Variance Calculations for Quantitative Real-Time PCR Experiments with Multiple Levels of Replication

2013 ◽  
Vol 825 ◽  
pp. 172-176
Author(s):  
Susana Soto-Rojo ◽  
Gary Glonek ◽  
Cecilia Demergasso ◽  
Pedro A. Galleguillos ◽  
Patty Solomon ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Industrial Process ◽  
Error Variance ◽  
Low Grade ◽  
Sulphide Ores ◽  
Polymerase Chain ◽  
Frequent Sampling ◽  
The Relationship ◽  
Proportional Reduction

Heap bioleaching is an established technology for recovering copper from low-grade sulphide ores. Recently, genetics-based approaches have been employed to characterize mineral-processing bacteria. In these approaches, data analysis is a key issue. Consequently, it is of fundamental importance to provide adequate mathematical models and statistical tools to draw reliable conclusions. The present work relates to current studies of the consortium of organisms inhabiting the bioleaching heap of the Escondida mine in Northern Chile. These studies aim to describe and understand the relationship between the dynamics of the community and the performance of the industrial process. Here, we consider a series of quantitative real-time polymerase chain reaction (PCR) experiments performed to quantify six different microorganisms at various stages of the bioleaching cycle. Establishing the reliability of the data obtained by real-time PCR requires the estimation of the error variance at several different levels. The results obtained show that the sampling component of the error variance is the dominant source of variability for most microorganisms. An estimate for the proportional reduction in residual standard deviation from the use of extraction and real-time PCR triplicates was found to range from 3% to 27% for the different organisms. This result suggests that triplicate assays would produce only a modest reduction in error variance compared to more frequent sampling from the heap.

Diagnosis and Causative Species of Visceral Leishmaniasis in Southwest Saudi Arabia

2021 ◽  
Author(s):  
Aymen Abdelhaleem ◽  
Nabil Dhayhi ◽  
Mohamed Salih Mahfouz ◽  
Ommer Daffalla ◽  
Mansour Mubarki ◽  
...  
Keyword(s):  
Saudi Arabia ◽  
Visceral Leishmaniasis ◽  
Real Time ◽  
Real Time Pcr ◽  
Leishmania Donovani ◽  
Target Genes ◽  
Sample Volume ◽  
Pcr Products ◽  
Polymerase Chain ◽  
Robust Evidence

Visceral leishmaniasis (VL) is the most severe clinical form of the disease and has been reported in the Jazan region of southwest Saudi Arabia. This study aimed to diagnose VL by real-time polymerase chain reaction (PCR) and the direct agglutination test (DAT) and to identify the causative Leishmania species. A total of 80 participants, including 30 suspected VL patients, 30 healthy endemic control individuals, and 20 malaria disease controls, were enrolled in this study. Blood samples were collected and tested for Leishmania DNA by real-time PCR and for antibody by the DAT. Sequencing of some amplified PCR products was used to identify the causative Leishmania species. The diagnosis of VL was successfully achieved by both real-time PCR and by DAT with 100% sensitivity. Leishmania donovani and Leishmania infantum species were detected by sequencing both by the kDNA and ITS1 target genes, followed a BLASTn search. The detection of VL antibody by the DAT followed by the confirmatory detection of Leishmania DNA in patient blood by PCR could promote the adoption of the much less invasive and more sensitive methods for the routine diagnosis of VL. Further study with high sample volume to evaluate the PCR and the DAT are needed, to generate more robust evidence. Based on the sequencing results, emerging studies on VL should focus on the causative Leishmania species, reservoirs, and vectors that are important in the study area.

scholarly journals Building a molecular typing protocol for rs1801133 based on real-time PCR HRM technique

2019 ◽  
Vol 2 (3) ◽  
pp. 5-13
Author(s):  
Linh Thi Nhut Tran ◽  
My Thi Huynh Nguyen ◽  
Linh Nguy Hoang Le ◽  
Khoa Dang Le ◽  
Minh Hoang Nhat Nguyen ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Neurological Diseases ◽  
Human Diseases ◽  
Chromosome 1 ◽  
Nucleotide Sequencing ◽  
Sequencing Method ◽  
Mgcl2 Concentration ◽  
Clear Differentiation ◽  
The Relationship

