scholarly journals Pathogens of potato (Solanum tuberosum L.) tuber (Phytophtora infestans) occurring in treatments with foliar fertilization

2012 ◽  
Vol 65 (3) ◽  
pp. 75-84
Author(s):  
Bożena Cwalina-Ambroziak ◽  
Bożena Bogucka
Keyword(s):  
Solanum Tuberosum L ◽  
Pathogenic Fungi ◽  
Soft Rot ◽  
Potato Cultivars ◽  
Potato Tubers ◽  
Mineral Fertilization ◽  
Dry Rot ◽  
Foliar Fertilization ◽  
Ne Poland ◽  
Tuber Diseases

The paper presents the results of a three-year exact plot experiment (2008-2010) established in Bałcyny (NE Poland). Three potato cultivars were grown: medium-early &lsquo;Adam&rsquo;, medium-late &lsquo;Pasja Pomorska&rsquo;, and late &lsquo;Ślęza&rsquo;. The experimental factors were foliar fertilizers applied alone or in combination (Basfoliar 12-4-6, ADOB Mn, Solubor DF) and two levels of soil mineral fertilization (N<sub>1</sub>P<sub>1</sub>K<sub>1</sub>-80 kg N × ha<sup>-1</sup>, 80 kg P × ha<sup>-1</sup>, 120 K × ha<sup>-1</sup>; N<sub>2</sub>P<sub>2</sub>K<sub>2</sub>-120 kg N × ha<sup>-1</sup>, 144 kg P × ha<sup>-1</sup>, 156 K × ha<sup>-1</sup>). The experimental materials comprised potato tubers. The symptoms of soft rot (<em>Pectobacterium carotovorum </em>subsp. <em>carotovorum</em>), late blight (<em>Phytophthora infestans</em>) and dry rot (<em>Fusarium </em>spp.) were evaluated in 5 kg potato samples, and were expressed as the percentage mass of infected tubers. The rates of common scab (<em>Streptomyces scabies</em>) and black scurf (<em>Rhizoctonia solani</em>) infection were estimated on 100 tubers collected randomly after harvest, according to a nine-point scale, and were presented as a percentage infection index. In the laboratory, fungi were isolated on PDA medium from potato tubers immediately after harvest and after five-month storage. The incidence of tuber diseases depended on potato cultivars affected. The severity of tuber diseases varied between treatments with two levels of NPK fertilization and foliar fertilization. The lowest number of <em>Fusarium-</em>infected tubers was obtained from treatments where three foliar fertilizers were applied in combination, which was confirmed by the lowest abundance of fungal isolates. More fungi were isolated from potato tubers after harvest than after storage, but pathogens were more frequently isolated from stored tubers. After harvest, the lowest number of pathogenic fungi was isolated from the tubers of cv. &lsquo;Adam&rsquo; in the non-fertilized treatment, and after storage – from the tubers of the late cultivars in the treatment with three foliar fertilizers applied in combination.

scholarly journals The effect of mineral fertilization on fungi colonizing potato (Solanum tuberosum L.) tubers after harvest and after storage

2012 ◽  
Vol 62 (2) ◽  
pp. 137-147
Author(s):  
Bożena Cwalina-Ambroziak ◽  
Bożena Bogucka
Keyword(s):  
Foliar Application ◽  
Solanum Tuberosum L ◽  
Potato Cultivar ◽  
Storage Period ◽  
Pathogenic Fungi ◽  
Control Treatment ◽  
Potato Tubers ◽  
Mineral Fertilization ◽  
Late Potato ◽  
Experimental Variant

