scholarly journals Monascus sanguineus May Be a Natural Nothospecies

2020 ◽  
Vol 11 ◽  
Author(s):  
Yatao He ◽  
Junlin Liu ◽  
Qian Chen ◽  
Senning Gan ◽  
Ting Sun ◽  
...  

The genus Monascus has important economic and ecological values. In 2016, we isolated a strain M. sanguineus. After studying the phylogenetic relationship of Monascus, we believe that M. sanguineus is an independent species and speculate that it is a natural nothospecies. Recently, the morphological characteristics and sequences of seven genes (ITS, LSU, β-tubulin, calmodulin, RNA polymerase II subunit, β-ketoacyl synthase, and mating-type locus 1-1) of 15 Monascus strains were analyzed, including sequencing of multiple clones of five protein genes in four M. sanguineus strains. Two types of haplotypes (A and B) were observed in the five protein genes of M. sanguineus. Haplotype A was closely related to M. ruber, and haplotype B may be derived from an unknown Monascus species. The results demonstrated that M. sanguineus including type strains may be a natural nothospecies. This study laid the foundation for further exploration of the M. sanguineus genome, and the study may be of significant importance for the Monascus fermentation industry.

Phytotaxa ◽  
2015 ◽  
Vol 197 (4) ◽  
pp. 267-281 ◽  
Author(s):  
Qian Chen ◽  
KE ZHANG ◽  
GUOZHEN ZHANG ◽  
LEI CAI

Phoma odoratissimi sp. nov. on Viburnum odoratissimum and Syringa oblate, and Phoma segeticola sp. nov. on Cirsium segetum from China are introduced and described, employing a polyphasic approach characterising morphological characteristics, host association and phylogeny. Both species are the first records of Phoma species on their respective hosts. Multi-locus phylogenetic tree was inferred using combined sequences of the internal transcribed spacer regions 1 & 2 and 5.8S nrDNA (ITS), and partial large subunit 28S nrDNA region (LSU), β-tubulin (TUB) region and RNA polymerase II (RPB2) region. The two new species clustered in two separate and distinct lineages, and are distinct from their allied species.


Author(s):  
D.L. Spector ◽  
S. Huang ◽  
S. Kaurin

We have been interested in the organization of RNA polymerase II transcription and pre-mRNA splicing within the cell nucleus. Several models have been proposed for the functional organization of RNA within the eukaryotic nucleus and for the relationship of this organization to the distribution of pre-mRNA splicing factors. One model suggests that RNAs which must be spliced are capable of recruiting splicing factors to the sites of transcription from storage and/or reassembly sites. When one examines the organization of splicing factors in the nucleus in comparison to the sites of chromatin it is clear that splicing factors are not localized in coincidence with heterochromatin (Fig. 1). Instead, they are distributed in a speckled pattern which is composed of both perichromatin fibrils and interchromatin granule clusters. The perichromatin fibrils are distributed on the periphery of heterochromatin and on the periphery of interchromatin granule clusters as well as being diffusely distributed throughout the nucleoplasm. These nuclear regions have been previously shown to represent initial sites of incorporation of 3H-uridine.


2015 ◽  
Vol 67 (6) ◽  
pp. 1510-1518
Author(s):  
S.A. Headley ◽  
T.R. Santos ◽  
L. Bodnar ◽  
J.P.E. Saut ◽  
A.P. Silva ◽  
...  

This study investigated the occurrence of canine distemper virus (CDV) by evaluating the presence of viral RNA within urine samples of dogs from Uberlândia, MG, with clinical manifestations suggestive of infection by CDV by targeting the CDV N gene. Of the clinical samples collected ( n =33), CDV viruria was detected in 45.5%. Five dogs died spontaneously; all had characteristic CDV-associated histopathological alterations and demonstrated CDV viruria. Statistical analyses revealed that the age, gender, breed, or the organ system of the dog affected had no influence on the occurrence of canine distemper. Myoclonus and motor incoordination were the most significant neurological manifestations observed. A direct association was observed between keratoconjunctivitis and dogs with CDV viruria. These findings suggest that CDV viruria in symptomatic dogs might not be age related, and that symptomatic dogs can demonstrate clinical manifestations attributed to CDV without viruria identified by RT-PCR. Additionally, the results of the sequence identities analysed have suggested that all Brazilian wild-type strains of CDV currently identified are closely related and probably originated from the same lineage of CDV. Nevertheless, phylogenetic analyses suggest that there are different clusters of wild-type strains of CDV circulating within urban canine populations in Brazil.


