Evidence of Microdochium Fungi Associated with Cereal Grains in Russia

In total, 46 Microdochium strains from five different geographic regions of Russia were explored with respect to genetic diversity, morphology, and secondary metabolites. Based on the results of PCR, 59% and 28% of the strains were identified as M. nivale and M. majus, respectively. As a result of sequencing four genome regions, namely ITS, LSU, BTUB, and RPB2 (2778 bp), five genetically and phenotypically similar strains from Western Siberia were identified as M. seminicola, which, according to our findings, is the prevalent Microdochium species in this territory. This is the first record of M. seminicola in Russia. Attempts were made to distinguish between Microdochium species and to identify species-specific morphological characteristics in the anamorph and teleomorph stages and physiological properties. We examined the occurrence frequency of conidia with different numbers of septa in the strains of Microdochium. The predominance of three-septate macroconidia in M. majus was higher than that in M. nivale and typically exceeded 60% occurrence. Most M. majus and M. nivale strains formed walled protoperithecia on wheat stems. Only three strains of M. majus and one strain each of M. nivale and M. seminicola produced mature perithecia. The growth rate of M. seminicola strains was significantly lower on agar media at 5–25 °C than those of M. majus and M. nivale strains. Multimycotoxin analysis by HPLC-MS/MS revealed that the strains of three Microdochium species did not produce any toxic metabolites.

Download Full-text

First record of the semi-slug Omalonyx unguis (d’Orbigny, 1837) (Gastropoda, Succineidae) in the Misiones Province, Argentina

Check List ◽

10.15560/14.5.705 ◽

2018 ◽

Vol 14 (4) ◽

pp. 705-712

Author(s):

Leila B. Guzmán ◽

Enzo N. Serniotti ◽

Roberto E. Vogler ◽

Ariel A. Beltramino ◽

Alejandra Rumi ◽

...

Keyword(s):

Dna Sequences ◽

Morphological Characteristics ◽

First Record ◽

Coi Gene ◽

Cytochrome Oxidase Subunit ◽

Specific Identification ◽

Molluscan Fauna ◽

Misiones Province ◽

Species Specific ◽

Northeastern Argentina

Omalonyx unguis (d’Orbigny, 1837) is a semi-slug inhabiting the Paraná river basin. This species belongs to Succineidae, a family comprising a few representatives in South America. In this work, we provide the first record for the species from Misiones Province, Argentina. Previous records available for Omalonyx in Misiones were identified to the genus level. We examined morphological characteristics of the reproductive system and used DNA sequences from cytochrome oxidase subunit I (COI) gene for species-specific identification. These new distributional data contribute to consolidate the knowledge of the molluscan fauna in northeastern Argentina.

Download Full-text

The First Record of Parthenitae and Cercariae of Plagiorchis Multiglandularis (Trematoda, Plagiorchiidae) in Lymnaea Stagnalis in Ukraine

Vestnik Zoologii ◽

10.2478/vzoo-2018-0030 ◽

2018 ◽

Vol 52 (4) ◽

pp. 289-294

Author(s):

E. P. Zhytova

Keyword(s):

Lymnaea Stagnalis ◽

Morphological Characteristics ◽

First Record ◽

Morphometric Data ◽

Diagnostic Characters ◽

Plagiorchis Elegans

Abstract Parthenitae and cercariae of Plagiorchis. multiglandularis Semenov, 1927 are recorded in Lymnaea stagnalis (Linnaeus, 1758) for the fi rst time in Ukraine; their morphological characteristics are specifi ed. Diagnostic characters of P. multiglandularis parthenitae and cercariae found in Ukrainian Polissia are compared with those from other regions. To confi rm the validity of the species, a comparison of the morphometric data of this trematode larvae with the cercariae of Plagiorchis elegans (Rudolphi, 1802) Braun, 1902, found in molluscs L. stagnalis, L. ralustris and L. corvuses, was performed. It was determined that P. multiglandularis cercariae diff er from those of P. elegans in size and position of the penetration glands.

