Tritium labeling of antisense oligonucleotides via different conjugation agents

A novel approach to tritium-labeled antisense oligonucleotides (ASO) was established by conjugating N-succinimidyl propionate, as well as maleimide-derivatives, to the 3′-end of ASOs targeting metastasis-associated lung adenocarcinoma transcript 1 (Malat1) containing amino- or sulfhydryl-linkers. In vitro stability and Malat1 RNA reduction studies demonstrated that N-ethylmaleimide (NEM) could be used as a stable tag while maintaining the desired target interaction. The corresponding radioactive label conjugation using [3H]-NEM resulted in tritium-labeled ASOs with a high molar specific activity of up to 17 Ci/mmol. Single-dose in vivo studies in mice were carried out to compare [3H]-ASOs with their unlabeled counterpart ASOs, with and without conjugation to N-acetylgalactosamine (GalNAc), for tissue and plasma concentrations time profiles. Despite the structural modification of the labeled ASOs, in vitro target interaction and in vivo pharmacokinetic behaviors were similar to that of the unlabeled ASOs. In conclusion, this new method provides a powerful technique for fast and safe access to tritium-labeled oligonucleotides, e.g., for pharmacokinetic, mass balance, or autoradiography studies. Graphical abstract

Ex Vivo Assessment of Tumor-Targeting Fluorescent Tracers for Image-Guided Surgery

Image-guided surgery can aid in achieving complete tumor resection. The development and assessment of tumor-targeted imaging probes for near-infrared fluorescence image-guided surgery relies mainly on preclinical models, but the translation to clinical use remains challenging. In the current study, we introduce and evaluate the application of a dual-labelled tumor-targeting antibody for ex vivo incubation of freshly resected human tumor specimens and assessed the tumor-to-adjacent tissue ratio of the detectable signals. Immediately after surgical resection, peritoneal tumors of colorectal origin were placed in cold medium. Subsequently, tumors were incubated with 111In-DOTA-hMN-14-IRDye800CW, an anti-carcinoembryonic antigen (CEA) antibody with a fluorescent and radioactive label. Tumors were then washed, fixed, and analyzed for the presence and location of tumor cells, CEA expression, fluorescence, and radioactivity. Twenty-six of 29 tumor samples obtained from 10 patients contained malignant cells. Overall, fluorescence intensity was higher in tumor areas compared to adjacent non-tumor tissue parts (p < 0.001). The average fluorescence tumor-to-background ratio was 11.8 ± 9.1:1. A similar ratio was found in the autoradiographic analyses. Incubation with a non-specific control antibody confirmed that tumor targeting of our tracer was CEA-specific. Our results demonstrate the feasibility of this tracer for multimodal image-guided surgery. Furthermore, this ex vivo incubation method may help to bridge the gap between preclinical research and clinical application of new agents for radioactive, near infrared fluorescence or multimodal imaging studies.

NEUROIMMUNE MECHANISMS OF COGNITIVE IMPAIRMENT AT AFFECTIVE DISORDERS

The aim of this study was the identification of the neuroimmune mechanisms of cognitive impairment on the basis of investigation of an of cognitive disorders association with functional activity of blood mononuclear cells and the synthesis of tumor necrosis factor - α (TNF-α) in patients with affective disorders in the form of depressive reactions and depression.TNF-α expression level in blood mononuclear cells of patients conducted with using the reverse transcriptase polymerase chain reaction method. The proliferative activity of blood mononuclear cells was investigated by a standard method based on the inclusion of a radioactive label. Cognitive function was assessed on the basis of perception, memory, praxis, speech, and control function. The severity of affective symptoms was measured by the Hamilton scale. It was found that patients with depressive reactions were characterized by the mild non-elemental cognitive impairment; while, in patients with depression, more severe non-elemental cognitive impairments in the form of decreased attention, memory, and daily activity were observed. In patients with affective disorders in the form of depression, an increase in the synthesis of TNF-α in blood mononuclear cells was detected, both an increase of the expression frequency of its gene and an increase in mRNA level, as well as an increase of the proliferative activity of blood mononuclear cells, which indicates the presence of immune system dysfunction in this category of patients.Thus, in patients with depression, activation of the TNF-α synthesis in blood mononuclear cells occurs: an increase in the frequency of its expression and an increase of the level of mRNA; these changes are accompanied by the increasing of immune cells functional activity and moderate non-delicate cognitive disorder in the form of cognitive impairment.

Fungal elimination of 2,4,6-trinitrotoluene (TNT) from the soils

The analysis of microscopic fungi collection created at theDurmishidze Institute of Biochemistry and Biotechnology revealed 107 strains assimilating 2,4,6-TNT (2,4,6-trinitrotoluene) belonging to the different fungal genera. The strains have been isolated from the polluted areas adjacent to the military grounds and industrial waste waters. It has been shown TNT is degraded most actively by strains belonging to the following genera: Trichoderma, Aspergillus, Mucor and Trichoderma. Optimal cultivation conditions for highly active strains -the destructors of TNT have been revealed. It has been established that the carbon skeleton of TNT being utilized by the mentioned strains undergoes biotransformation. The existence of radioactive intermediates of biotransformation, organic acids (70-90%) and amino acids (10-30%) have been detected in liquid culture. Radioactive label of 1-14C-TNT is mostly found in fumaric acid, which is known as one of the main products of benzene biotransformation and further conversion into succinic acid. Remediation level of TNT-contaminated red and black soils treated by the most active strains Aspergillus nigerN2-2 and Mucor sp. T1-1 have been studied under laboratory and field conditions. Cultivation of the above mentioned strains under laboratory conditions in sterile, black and red soils for 30 days at 30°C allowed decreasing the content of TNT in black soil to the residual, and in red soil - to 15%; cultivation of Aspergillus niger N2-2 decreased the amount of TNT in black soil to 11 and in red soil - to 21%. Under field conditions, TNT degradation level in contaminated soils by naturally existing micro flora during 100 days was equal to 40-50%, and in the case of additional introduction of both fungal strains, TNT-destructors reached 80%.