The paper presents the results of a three-year exact experiment conducted in Bałcyny, in which a late potato cultivar, Jasia, was grown. The objective of the study was to determine the effect of different levels of mineral fertilization: A (N 80 kg × ha<sup>-1</sup> P 80 kg × ha<sup>-1</sup> K120 kg × ha<sup>-1</sup>) and B (N 120 kg × ha<sup>-1</sup> P 144 kg × ha<sup>-1</sup> K156 kg × ha<sup>-1</sup>), and foliar fertilization (Basfoliar 12-4-6, ADOB Mn and Solubor DF) on the quantitative and qualitative composition of fungal populations colonizing potato tubers. Fungi were isolated immediately after harvest and after a five-month storage period. After seven days of incubation, fungal colonies were transferred onto agar slants for microscopic identification. Over the entire experimental period, more pathogenic fungi were obtained from potato tubers analyzed after storage (62.9% of the total fungal population after storage) than from those analyzed immediately after harvest (39.1%), and the greatest number of fungi was reported in 2004. <i>Rhizoctonia solani</i> was isolated most frequently, followed by <i>Colletotrichum coccodes</i> and <i>Alternaria alternata</i>. Pathogens of the genus <i>Fusarium</i> and the species <i>Helminthosporium solani</i> were not numerous. In the treatment A with soil mineral fertilization with lower NPK rates, larger numbers of pathogenic fungi were noted in 2004 after harvest and after five-month storage, and in 2005 after harvest. At the remaining dates of analysis, pathogens were more frequently isolated from potato tubers in experimental variant B with higher NPK rates. Immediately after harvest, the highest number of pathogenic fungi was isolated in the treatment with foliar application of ADOB Mn and Basfoliar 12-4-6. After five-month storage, pathogens most often colonized potato tubers in experimental variant B with foliar application of Solubor DF, Solubor DF and ADOB Mn, and in experimental variant A with a combination of fertilizers. In the other fertilization variants, including in the control treatment, the population size of pathogenic agents remained at a similar level.

scholarly journals Parasitic nematodes in potatoes of different varieties and their interrelations with some arthropods

2021 ◽  
Vol 2 (3) ◽  
pp. 39-47
Author(s):  
Maria MELNIC ◽  
Olesea GLIGA ◽  
Dumitru ERHAN ◽  
Stefan RUSU ◽  
Elena IORDOSOPOL
Keyword(s):  
Solanum Tuberosum ◽  
Fungal Infections ◽  
Solanum Tuberosum L ◽  
Parasitic Nematodes ◽  
Potato Tubers ◽  
Dry Rot ◽  
Mole Cricket ◽  
The Republic ◽  
Ditylenchus Destructor

Introduction. Potato (Solanum tuberosum L.) is susceptible to infestation with an associated complex of different species of parasitic and saprophytic nematodes, bacteria, fungi, and arthropods, which diminish the quality of the product. Material and methods. 10 varieties of potatoes were investigated (Agata, Albastriu-mov, Bella rosa, Concorde, Desiree, Irga, Iagodca, Roko, Romano, Sprinter), cultivated on the territory of the Republic of Moldova. The extraction of nematodes and mites was performed using the Baermann funnels, modified by Nesterov.Results. Multiannual researches on the degree of potato infestation have shown that tubers are preferred by various arthropods (Acaridae), Agriothes spp. (Elateridae), Gryllotalpa gryllotalpa, (Grillotalpidae) and Sciaridae spp . (Sciaridae), which form different interactions with the parasitic nematodes of tubers (Ditylenchus destructor, D. dipsaci).Conclusions. Solanum tuberosum infested by parasitic nematodes D. destructor in association with saprophytic nematodes and dry rot are colonized by nematophag ous (mites – 80%) and phytophagous arthropods (wireworms – 40%; mole cricket – 50%; flies – 40%). Among the researched arthropods, Rhizoglyphus echinopus were more frequently found, which together with other species actively consume the primary and secondary parasitic nematodes, their mortality constituting up to 90%. In the traumatized by some arthropods potatoes, with the soil, secondary parasitic nematodes, also penetrate, carrying bacterial and fungal infections, subsequently stimulating the total rot of potato tubers.

scholarly journals First Report of Thiabendazole-Resistant Isolates of Fusarium sambucinum Infecting Stored Potatoes in Nova Scotia, Canada

Plant Disease ◽  
2001 ◽  
Vol 85 (9) ◽  
pp. 1030-1030 ◽  
Author(s):  
R. D. Peters ◽  
I. K. Macdonald ◽  
K. A. MacIsaac ◽  
S. Woodworth
Keyword(s):  
Nova Scotia ◽  
Solanum Tuberosum L ◽  
Fusarium Species ◽  
The United States ◽  
Postharvest Disease ◽  
Potato Tubers ◽  
Eastern Canada ◽  
Dry Rot ◽  
First Report ◽  
Petri Dishes