Download Full-text

EVALUATION OF THE COMMON HOP VARIETY SAMPLES ACCORDING TO THE PHENOLOGICAL AND MORPHOLOGICAL FEATURES

Vestnik of the Russian agricultural science ◽

10.30850/vrsn/2018/2/40-42 ◽

2018 ◽

pp. 40-42 ◽

Cited By ~ 1

Author(s):

А. А. Fadeev ◽

Z. А. Nikonova

Keyword(s):

Morphological Characteristics ◽

Economic Importance ◽

Morphological Features ◽

High Yield ◽

Early Maturity ◽

Foreign Countries ◽

Humulus Lupulus L ◽

The Common ◽

Regions Of Russia ◽

Vegetative Season

The results of study of the 12 year cycle of studies on the only in Russia collection of hops ordinary (Humulus lupulus L.), which contains 250 samples from different regions of Russia and 17 foreign countries. The number of process varieties, composition and origin, it is unique and corresponds to world level. A collection of accessions of hops is a population of female plants with a set of phenological, morphological and economic importance of signs. In the article, the estimation of the collectible varieties of hops at different ripeness groups according to phenological and morphological characteristics according to the method of test for distinctness, uniformity and stability. As the result of the research the Common Hop (Humuluslupulus) sorts were classified in accordance with their maturity time as early maturity (less than 100 days) – 10%, middle-early (101…110 days) – 14, middle duration (111…120 days) – 40, middle-late (121…130 days) – 10% and slow-maturing (more than 130 days) – 26%. Each group has a phenotypic and morphologies features. The early maturity, middle-early and middle duration varieties with vegetative season approximately 120 days are more adaptive to the conditions of the Chuvashia and central part of the Russia and provide obtaining high yield of the hop cones.

Download Full-text

Characterization of the Bull's Eye Rot of Apple in Chile

Plant Disease ◽

10.1094/pdis-06-12-0606-re ◽

2013 ◽

Vol 97 (4) ◽

pp. 485-490 ◽

Cited By ~ 22

Author(s):

Sylvana Soto-Alvear ◽

Mauricio Lolas ◽

Inés M. Rosales ◽

Eduardo R. Chávez ◽

Bernardo A. Latorre

Keyword(s):

Morphological Characteristics ◽

The United States ◽

Apple Fruit ◽

Maritime Transportation ◽

Tubulin Genes ◽

Internal Transcribed Spacer Sequences ◽

Apple Production ◽

Species Specific ◽

Bull's Eye

Apple fruit in Chile are primarily produced for export to Asia, Europe, and the United States, which typically requires 15 to 40 days of maritime transportation. Therefore, Chilean apple production must fulfill the sanitization requirements imposed by the receiving countries. Under these circumstances, it was important to clarify the etiology of bull's eye rot that can severely affect ‘Cripps Pink’ apple and other late-harvest cultivars in Chile. Based on morphological characteristics and the partial sequence analysis of the internal transcribed spacer sequences and β-tubulin genes, Neofabraea alba was identified as the causal agent of the bull's eye rot of Chilean apple. These results were further corroborated using species-specific primers. The incidence of bull's eye rot varied considerably; for instance, in 2009, 0.0 to 58.7% in 38 Cripps Pink orchards surveyed in the relatively arid and humid apple-growing areas of Chile, respectively. There was no evidence for the presence of N. malicorticis or N. perennans, which are commonly identified as causal agents of bull's eye rot in other apple-producing countries. Altogether, these data suggest that N. alba might represent the predominant and possibly the only cause of bull's-eye rot of Chilean apple.

