scholarly journals Dietary supplementation of propionylated starch to domestic cats provides propionic acid as gluconeogenic substrate potentially sparing the amino acid valine

2014 ◽  
Vol 3 ◽  
Author(s):  
Kristel Rochus ◽  
An Cools ◽  
Geert P. J. Janssens ◽  
Lynn Vanhaecke ◽  
Birgitte Wuyts ◽  
...  
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Propionic Acid ◽  
Protein Intake ◽  
Protein Digestibility ◽  
Domestic Cats ◽  
Intake Level ◽  
Health And Disease ◽  
And Control ◽  
Gluconeogenic Substrate

AbstractIn strict carnivorous domestic cats, a metabolic competition arises between the need to use amino acids for gluconeogenesis and for protein synthesis both in health and disease. The present study investigated the amino acid-sparing potential of propionic acid in cats using dietary propionylated starch (HAMSP) supplementation. A total of thirty cats were fed a homemade diet, supplemented with either HAMSP, acetylated starch (HAMSA) or celite (Control) for three adaptation weeks. Propionylated starch was hypothesised to provide propionic acid as an alternative gluconeogenic substrate to amino acids, whereas acetic acid from HAMSA would not provide any gluconeogenic benefit. Post-adaptation, a 5-d total faecal collection was carried out to calculate apparent protein digestibility coefficients. Fresh faecal and blood samples were collected to analyse fermentation endproducts and metabolites. The apparent protein digestibility coefficients did not differ between supplements (P = 0·372) and were not affected by the protein intake level (P = 0·808). Faecal propionic acid concentrations were higher in HAMSP than in HAMSA (P = 0·018) and Control (P = 0·003) groups, whereas concentrations of ammonia (P = 0·007) were higher in HAMSA than in HAMSP cats. Tendencies for or higher propionylcarnitine concentrations were observed in HAMSP compared with HAMSA (P = 0·090) and Control (P = 0·037) groups, and for tiglyl- + 3-methylcrotonylcarnitine concentrations in HAMSP as compared with Control (P = 0·028) cats. Methylmalonylcarnitine concentrations did not differ between groups (P = 0·740), but were negatively correlated with the protein intake level (r –0·459, P = 0·016). These results suggest that HAMSP cats showed more saccharolytic fermentation patterns than those supplemented with HAMSA, as well as signs of sparing of valine in cats with a sufficient protein intake.

Effect of protein intake on weight gain and plasma amino acid levels in uremic rats

1976 ◽  
Vol 230 (5) ◽  
pp. 1455-1459 ◽  
Author(s):  
M Wang ◽  
I Vyhmeister ◽  
JD Kopple ◽  
ME Swendseid
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Protein Intake ◽  
Plasma Concentrations ◽  
Plasma Amino Acid ◽  
Uremic Patient ◽  
Lower Protein ◽  
Similar Weight ◽  
Amino Acid Levels ◽  
And Control

Chronically uremic rats weighing approximately 180-200 g and sham-operated controls of similar weight were pair fed diets containing 5, 15 or 23% protein for 10-12 wk. At each level of protein intake, uremic animals gained less weight and had lower protein efficiency ratios than controls. In addition, certain plasma amino acid levels were altered in the uremic animals. These included tyrosine and the tyrosine/phenylalanine ratio, which were decreased, and citrulline, glycine, and the methylhistidines, which were increased. In both uremic and control rats, plasma concentrations of certain amino acids, primarily nonessential ones, varied inversely with protein intake; with the 5% protein diet, the ratio of essential to nonessential amino acids was significantly reduced. These observations indicate that both uremia and reduced protein intake may affect growth and amino acid metabolism in rats with chronic renal failure. The finding that uremic rats utilize protein less efficiently may indicate that marked reductions in protein intake may be particularly hazardous to the nutritional status of the uremic patient.