Fusarium dry rot is a significant postharvest disease of potato (Solanum tuberosum L.) and is often controlled by applying thiabendazole to tubers prior to storage. However, thiabendazole-resistant isolates of Fusarium spp. have been reported from Europe (2), the United States (1), and Canada (1,4). To address concerns, samples of potato tubers showing symptoms of dry rot caused by Fusariumspp. were collected from three storage bays in a commercial storage facility in Nova Scotia, Canada, in February 2001. All tubers had been treated with thiabendazole after harvest and prior to storage. Tubers were cut longitudinally, and small tissue samples (10 × 5 × 3 mm) were taken from the margins of internal necrotic regions with a sterile scalpel, surface-sterilized in 0.6% sodium hypochlorite for 15 s, rinsed twice in sterile distilled water (SDW), and blotted dry on sterile filter paper. Tissue pieces were plated on 0.5-strength potato dextrose agar (PDA) amended with tetracycline (0.05 g/liter) and streptomycin sulfate (0.1 g/liter). Petri dishes were incubated in the dark at 22°C for 4 to 7 days. After incubation, hyphal tips from the margins of actively growing isolates were removed with a sterile probe and plated on 0.5-strength PDA to generate pure cultures. Of 35 potato tubers examined, 10 (29%) yielded Fusarium isolates for further study. All 10 isolates were identified as F. sambucinum Fuckel according to Nelson et al. (3). Agar plugs (5 mm diameter) taken from the margins of 7- to 10-day-old cultures of F. sambucinum isolates were transferred to petri dishes containing 0.5-strength PDA amended with thiabendazole at 0, 1, 5, 10, 20, 50, or 100 mg/liter. Thiabendazole was prepared as a stock solution in SDW and added to molten agar after autoclaving. Cultures were grown in the dark for 7 days at 22°C, after which mycelial growth diameter was measured using digital calipers. Two measurements, along orthogonal diameters, were taken from each of three replicate plates for a total of six measurements per thiabendazole concentration. Means were calculated, and the diameter of the inoculation plug was subtracted from each mean. Calculated EC50 values (thiabendazole concentration inhibiting pathogen growth by 50%) were obtained by regression of the log of the chemical concentration against the corresponding probit of percent fungal inhibition. All isolates of F. sambucinum were resistant to thiabendazole, with EC50 values ranging from 7 to 82 mg/liter. Six isolates had EC50 values between 40 and 82 mg/liter. Control isolates of F. sambucinum, F. avenaceum, F. solani, and F. oxysporum were sensitive to thiabendazole, with EC50 values of <1 mg/liter. Although isolates of F. sambucinum resistant to thiabendazole have been recovered from eastern Canada (1,4), this is the first report of thiabendazole resistance in F. sambucinum isolates from tubers in commercial storage in the Annapolis Valley of Nova Scotia, Canada, a production region that concentrates on growing processing potatoes for the potato chip industry and is several hundred kilometers from other potato-growing regions of Prince Edward Island and New Brunswick. References: (1) A. E. Desjardins. Am. Potato J. 72:145, 1995. (2) G. A. Hide et al. Plant Pathol. 41:745, 1992. (3) P. E. Nelson et al. 1983. Fusarium Species: An Illustrated Manual for Identification . Pennsylvania State University Press, University Park, PA. (4) H. W. Platt. Phytoprotection 78:1, 1997.

scholarly journals Evaluation of potato cultivars and breeding lines for susceptibility to tuber soft rot induced by Erwinia carotovora subsp atroseptica

2009 ◽  
Vol 62 ◽  
pp. 403-403
Author(s):  
M. Jeram ◽  
P.J. Wright ◽  
J.A.D. Anderson ◽  
S.L. Lewthwaite
Keyword(s):  
Erwinia Carotovora ◽  
Soft Rot ◽  
Storage Conditions ◽  
Potato Cultivars ◽  
Control Measures ◽  
Postharvest Disease ◽  
Potato Tubers ◽  
Breeding Lines ◽  
Susceptibility To Infection ◽  
Potato Breeding Programme