2016 ◽  
Vol 14 (1) ◽  
pp. 29-37 ◽  
Author(s):  
Dương Thúy Yên ◽  
Nguyễn Kiệt ◽  
Bùi Sơn Nên ◽  
Nguyễn Văn Thường ◽  
Nguyễn Bạch Loan ◽  
...  

Three Pangasius species including P. krempfi, P. elongatus and P. mekongensis, are economically important. They can be mis-identified due to similar external appreance at small sizes. This study aimed to distinguish these species based on their differences in DNA barcode, COI (cytochrome c oxidase subunit I) gene, and morphological characteristics. Fish with various sizes (>90 samples/species) were sampled at the lower Mekong delta region. Kimura-2 parameter genetic distances based on COI sequences of three species (15 samples, in which, 4 unique sequences were assigned Genbank accession numbers from KT289877 to KT289880) are relatively high, ranging 9.33 – 12.10 %. Morphological measurements show that coutanble traits including numbers of fin rays and the first gill rakers vary in similar ranges but ratios of metric traits are significantly different among three species (P<0.01). Principle component analysis using metric traits sets three species apart. P. elongatus is characterized by elongated body, long caudal preduncle, large eyes, and retangle palatine tooth plates. P. krempfi differs from P. mekongesis in characteristics on their head. The number of sections, shape and length of barbel are different among three species. Phylogenetic relationship of three species based on morphology and COI sequences indicate that P. krempfi is closer to P. mekongenis rather than P. elongatus, and that the distance between P. mekongenis and P. elongatus is the largest.


Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168
Author(s):  
R. S. Trivedi ◽  
J. G. Hampton ◽  
J. M. Townshend ◽  
M. V. Jaspers ◽  
H. J. Ridgway

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.


Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 843-843 ◽  
Author(s):  
N.-H. Lu ◽  
Q.-Z. Huang ◽  
H. He ◽  
K.-W. Li ◽  
Y.-B. Zhang

Avicennia marina is a pioneer species of mangroves, a woody plant community that periodically emerges in the intertidal zone of estuarine regions in tropical and subtropical regions. In February 2013, a new disease that caused the stems of A. marina to blacken and die was found in Techeng Island of Zhanjiang, Guangdong Province, China. Initial symptoms of the disease were water-soaked brown spots on the biennial stems that coalesced so whole stems browned, twigs and branches withered, leaves defoliated, and finally trees died. This disease has the potential to threaten the ecology of the local A. marina community. From February to May 2013, 11 symptomatic trees were collected in three locations on the island and the pathogen was isolated as followed: tissues were surface disinfected with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 45 s, rinsed with sterilized water three times, dried, placed on potato dextrose agar (PDA), and incubated for 3 to 5 days at 28°C without light. Five isolates (KW1 to KW5) with different morphological characteristics were obtained, and pathogenic tests were done according Koch's postulates. Fresh wounds were made with a sterile needle on healthy biennial stems of A. marina, and mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. All treated plants were incubated at room temperature. Similar symptoms of black stem were observed only on the stems inoculated the isolate KW5 after 35 days, while the control and all stems inoculated with the other isolates remained symptomless. An isolate similar to KW5 was re-isolated from the affected materials. The pathogenic test was repeated three times with the same conditions and it was confirmed that KW5 was the pathogen causing the black stem of A. marina. Hyphal tips of KW5 were transferred to PDA medium in petri dishes for morphological observation. After 48 to 72 h, white, orange, or brown flocculence patches of KW5 mycelium, 5.0 to 6.0 cm in diameter, grew. Tapering and spindle falciform macroconidia (11 to 17.3 μm long × 1.5 to 2.5 μm wide) with an obviously swelled central cell and narrow strips of apical cells and distinctive foot cells were visible under the optical microscope. The conidiogenous cells were intertwined with mycelia and the chlamydospores were globose and formed in clusters. These morphological characteristics of the isolate KW5 are characteristic of Fusarium equiseti (1). For molecular identification, the ITS of ribosomal DNA, β-tubulin, and EF-1α genes were amplified using the ITS4/ITS5 (5), T1/T2 (2), and EF1/EF2 (3) primer pairs. These sequences were deposited in GenBank (KF515650 for the ITS region; KF747330 for β-tubulin region, and KF747331 for EF-1α region) and showed 98 to 99% identity to F. equiseti strains (HQ332532 for ITS region, JX241676 for β-tubulin gene, and GQ505666 for EF-1α region). According to both morphological and sequences analysis, the pathogen of the black stem of A. marina was identified as F. equiseti. Similar symptoms on absorbing rootlets and trunks of A. marina had been reported in central coastal Queensland, but the pathogen was identified as Phytophthora sp. (4). Therefore, the disease reported in this paper differs from that reported in central coastal Queensland. To our knowledge, this is the first report of black stems of A. marina caused by F. equiseti in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, 1st ed. Wiley-Blackwell, Hoboken, NJ, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) K. G. Pegg. Aust et al. Plant Pathol. 3:6, 1980. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.