Extent of damage to amino acid availability of whey protein heated with sugar

1991 ◽  
Vol 58 (4) ◽  
pp. 431-441 ◽  
Author(s):  
Thérèse Desrosiers ◽  
Laurent Savoie
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Whey Protein ◽  
Significant Proportion ◽  
Protein Digestibility ◽  
Heating Time ◽  
Heat Treatments ◽  
Molar Ratio ◽  
Amino Acid Availability

SummaryThe effect of heat treatments, at various water activities (αw), on digestibility and on the availabilities of amino acids of whey protein samples in the presence of lactose was estimated by an in vitro digestion method with continuons dialysis. Four αw (0·3, 0·5, 0·7 and 0·97), three temperatures (75, 100 and 121 °C) and three heating periods (50, 500 and 5000 s) were selected. The initial lysine: lactose molar ratio was 1:1. Amino acid profiles showed that excessive heating of whey (121 °C, 5000 s) destroyed a significant proportion of cystine at all αw, lysine at αw 0·3, 0·5 and 0·7, and arginine at αw 0·5 and 0·7. At αw 0·3, 0·5 and 0·7, protein digestibility decreased (P < 0·05) as the temperature increased from 75 to 121 °C for a heating period of 5000 s, and as the heating time was prolonged from 500 to 5000 s at 121 °C. Excessive heating also decreased (P < 0·05) the availabilities of ail amino acids at αw 0·3, 0·5 and 0·7. The availabilities of lysine, proline, aspartic acid, glutamic acid, threonine, alanine, glycine and serine were particularly affected. Severe heating at αw 0·97 did not seem to favour the Maillard reaction, but the availabilities of cystine, tyrosine and arginine were decreased, probably as a result of structural modifications of the protein upon heating. Heating whey protein concentrates in the presence of lactose not only affected lysine, but also impaired enzymic liberation of other amino acids, according to the severity of heat treatments and αw.

scholarly journals Scientific Background of Dairy Protein Digestibility: A Review

2014 ◽  
Vol 7 ◽  
pp. 1-8 ◽  
Author(s):  
Ashok Kumar Shrestha
Keyword(s):  
Amino Acids ◽  
Whey Proteins ◽  
Protein Digestibility ◽  
In Vitro Digestion ◽  
Dairy Proteins ◽  
Dairy Foods ◽  
Dairy Protein ◽  
Protein Rich ◽  
And Control

Recent advances have shown that differences in compositional, structural and physical properties of caseins and whey proteins affect their digestion and absorption behavior, hormonal response, satiety effect and other physiological effects. For example, the ingestion of whey protein cause fast, high and transient increase of amino acids ‘fast protein’, whereas casein induce slower, lower and prolonged increase of ‘slow protein’ in the gut. Knowledge of, and control over, the rate and nature of digestive breakdown of dairy proteins provides a potential basis for product/process innovation through identifying ingredients and formulations that provide desired nutrient delivery profiles. With this background, the aim of our current review paper is to understand the digestion behavior of various protein-rich milk powders and their potential use in formulation of dairy foods for controlled release of amino acids and energy. Currently available in vitro protein digestibility methods to measure or predict the dairy protein digestibility were also investigated. The author has also presented the preliminary results of ongoing study on in vitro digestion of various commercial proteins powders.DOI: http://dx.doi.org/10.3126/jfstn.v7i0.10560 J. Food Sci. Technol. Nepal, Vol. 7 (1-8), 2012

Changes in amino acid compounds of wheat plants during ensiling and aerobic exposure: the influence of propionic acid and urea phosphate-calcium propionate

1984 ◽  
Vol 102 (3) ◽  
pp. 667-672 ◽  
Author(s):  
G. Ashbell ◽  
H. H. Theune ◽  
D. Sklan
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Glutamic Acid ◽  
Propionic Acid ◽  
Butyric Acid ◽  
Total Amino Acid ◽  
Amino Butyric Acid ◽  
Urea Phosphate ◽  
Fresh Material ◽  
Calcium Propionate

SummaryChanges in distribution of amino acid nitrogen of chopped wheat plants ensiled at shooting and flowering when wilted, and at the milk and dough stages as fresh material, were determined as affected by addition of 0·8% propionic acid (PrA) or 2·2% urea phosphate-calcium propionate (UP-CaPr). Analyses were carried out after an ensiling period of 90 days and after a further aerobic exposure period (AE) of 7 days.Total amino acid (TAA) contents in the dry matter (D.M.) during the fermentation period and in the AE were stable in untreated material (UM) and treated material. Concentration of essential amino acids decreased during fermentation, this decrease being higher in the UM. The free amino acids were low in the fresh material (18·6% of TAA) but increased in the ensiled material to ca. 71 % of the TAA in the silage. In the AE this level was 63% in UM and 69% in treated material. The ammonia-N contents increased during fermentation in UM and especially in the UP-CaPr treatments, while the opposite occurred in the PrA treatments.The concentrations of and changes in 21 amino acids (AAs) are given. The highest AA concentrations recorded in the fresh material were those of arginine, lysine, glutamic acid, alanine, leucine, proline and glycine. The most marked increments in AAs as a result of fermentation were those of ornithine, γ-amino butyric acid, threonine and methionine. Marked decreases were observed in glutamine, arginine and glutamic acid. PrA increased mainly arginine, asparagine and glutamine, whereas γ-amino butyric acid decreased; UP-CaPr increased arginine, asparagine, lysine and glutamic acid (in silage only) and reduced γ-amino butyric acid and glutamine (in AE only).

