Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.
Fungicidal effect of silver nanoparticles on toxigenic fungi in cocoa