EDUSAINS ◽  
2020 ◽  
Vol 12 (1) ◽  
pp. 20-29
Author(s):  
M Ubaidilah Hasan ◽  
Ira Nurmawati

THE RELATIONSHIP OF STUDENTS' UNDERSTANDING LEVEL OF ANIMAL MORPHOLOGY CHARACTERISTICS WITH THE ABILITY TO MEMORIZE ANIMAL LATIN NAMES IN GRADE 10 IPAAbstractAnimal taxonomy subjects often use animal's Latin names. Many students think that this subject is annoying because it is dominated by memorizing animal's Latin names, even though memorizing becomes a prerequisite for understanding. Meanwhile, most of the language materials memorized need an understanding before the memorizing process. This study aimed to find a relationship between the level of students' understanding of an animal's morphological characteristics and the ability to memorize animal's Latin names at the Xth grade of IPA students in SMAN 3 Jember. This study used a quantitative approach with a type of ex post facto. The test obtained the data. Then it was descriptively and inferentially analyzed by Kendall correlation. This research indicated that 56 students who answered test of the level of understanding animal's morphological characteristics and the ability to memorize animal's Latin names resulted in a correlation coefficient of score 0.673, and significance 0,000 < 0.05. Therefore, if the level of students’ understanding of an animal's morphological characteristics increased, the ability to memorize animal's Latin names at the Xth grade of IPA students in SMAN 3 Jember also increased, conversely. AbstrakNama latin hewan sering digunakan dalam materi taksonomi hewan. Banyak siswa beranggapan bahwa materi tersebut membosankan karena didominasi oleh menghafal nama latin hewan, padahal menghafal menjadi prasyarat pemahaman. Sementara itu, sebagian besar materi bahasa yang dihafal membutuhkan pemahaman sebelum proses menghafal berlangsung. Tujuan penelitian ini ialah mengetahui hubungan tingkat pemahaman karakteristik morfologi hewan dengan kemampuan menghafal nama latin hewan pada siswa kelas X IPA SMA Negeri 3 Jember. Penelitian ini menggunakan pendekatan kuantitatif dengan jenis eks post facto. Data didapatkan menggunakan instrumen tes. Kemudian dianalisis secara deskriptif dan inferensial menggunakan korelasi Kendall. Penelitian ini menunjukkan bahwa dari 56 siswa yang menjawab tes tingkat pemahaman karakteristik morfologi hewan dan kemampuan menghafal nama latin hewan menghasilkan koefisien korelasi 0,673 dan signifikansi 0,000 < 0,05. Dengan demikian, jika tingkat pemahaman karakteristik morfologi hewan meningkat, kemampuan menghafal nama latin hewan pada siswa kelas X IPA SMA Negeri 3 Jember juga meningkat, begitupula sebaliknya. 


Plant Disease ◽  
2021 ◽  
Author(s):  
Xi Xu ◽  
Li Zhang ◽  
Xilang Yang ◽  
Hanshui Cao ◽  
Jingjing Li ◽  
...  