rs1801133 is a single nucleotide polymorphism (SNP) located in the sequence of MTHFR on human chromosome 1. The alleles of this SNP affect the activity of the MTHFR enzyme. People bearing C/T genotype have 66% activity of MTHFR while people with T/T genotype have only 25% activity. These reduced activities of MTHFR cause homocysteinemia. There are several publications on the relationship between homocysteinemia and human diseases such as cardiovascular disease, neurological diseases, abnormal fetus, infertility and cancer. In this study, we built a molecular protocol for genotyping rs1801133 using real-time PCR HRM technique. This protocol could be used for diagnosis of molecular mechanism of homocysteinemia causing the mentoned above diseases as well as for the study of the relationship between rs1801133 and other human diseases. We successfully designed the primer pairs for genotyping and nucleotide sequencing rs1801133 by real-time PCR HRM and Sanger sequencing method. We also examined the optimal MgCl2 concentration for clear differentiation of three rs1801133 genotypes. Performance characteristics of the real-time PCR HRM protocol included of specificity, repeatability, reproducibility was evaluated and it showed good results. Comparison of genotyping results of rs1801133 between the realtime PCR HRM method and the Sanger nucleotide sequencing method showed good concordances. Finally, this real-time PCR HRM protocol for rs1801133 genotyping was applied on 100 human DNA samples to evaluate the clinical utility of the protocol.

scholarly journals DETEKSI CLOSTRIDIUM DIFFICILE TOKSIGENIK MENGGUNAKAN UJI CEPAT TOKSIN DAN REAL TIME POLYMERASE CHAIN REACTION (Toxigenic Clostridium Difficile Detection Using Toxin Rapid Test and Real Time Polymerase Chain Reaction)

2018 ◽  
Vol 22 (1) ◽  
pp. 22
Author(s):  
Ika Yasma Yanti ◽  
Dalima Ari Wahono Astrawinata
Keyword(s):  
Polymerase Chain Reaction ◽  
Clostridium Difficile ◽  
Antibiotic Therapy ◽  
Real Time ◽  
Real Time Pcr ◽  
Rapid Test ◽  
Chain Reaction ◽  
Chi Square ◽  
Polymerase Chain ◽  
Clostridium Difficile Associated Diarrhea

Toxigenic Clostridium difficile infection, causing a Pseudo Membrane Colitis (PMC) and Clostridium Difficile Associated Diarrhea(CDAD) has increased sharply. The largest risk factor is the use of antibiotics. The purpose of this study was to know how to determinethe prevalence and characteristics of subjects with Toxigenic Clostridium difficile and to assess the ability of the toxin rapid test comparedto real-time PCR. Ninety adult subjects with antibiotic therapy more than two (2) weeks were enrolled in this study. The results of toxinrapid test and real-time PCR were presented in a 2x2 table, statistical test used was Chi square. The prevalence of Toxigenic Clostridiumdifficile based on the toxin rapid test and by real-time PCR was 27.3% and 37.5%, respectively. There were significant differences betweenstool consistency and number of antibiotics used with the detection of Toxigenic Clostridium difficile. There was a relationship betweenthe duration of antibiotic therapy with the detection of Toxigenic Clostridium difficile using real-time PCR (p=0.010, RR=2.116). Thesensitivity, specificity, PPV, NPV, PLR and NLR rapid test against real-time PCR were 69.7%; 98.2%; 95.8%; 84.4%; 39.2 and 0.31,respectively. This study concluded that the prevalence of Clostridium difficile in RSCM was higher compared to that in Malaysia, Thailandand India; the subjects with antibiotic therapy for more than four (4) weeks had a double risk to have Toxigenic Clostridium difficilethan subjects with antibiotic therapy for less than that time (4 weeks). Thus, in this study, toxin rapid test could be used as a tool todetect Toxigenic Clostridium difficile.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Quantitative Real-Time Polymerase Chain Reaction Detection of BK Virus Using Labeled Primers

2010 ◽  
Vol 134 (3) ◽  
pp. 444-448 ◽  
Author(s):  
Zhengming Gu ◽  
Jianmin Pan ◽  
Matthew J. Bankowski ◽  
Randall T. Hayden
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Quantitative Polymerase Chain Reaction ◽  
Bk Virus ◽  
Clinical Samples ◽  
Quantitative Detection ◽  
Chain Reaction ◽  
Pcr Method ◽  
Polymerase Chain

Abstract Context.—BK virus infections among immunocompromised patients are associated with disease of the kidney or urinary bladder. High viral loads, determined by quantitative polymerase chain reaction (PCR), have been correlated with clinical disease. Objective.—To develop and evaluate a novel method for real-time PCR detection and quantification of BK virus using labeled primers. Design.—Patient specimens (n = 54) included 17 plasma, 12 whole blood, and 25 urine samples. DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science, Indianapolis, Indiana); sample eluate was PCR-amplified using the labeled primer PCR method. Results were compared with those of a user-developed quantitative real-time PCR method (fluorescence resonance energy transfer probe hybridization). Results.—Labeled primer PCR detected less than 10 copies per reaction and showed quantitative linearity from 101 to 107 copies per reaction. Analytical specificity of labeled primer PCR was 100%. With clinical samples, labeled primer PCR demonstrated a trend toward improved sensitivity compared with the reference method. Quantitative assay comparison showed an R2 value of 0.96 between the 2 assays. Conclusions.—Real-time PCR using labeled primers is highly sensitive and specific for the quantitative detection of BK virus from a variety of clinical specimens. These data demonstrate the applicability of labeled primer PCR for quantitative viral detection and offer a simplified method that removes the need for separate oligonucleotide probes.