Bacterial soft rot of potato tubers in storage is an economically important postharvest disease worldwide Disease control measures include reduction of tuber damage at harvest provision of suitable storage conditions and breeding of resistant cultivars Tubers of 18 potato cultivars and breeding lines were assessed for susceptibility to infection by Erwinia carotovora subsp atroseptica (Eca) over three maincrop seasons between 2003 and 2007 Susceptibility to Ecainduced soft rot was determined by measuring the weight of rotted tissue in anaerobically incubated whole tubers 7 days after inoculation with Eca Potato lines differed in susceptibility to soft rot by a factor of >37 (weight of rotted tissue) Cultivars Crop 28 Ilam Hardy and 30975 were highly susceptible and 065/27 Crop 15 and Crop 16 were least susceptible to Ecainduced soft rot As a consequence of these trials several of these lines are now being used in Plant Food Researchs potato breeding programme in order to develop cultivars with lower soft rot susceptibility than cultivars currently grown

scholarly journals Occurrence of Potato Soft Rot Caused by Erwinia carotovora (synonym Pectobacterium carotovorum) in Nepal: A First Report

Plant Disease ◽  
2010 ◽  
Vol 94 (3) ◽  
pp. 382-382 ◽  
Author(s):  
J. R. Lamichhane ◽  
G. M. Balestra ◽  
L. Varvaro
Keyword(s):  
16S Rdna ◽  
Solanum Tuberosum L ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Potato Tubers ◽  
Biochemical Tests ◽  
Wide Range ◽  
Fundamental Value ◽  
Negative Controls

Potato (Solanum tuberosum L.) is the fourth most important major crop of Nepal after rice, corn, and wheat, with an annual production of 1.94 million t and 153,000 ha of harvested area. It is a staple food crop in the remote hilly areas and the main vegetable in other parts of the country. Potato is grown in all three major agricultural zones (high hills, mid hills, and plain land) of Nepal, at an altitude ranging from 60 m to more than 4,000 m. Erwinia carotovora causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During the spring of 2009, a soft rot with a foul smell was noted in stored potato tubers of different local cultivars, especially Rato Alu and Seto Alu, in the Kathmandu District, central region of Nepal. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white-to-cream colored. Seven different potato fields, where the stored tubers originated, were surveyed and 23 samples consisting of approximately three symptomatic tubers were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar supplemented with 5% sucrose and incubated at 26 ± 1°C. After purification on tripticase soy agar medium, 17 isolates were identified as E. carotovora by the following deterministic tests: all strains were gram-negative rods; oxidase negative; facultatively anaerobic; able to degrade pectate; sensitive to erythromycin; negative for phosphatase; unable to produce acid from α-methyl-glucoside; and produced acid from trehalose. Pathogenicity of the strains was evaluated by depositing a bacterial suspension (106 CFU/ml) on potato slices (cv. Monalisa) and incubating at 30 ± 1°C. A reference strain of E. carotovora subsp. carotovora (NCPPB 2577) and sterile distilled water were used, respectively, as positive and negative controls. All strains caused soft rot within a week. Bacteria were reisolated from the slices and were shown to be identical to the original strains according to the above morphological, cultural, and biochemical tests. A 1,430-bp region of the 16S rDNA from all strains was amplified with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession No. GU075708; strain NEP ECC09). A BlastN search of GenBank revealed that the strains had 100% nt identity with the 16S rDNA sequence of E. carotovora subsp. carotovora type strain ATCC 15713 (GenBank Accession No. U80197). The finding of this pathogen is of fundamental value since this crop represents one of the economically important crops of Nepal. This pathogen has already been reported in the countries of China and India (1) with whom Nepal shares its boundaries. The pathogen may have been introduced to this region of Nepal via seed potato tubers from other countries. Reference: (1) G. S. Shekhawat et al. Potato Res. 19:241, 1976.