Maize is a major economic crop worldwide. Maize can be infected by Alternaria species causing leaf blight that can result in significant economic losses. In this study, 168 Alternaria isolates recovered from symptomatic maize leaves were identified based on morphological characteristics, pathogenicity, and multi-locus sequence analyses of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), the internal transcribed spacer of ribosomal DNA (rDNA ITS), the RNA polymerase II second largest subunit (RPB2), and histone 3 (HIS3). Maize isolates grouped to four Alternaria species including Alternaria tenuissima, A. alternata, A. burnsii, and Alternaria sp. Notably, A. tenuissima (71.4%) was the most prevalent of the four isolated species, followed by A. alternata (21.5%), Alternaria sp. (4.1%), and A. burnsii (3.0%). Pathogenicity tests showed that all four Alternaria species could produce elliptic to nearly round, or strip lesions on leaves of maize, gray white to dry white in the lesions center and reddish brown in the edge. The average disease incidence (58.47%) and average disease index (63.55) of maize leaves inoculated with A. alternata were significantly higher than levels resulting from A. tenuissima (55.28% and 58.49), Alternaria sp. (55.34% and 58.75), and A. burnsii (56% and 55). Haplotype analyses indicated that there were 14 haplotypes of A. tenuissima and 5 haplotypes of A. alternata in Heilongjiang province and suggested the occurrence of a population expansion. Results of the study showed that Alternaria species associated with maize leaf blight in Heilongjiang province are more diverse than those have been previously reported. This is the first report globally of A. tenuissima, A. burnsii, and an unclassified Alternaria species as causal agents of leaf blight on maize.


Phytotaxa ◽  
2021 ◽  
Vol 513 (2) ◽  
pp. 129-140
Author(s):  
YUAN S. LIU ◽  
JIAN-KUI LIU ◽  
PETER E. MORTIMER ◽  
SAISAMORN LUMYONG

Amanita submelleialba sp. nov. in section Amanita, is described from northern Thailand based on both multi-gene phylogenetic analysis and morphological evidences. It is characterized by having small to medium-sized basidiomata; a yellow to yellowish pale pileus covering pyramidal to subconical, white to yellow white volval remnants; globose stipe base covered conical, white to yellow white volval remnants; fugacious subapical annulus; and absent clamps. Multi-gene phylogenetic analyses based on partial nuclear rDNA internal transcribed spacer region (ITS), partial nuclear rDNA larger subunit region (nrLSU), RNA polymerase II second largest subunit (RPB2), partial translation elongation factor 1-alpha (TEF1-α) and beta-tubulin gene (TUB) indicated that A. submelleialba clustered together with A. elata and A. mira, but represented as a distinct lineage from other extant species in section Amanita. The detailed morphological characteristics, line-drawing illustration and comparisons with morphologically similar taxa are provided.


Nematology ◽  
2002 ◽  
Vol 4 (7) ◽  
pp. 875-882 ◽  
Author(s):  
Dieter Sturhan

AbstractBased mainly on an analysis of the host ranges of the species presently placed in Cactodera, sensu lato, and of selected morphological characteristics, an attempt is made to improve the definition of the genus which, after exclusion of C. betulae and C. johanseni, is considered to be monophyletic. The host range of Cactodera, sensu stricto, appears to be restricted to the subclass Caryophyllidae with the ten known species showing an adaptive radiation on host genera in five families of the orders Caryophyllales and Polygonales. This may be a result of co-evolution. Cactodera betulae cannot be assigned to any of the presently recognised genera of cyst-forming nematodes and therefore Betulodera gen. nov. is proposed with B. betulae comb. nov. as the type and only species. The relationship of Betulodera gen. nov. to other genera of Heteroderidae and to some undescribed heteroderid species has still to be evaluated. The new genus is characterised by circumfenestrate cysts with only a slightly protruding vulval cone, three incisures in the lateral field of the second-stage juveniles and presence of phasmids in the males. The hosts are in unrelated plant orders and subclasses. Cactodera aquatica, a species inquirenda, is returned to the genus Heterodera and Heterodera johanseni (Sharma et al. , 2001) comb. nov. is proposed for C. johanseni.


Sign in / Sign up

Export Citation Format

Share Document