Download Full-text

Specialists, Spies, “Special Settlers”, and Prisoners of War: Social Frictions in the Kuzbass (USSR), 1920–1950

International Review of Social History ◽

10.1017/s0020859015000462 ◽

2015 ◽

Vol 60 (S1) ◽

pp. 185-205

Author(s):

Julia Landau

Keyword(s):

Western Siberia ◽

Kuznetsk Basin ◽

Prisoners Of War ◽

Local State ◽

Significant Part ◽

Secret Police ◽

Large Numbers ◽

Place Of Origin ◽

Labour Turnover ◽

Regions Of Russia

AbstractThe Kuzbass coalmining region in western Siberia (Kuznetsk Basin) was explored, populated, and exploited under Stalin’s rule. Struggling to offset a high labour turnover, the local state-run coal company enrolled deportees from other regions of Russia and Siberia, who were controlled by the secret police (OGPU). These workers shared a common experience in having been forcibly separated from their place of origin. At the same time, foreigners were recruited from abroad as experts and offered a privileged position. In the years of the Great Terror (1936−1938) both groups were persecuted, as they were regarded by the state as disloyal and suspicious. After the war, foreigners were recruited in large numbers as prisoners of war. Thus, migrants, foreigners, and deportees from other regions and countries constituted a significant part of the workforce in the Kuzbass, while their status constantly shifted due to economic needs and repressive politics.

Download Full-text

Andrena Florivaga Eversmann , 1852 (Hymenoptera: Apoidea: Andrenidae) - A New Bee Species of the Genus Andrena in Poland

Journal of Apicultural Science ◽

10.2478/jas-2013-0005 ◽

2013 ◽

Vol 57 (1) ◽

pp. 45-50

Author(s):

Józef Banaszak ◽

Ewelina Motyka ◽

Katarzyna Szczepko

Keyword(s):

National Park ◽

Morphological Characteristics ◽

First Record ◽

General Distribution ◽

Baikal Lake ◽

The West ◽

Central Siberia ◽

Lake Region ◽

Time Period ◽

Pan Traps

Summary The first record of Andrena florivaga Eversmann, 1852 is reported from Poland on the basis of specimens collected in the Kampinos National Park (Mazovian Lowland). Diagnosis, data on localities, biology, and general distribution of the species are provided. One female and five males were caught on a mowed fresh meadow and fallow fields with the use of water pan-traps (Moericke traps), during the 2003 - 2004 time period. The main morphological characteristics distinguishing Andrena florivaga from the very similar Andrena dorsalis Brullé, 1832 species and from the other species of the subgenus Lepidandrena are: in the case of females - the width of facial foveae and colouration of legs, and in the case of males - the length of the first flagellar segment, colouration of clypeus, and pubescence of gonostyles. Andrena florivaga can be found from France in the west, to Central Siberia (Baikal lake region) in the east, and Turkey in the south. Poland is the northernmost locality of the species.

Download Full-text

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽

10.1094/pdis-94-9-1168c ◽

2010 ◽

Vol 94 (9) ◽

pp. 1168-1168

Author(s):

R. S. Trivedi ◽

J. G. Hampton ◽

J. M. Townshend ◽

M. V. Jaspers ◽

H. J. Ridgway

Keyword(s):

New Zealand ◽

Morphological Characteristics ◽

New Taxon ◽

First Report ◽

Agar Plug ◽

Carrot Seed ◽

Agar Media ◽

Leaves And Roots ◽

Seed Crops ◽

Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Download Full-text

First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽

10.1094/pdis-02-14-0119-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1019-1019 ◽

Cited By ~ 2

Author(s):

Y. F. Wang ◽

S. Xiao ◽

Y. K. Huang ◽

X. Zhou ◽

S. S. Zhang ◽

...

Keyword(s):

Morphological Characteristics ◽

Severe Infection ◽

Original Description ◽

First Record ◽

Vegetable Crops ◽

Species Identity ◽

Fujian Province ◽

First Report ◽

Lateral Lines ◽

Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

First record of intersexuality in Porcellana platycheles (Pennant, 1777) (Decapoda: Anomura: Porcellanidae)

Latin American Journal of Aquatic Research ◽

10.3856/vol41-issue3-fulltext-24 ◽

2017 ◽

Vol 41 (3) ◽

pp. 606-610

Author(s):

Luciane Ferreira ◽

Guillermo Guzmán

Keyword(s):

Morphological Characteristics ◽

First Record ◽

Genetic Variations ◽

The Third ◽

The Family

This paper reports the first record of intersexuality from Porcellana platycheles, a member of the family Porcellanidae. Intersex individuals were identified by the presence of both pairs of genital openings on the coxae of the third and fifth pereiopods respectively, and by morphological characteristics of the abdomen and pleopods. The low occurrence of this condition suggests that intersexuality is due to genetic variations in the population rather than other possible causes of intersexuality previously reported in other decapods.