scholarly journals Antioxidant Capacity and Nutritional Value of Potato Tubers (Solanum tuberosum L.) as a Dependence of Growing Conditions and Long-Term Storage

Agriculture ◽  
2021 ◽  
Vol 12 (1) ◽  
pp. 21
Author(s):  
Dorota Wichrowska
Keyword(s):  
Antioxidant Capacity ◽  
Chlorogenic Acid ◽  
Solanum Tuberosum L ◽  
Interactive Effect ◽  
Potato Tubers ◽  
Organic Fertilization ◽  
Mineral Fertilization ◽  
Total Polyphenols ◽  
Npk Fertilizers ◽  
Full Dose

The aim of the study was to assess the interactive effect of the use of bio-fertilizer and organic matter brought into the soil, as well as to limit the use of mineral fertilization on the content of bioactive compounds in potato tubers cultivar ‘Satina’. The test results show a positive effect of the applied bio-fertilizer in all tested variants of organic fertilization (straw, fodder pea, manure) on the level of the tested compounds. Comparing the content of crude protein in tubers from plots where half the dose of mineral fertilization was applied, the use of bio-fertilizer increased the content of this component, especially after using straw. After 6 months of storage, organic fertilization had no significant effect on the protein content, while significant differences were found in tubers fertilized with mineral, in favor of the full dose of NPK fertilizers. The storage time increased the content of tyrosine, leucine, lysine, alanine, glutamic acid, and total AA, and also methionine, aspartic acid, and asparagine, while the content of isoleucine and phenyl-alanine decreased. The highest content of total polyphenols was found in tubers where the plots were covered with pea application, a full dose of mineral fertilizer, and the use of bio-fertilizer. Unfortunately, after 6 months of storage, potato tubers from plots fertilized with peas, especially those fertilized with half the dose of mineral fertilization and without the use of biofertilizer, significantly lost the most total polyphenols. Similar relationships were obtained for the level of chlorogenic acid in tubers, which is significantly correlated with the content of polyphenols, but only organic fertilization in the form of peas significantly increased the concentration of chlorogenic acid. On the other hand, the highest post-harvest antioxidant activity was characteristic of tubers from plots fertilized with manure, with a full dose of mineral fertilization and biofertilizer. During the 6-month storage, there was a decrease in the antioxidant capacity, on average 12.4% for the objects. This may indicate the influence of polyphenolic compounds as well as other antioxidants on the assessed trait.

scholarly journals Morphology, pathogenicity and molecular identification of Fusarium solani species complex (FSSC) associated with potato tubers

2021 ◽  
Author(s):  
Youssuf Gherbawy ◽  
Mohamed Hussein ◽  
Nabila Hassany ◽  
Yassmin Shebany ◽  
Mohamed Awad ◽  
...  
Keyword(s):  
Fusarium Solani ◽  
Species Complex ◽  
Sequence Data ◽  
Solanum Tuberosum L ◽  
Elongation Factor ◽  
Molecular Characteristics ◽  
Potato Tubers ◽  
Dry Rot ◽  
Upper Egypt ◽  
Fusarium Solani Species Complex

Abstract Potato (Solanum tuberosum L.) is among the top five crops growing worldwide following cereals, wheat, rice, corn and barley due to its high carbohydrate content and adaptability. Potatoes are particularly valued in developing countries as a rich source of starch, vitamins C and B6 and essential amino acids. Fusarium solani species complex (FSSC) is common pathogen of potato, causing dry rot in the Upper Egypt. In this study were isolated and identified FSSC from potato tubers based on the morphological and molecular characteristics. 187 isolates of Fusarium solani were obtained from potato tubers collected from different regions in the Upper Egypt. Based on the morphological characters, sequence data from β-tubulin and translation elongation factor (TEF-1α) genes, all of the selected FSSC isolates were divided into three major groups (F. keratoplasticum, F. falciforme and F. solani). All the tested FSSC were able to produce amylases. All of the isolates were evaluated for their pathogenicity on healthy potato tubers; which showed pathogenic effect, lesion sizes were quite variable. F. solani (SVUFs73) had a highly virulent effect.

Sign in / Sign up

Export Citation Format

Share Document