High Protein Intake during Continuous Hemodiafiltration: Impact on Amino Acids and Nitrogen Balance

2002 ◽  
Vol 25 (4) ◽  
pp. 261-268 ◽  
Author(s):  
R. Bellomo ◽  
H. K. Tan ◽  
S. Bhonagiri ◽  
I. Gopal ◽  
J. Seacombe ◽  
...  
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Nitrogen Balance ◽  
Protein Intake ◽  
Protein Supplementation ◽  
High Protein ◽  
Total Serum ◽  
Amino Acid Supplementation ◽  
Continuous Hemodiafiltration ◽  
High Protein Intake

Aims To study the effect of combined continuous veno-venous hemodiafiltration (CVVHDF) and high (2.5 g/kg/day) parenteral amino acid supplementation on nitrogen balance, amino acid losses and azotemic control in a cohort of patients with severe acute renal failure (ARF). Methods We administered 2.5 grams/kg/day of amino acids intravenously to seven critically ill patients with ARF. We obtained paired blood and ultrafiltrate (UF) samples (n=20) and calculated amino acid clearances and losses, nitrogen balance, protein catabolic rate and total nitrogen losses. Results The median total serum amino acid concentration was high at 5.2 mmol/L with particularly high concentrations of ornithine, lysine, and phenylalanine, but a low level of histidine. The median overall amino acid clearance was 18.6 ml/min (range: 12 to 29 ml/min). UF losses as percentage of administered dose were high for tyrosine (53.6 %) but low for methionine (3.0 %) and arginine (2.3 %). A positive nitrogen balance was achieved in 7 (35%) of the 20 study days with an overall median nitrogen balance of -1.8 g/day. Urea levels were maintained at a median of 26.6 mmol/L. Conclusions High protein intake increases the serum concentrations of most amino acids. Such protein supplementation, when coupled with CVVHDF, achieves a slightly negative overall nitrogen balance in extremely catabolic patients while still allowing adequate azotemic control.

scholarly journals Amino Acid Metabolism in Friedreich's Ataxia

1976 ◽  
Vol 3 (4) ◽  
pp. 373-378 ◽  
Author(s):  
B. Lemieux ◽  
A. Barbeau ◽  
V. Beroniade ◽  
D. Shapcott ◽  
G. Breton ◽  
...  
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Aspartic Acid ◽  
Plasma Levels ◽  
Genetic Defect ◽  
Friedreich’S Ataxia ◽  
Friedreich's Ataxia ◽  
Physiological Importance ◽  
And Control ◽  
Csf Concentration

SUMMARY:A study of amino acids determined by sequential Multi-sample Amino Acid Automatic Analyzer in plasma, urine and cerebrospinal fluid (CSF) in patients with Friedreich's ataxia and control subjects has revealed a number of mathematically significant variations from normal. Of practical physiological importance are the following: a high urinary excretion of alanine with slightly elevated plasma levels; a low plasma and CSF concentration of aspartic acid in the resence of normal urinary values and finally a low CSF concentration of taurine accompanied by normal plasma levels, but elevated urinary output and renal clearance rates. We postulate that the modifications in alanine and aspartic acid are less specific and probably secondary, but there could be a genetic defect in the membrane transport of taurine and the other β-amino acids in Friedreich's ataxia.