Rapid, specific and quantitative polymerase chain reaction (PCR) detection of pathogenic protozoa Entamoeba histolytica for drinking water supply

2011 ◽  
Vol 11 (4) ◽  
pp. 418-425 ◽  
Author(s):  
S. W. Lam ◽  
H. B. Zhang ◽  
L. Yu ◽  
C. H. Woo ◽  
K. N. Tiew ◽  
...  
Keyword(s):  
Real Time ◽  
Water Samples ◽  
Real Time Pcr ◽  
Genomic Dna ◽  
Tap Water ◽  
Pcr Detection ◽  
Raw Water ◽  
Conventional Pcr ◽  
Polymerase Chain ◽  
Species Specific

In this study, a quantitative species-specific polymerase chain reaction (PCR) method to rapidly detect E. histolytica in water is developed. First, the specificity of E. histolytica PCR detection was verified by using species-specific primers of 16S-like rRNA genes to clearly differentiate it from the closely related amoebae species E. dispar and E. moshkovskii. The sensitivity of this method was subsequently determined using purified E. histolytica genomic DNA and culture cells as PCR reaction templates. Results indicated that conventional PCR visualized on 1% agarose gel was able to detect as low as 0.02 pg genomic DNA and 5 cells, while real-time PCR could detect 0.01 pg genomic DNA and 2 cells of E. histolytica. The protocols for E. histolytica PCR detection in real water samples were then optimized by spiking E. histolytica cells into tap water and reservoir raw water samples. A two-round centrifugation treatment to concentrate amoeba cells directly as a PCR template was the most effective way to detect E. histolytica in spiked tap water samples, while DNA extraction after concentrating amoeba cells was required for spiked reservoir raw water samples. The detection limit of 50 E. histolytica cells in 100 ml tap water was achieved in 2 h from sample collection to real-time PCR data readout. With these established protocols, 78 tap water samples, 11 reservoir raw water samples and 4 feed water samples from Singapore water supply systems were analyzed by both conventional PCR and real-time PCR methods. No E. histolytica cell was detected in tested samples.

scholarly journals In Planta Distribution of ‘Candidatus Liberibacter asiaticus’ as Revealed by Polymerase Chain Reaction (PCR) and Real-Time PCR

2008 ◽  
Vol 98 (5) ◽  
pp. 592-599 ◽  
Author(s):  
Satyanarayana Tatineni ◽  
Uma Shankar Sagaram ◽  
Siddarame Gowda ◽  
Cecile J. Robertson ◽  
William O. Dawson ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Citrus Tree ◽  
Candidatus Liberibacter Asiaticus ◽  
In Planta ◽  
Chain Reaction ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Polymerase Chain

Huanglongbing (HLB) is one of the most devastating diseases of citrus worldwide, and is caused by a phloem-limited fastidious prokaryotic α-proteobacterium that is yet to be cultured. In this study, a combination of traditional polymerase chain reaction (PCR) and real-time PCR targeting the putative DNA polymerase and 16S rDNA sequence of ‘Candidatus Liberibacter asiaticus,’ respectively, were used to examine the distribution and movement of the HLB pathogen in the infected citrus tree. We found that ‘Ca. Liberibacter asiaticus’ was distributed in bark tissue, leaf midrib, roots, and different floral and fruit parts, but not in endosperm and embryo, of infected citrus trees. Quantification analysis of the HLB bacterium indicated that it was distributed unevenly in planta and ranged from 14 to 137,031 cells/μg of total DNA in different tissues. A relatively high concentration of ‘Ca. Liberibacter asiaticus’ was observed in fruit peduncles. Our data from greenhouse-infected plants also indicated that ‘Ca. Liberibacter asiaticus’ was transmitted systemically from infection site to different parts of the plant. Understanding the distribution and movement of the HLB bacterium inside an individual citrus tree is critical for discerning its virulence mechanism and to develop management strategies for HLB.

Sign in / Sign up

Export Citation Format

Share Document