febriani ◽  
Riska Anggraini ◽  
Muthia Naila Mazieda ◽  
Murni Saptasari ◽  
Dwi Listyorini ◽  
...  
Keyword(s):  
Flower Development ◽  
Start Codon ◽  
Regulator Gene ◽  
Mads Box ◽  
Orchid Species ◽  
Mads Box Gene ◽  
Reverse Primer ◽  
Development Regulation ◽  
Large Flower ◽  
Forward Primer

<p class="Els-Abstract-text"><em>Phalaenopsis amabilis </em>(L.) Blume<em> </em>is an indigenous orchid species in Indonesia. This orchid has a white large flower. The large flower is caused by the existence of gene that has an important role in flower development. One of the genes is <em>SEPALLATA 1. </em>This gene is a member of superfamily MADS-Box gene. <em>SEPALLATA 1 </em>gene is a marker of primordial flower organ. This study aimed to isolate <em>SEPALLATA1</em><em> </em>gene from <em>Phalaenopsis amabilis </em>(L.) Blume by PCR using forward primer 5’-GCT-GGA-GCG-GAT-CGA-GAA-CA-3’and reverse primer 5’-TCA-TGC-AAG-CCA-ACC-AGG-TG-3’<em>. </em>This study successfully amplified 691 bp lengths of <em>SEPPALATA1</em> fragment, lacking 20 bp upstream which consist its start codon.</p><p> </p><div><p class="Els-keywords"><strong>Keywords:</strong> Flower development regulation, <em>Phalaenopsis amabilis</em> (L.) Blume, SEPALLATA 1 gene.</p></div>

Sign in / Sign up

Export Citation Format

Share Document