EFFECT OF STEAM PELLETING AND REGRINDING ON THE DIGESTIBILITY OF PROTEIN IN CEREAL GRAINS, SOYBEAN MEAL AND WHEAT BRAN BY THE RAT

1968 ◽  
Vol 48 (1) ◽  
pp. 35-39 ◽  
Author(s):  
E. M. Olsen ◽  
S. J. Slinger
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Wheat Bran ◽  
Soybean Meal ◽  
Protein Digestibility ◽  
Essential Amino Acids ◽  
Cereal Grains ◽  
Protein Utilization ◽  
Amino Acid Availability ◽  
Net Protein

The effect if steam pelleting and regrinding on digestibility of protein in corn, wheat, barley, oats, soybean meal and wheat bran was tested with rats. Percentage amino acid absorption and net protein utilization (NPU) were determined for the wheat bran. Pelleting and regrinding improved the digestibility of protein in bran but had no effect on the digestibility of protein in the other ingredients tested. Increased absorption of amino acids caused by the increased digestibility of protein in bran varied considerably for individual amino acids, being greatest for isoleucine, lysine, methionine and threonine of the essential amino acids. The improvement in protein digestibility and amino acid availability was reflected in a higher NPU.

scholarly journals Advantages and limitations of the protein digestibility-corrected amino acid score (PDCAAS) as a method for evaluating protein quality in human diets

2012 ◽  
Vol 108 (S2) ◽  
pp. S333-S336 ◽  
Author(s):  
Gertjan Schaafsma
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Protein Quality ◽  
Protein Digestibility ◽  
Essential Amino Acids ◽  
Tissue Growth ◽  
Biological Efficiency ◽  
Amino Acid Supplementation ◽  
Reference Pattern ◽  
Plant Protein Sources

PDCAAS is a widely used assay for evaluating protein quality. It is a chemical score, which is derived from the ratio between the first limiting amino acid in a test protein and the corresponding amino acid in a reference amino acid pattern and corrected for true faecal N digestibility. Chemical scores exceeding 100 % are truncated to 100 %. The advantages of the PDCAAS are its simplicity and direct relationship to human protein requirements. The limitations are as follows: the reference pattern is based on the minimum amino acid requirements for tissue growth and maintenance and does not necessarily reflect the optimum intake. Truncated PDCAAS of high-quality proteins do not give any information about the power of these proteins to compensate, as a supplement, for low levels of dietary essential amino acids in low-quality proteins. It is likely that faecal N digestibility does not take into account the loss from the colon of indispensable amino acids that were not absorbed in the ileum. Anti-nutritional factors, such as lectins and trypsin inhibitors, in several plant protein sources can cause heightened endogenous losses of amino acids, an issue which is particularly relevant in animal feedstuffs. The assumption that amino acid supplementation can completely restore biological efficiency of the protein source is incorrect since the kinetics of digestion and absorption between supplemented free amino acids and amino acids present in dietary proteins, are different.

scholarly journals Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride

2021 ◽  
Vol 41 ◽  
pp. 06003
Author(s):  
Lu’lu’ Sahara Wusahaningtyas ◽  
Moh Mirza Nuryady ◽  
Lintang Winantya Firdausy ◽  
Ahmad Fahrurrozi Zs ◽  
R. Wisnu Nurcahyo
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Abc Transporters ◽  
Trypanosoma Evansi ◽  
Control Group ◽  
Transporter Gene ◽  
High Similarity ◽  
Blood Samples ◽  
Multiple Alignments ◽  
And Control

This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.

scholarly journals Composition and nutritional evaluation of amino acids in Mimai Qu rice wine

2021 ◽  
Vol 33 (2) ◽  
pp. 46-53
Author(s):  
Kaizheng Zhang ◽  
Wenchi Wu ◽  
Wei Zou ◽  
Zhenhui Kang ◽  
Qin Yan ◽  
...  
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Nutritional Value ◽  
Principal Component ◽  
Total Amino Acid ◽  
Linear Regression Method ◽  
Rice Wine ◽  
Chinese Rice Wine ◽  
Acid Ratio ◽  
And Control

An amino acid analyzer was used to detect free amino acids (FAA) in Mimai Qu rice wines (SMW and DMW) and control wine samples (Chinese rice wine [CRW] and Japanese sake [JNS]). It was found that CRW had the highest total amino acid (TAA) content (~2814 mg/L), followed by SMW (~2509 mg/L) and DMW (~1474 mg/L), while JNS had the least (~917 mg/L). Amino acid ratio coefficient method (SRCAA), linear regression method, cluster analysis (CA) and principal component analysis (PCA) were used for evaluating the nutritional value of amino acids in wine samples, giving similar results. SMW had the highest nutritional value, followed by CRW and DMW and JNS.

Sign in / Sign up

Export Citation Format

Share Document