Download Full-text

First Report of Myrothecium roridum Causing Leaf Spot on Zantedeschia aethiopica in China

Plant Disease ◽

10.1094/pdis-11-13-1140-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 854-854 ◽

Cited By ~ 1

Author(s):

B.-J. Li ◽

H.-Y. Ben ◽

Y.-X. Shi ◽

X.-W. Xie ◽

A.-L. Chai

Keyword(s):

Leaf Spot ◽

Morphological Characteristics ◽

Its Region ◽

First Record ◽

Conidial Suspension ◽

Isolation And Identification ◽

Zantedeschia Aethiopica ◽

Calla Lily ◽

Initial Symptoms ◽

Myrothecium Roridum

Zantedeschia aethiopica (L.) Spreng. (calla lily), belonging to family Araceae, is a popular ornamental plant in China. In the summer of 2010, leaves of calla lily with typical symptoms of necrotic lesions were observed in a commercial glasshouse in Beijing, China (116°20′ E, 39°44′ N). The initial symptoms were circular to subcircular, 1 to 3 mm, and dark brown lesions on the leaf lamina. Under high humidity, lesions expanded rapidly to 5 to 10 mm with distinct concentric zones and produced black sporodochia, especially on the backs of leaves. Later, the infected leaves were developing a combination of leaf lesions, yellowing, and falling off; as a result, the aesthetic value of the plant was significantly impacted. Leaf samples were used in pathogen isolation. Symptomatic leaf tissues were cut into small pieces and surface sterilized with 70% ethanol for 30 s and then in 0.1% mercuric chloride solution for 1 to 3 min. After being washed in sterile distilled water three times, the pieces were plated on potato dextrose agar (PDA) and incubated at 25°C in darkness for 7 days (5). Initial colonies of isolates were white, floccose mycelium and developed dark green to black concentric rings that were sporodochia bearing viscid spore masses after incubating 5 days. Conidiophores branched repeatedly. Conidiogenous cells were hyaline, clavate, and 10.0 to 16.0 × 1.4 to 2.0 μm. Conidia were hyaline, cylindrical, both rounded ends, and 6.0 to 8.2 × 1.9 to 2.4 μm. Morphological characteristics of the fungus were consistent with the description of Myrothecium roridum Tode ex Fr. (3,4). To confirm the pathogenicity, three healthy plants of calla lily were inoculated with a conidial suspension (1 × 106 conidia per ml) brushed from a 7-day-old culture of the fungus. Control plants were sprayed with sterile water. The inoculated plants were individual with clear plastic bags and placed in a glass cabinet at 25°C. After 7 days, all inoculated leaves developed symptoms similar to the original samples, but control plants remained disease free. Re-isolation and identification confirmed Koch's postulates. For molecular identification, genomic DNA of a representative isolate (MTL07081001) was extracted by modified CTAB method (1), and the rDNA-ITS region was amplified by using primers ITS1 (5-TCCGTAGGTGAACCTGCGG-3) and ITS4 (5-TCCTCCGCTTATTGATATGC-3). The 465-bp amplicon (GenBank Accession No. KF761293) was 100% identity to the sequence of M. roridum (JF724158.1) from GenBank. M. roridum has an extensive host range, covering 294 host plants (2). To our knowledge, this is the first record of leaf spot caused by M. roridum on calla lily in China. References: (1) F. M. Ausubel et al. Current Protocols in Molecular Biology. John Wiley & Sons Inc, New York, 1994. (2) D. F. Farr and A. Y. Rossman, Fungal Databases. Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , October 2013. (3) M. T. Mmbaga et al. Plant Dis. 94:1266, 2010. (4) Y. X. Zhang et al. Plant Dis. 95:1030, 2011. (5) L. Zhu et al. J. Phytopathol. 161:59, 2013.

Download Full-text