Determination of Silver Nanoparticle Concentration Ratio in the Blood and Brain of Rats for Different Administration Routes

A study to assess the concentrations ratio of silver nanoparticles (Ag-NPs) in the blood and brain of the male Wistar rats using nuclear physical methods has been carried out. The Ag-NPs suspension including quasi-spherical Ag-NPs was administrated intravenously (in the tail vein for Ag-NPs of 9+2 nm and 94+10 nm), and for Ag-NPs of 94 nm diameter it was also administrated orally and intratracheally. The organ recovery was made in 24 h following the administration (for three types of administration) and one more time in 120 h in case of intravenous administration. Radioactive label in the nuclei of silver was created by irradiation of Ag-NPs suspensions in a flow of reactor thermal neutrons, and its share was 5.6 ∙ 10-7 of the total number of silver atoms. This fact could not affect the overall physical and chemical properties of radiolabeled Ag-NPs. We measured the activity of the 110mAg isotope-label in samples of blood and brain of rats, while the activity of 59Fe isotope was measured after the exposure to samples of these organs.Given the fact that iron is contained mainly in the hemoglobin of blood, on the basis of the measurement of 59Fe activity being the induced by neutron flux, we derived an evaluation of the residual mass of blood in brain capillaries using a standard procedure to prepare the samples. This determination is 0.058±0.010 g, and on average this is about 0 37±0.09% of the total mass of blood in rats. The estimated ratio of the Ag-NPs concentration in brain samples of rats (minus the Ag-NPs number in residual blood capillaries) to their peripheral blood concentration for 9 nm Ag-NPs is 0.16±0.04 and 0.31±0.07, and for 94 nm Ag-NPs - 0.20±0.05 and 0.29±0.07 for times in 24 and 120 hours after intravenous administration, respectively. For Ag-NPs of 9 nm and 94 nm diameter we revealed no significant effect of the Ag-NPs size on the value of this ratio. The same ratio for Ag-NPs of 94 nm diameter in 24 h after the oral and intratracheal administration is 0.29+0.09 and 0.41+0.12, respectively.

Large Gliadin Peptides Detected in the Pancreas of NOD and Healthy Mice following Oral Administration

Gluten promotes type 1 diabetes in nonobese diabetic (NOD) mice and likely also in humans. In NOD mice and in non-diabetes-prone mice, it induces inflammation in the pancreatic lymph nodes, suggesting that gluten can initiate inflammation locally. Further, gliadin fragments stimulate insulin secretion from beta cells directly. We hypothesized that gluten fragments may cross the intestinal barrier to be distributed to organs other than the gut. If present in pancreas, gliadin could interact directly with the immune system and the beta cells to initiate diabetes development. We orally and intravenously administered 33-mer and 19-mer gliadin peptide to NOD, BALB/c, and C57BL/6 mice and found that the peptides readily crossed the intestinal barrier in all strains. Several degradation products were found in the pancreas by mass spectroscopy. Notably, the exocrine pancreas incorporated large amounts of radioactive label shortly after administration of the peptides. The study demonstrates that, even in normal animals, large gliadin fragments can reach the pancreas. If applicable to humans, the increased gut permeability in prediabetes and type 1 diabetes patients could expose beta cells directly to gliadin fragments. Here they could initiate inflammation and induce beta cell stress and thus contribute to the development of type 1 diabetes.

A Development of Homolog Sequence of Eimeria tenella Partial Genome as a Probe for Molecular Diagnosis of Coccidiosis

The goal of the research was to develop a homolog sequence of Eimeria tenella partial genome as a molecularprobe for diagnose coccidiosis using dot blot method. A probe of homolog sequence of E.tenella partial genomeand a non radioactive label, dig-11-dUTP, were used for this research. Four concentrations of molecular probelabeled with dig-11-dUTP, namely, 158,33 pg/μl, 52,25 pg/μl, 15,83 pg/μl and 5,225 pg/μl were tested to detect0,6551 μg DNA target. The procedure of labeling and hybridization detection between DNA target with themolecular probe labeled with dig-11-dUTP were carried out with Digh high prime DNA labeling and detectionstarter Kit I. The conclusion of the research was that 52,25 pg/μl molecular probe or more which its sequenceGGCA CAGTATCCTCCTTCAGGGCAGGG CTCGCACTGGTCAAA CGCGG TAC CATT could detect DNAtarget by dot blot method.Keywords: coccidiosis, E. tenella genome, molecular probe, dot blot hybridization

DETECTION OF SAG1 AND BAG1 Toxoplasma gondii DNA PROBES LABELLED WITH DIGOXIGENIN-11-dUTP

The objective of this research was to detect a minimum concentration of the probes that could be used for dot blot hybridization analysis. The method required labeled DNA probes. In this study a non-radioactive label of Digoxigenin-11-dUTP was used for labeling the Sag1 and the Bag1 of Toxoplasma gondii DNA probe. Labeling method for the probes was done according to the random primed labeling technique. The result showed that 0.67 pg/µl Sag1 probe and 0.58 pg/µl Bag1 probe could be detected by anti-Dig-antibody. It could be concluded that 0.67 pg/µl Sag1 probe and 0.58 pg/µl Bag1 probe could be used to diagnose toxoplasmosis by dot blot hybridization method.