scholarly journals A new lateral flow assay to detect sIL-2R during T-cell mediated rejection after kidney transplantation

The Analyst ◽  
2021 ◽  
Author(s):  
Lisa K. Seiler ◽  
Rebecca Jonczyk ◽  
Patrick Lindner ◽  
Ncog Linh Phung ◽  
Christine S. Falk ◽  
...  
Keyword(s):  
Kidney Transplantation ◽  
T Cell ◽  
Point Of Care ◽  
High Specificity ◽  
Lateral Flow ◽  
Lateral Flow Assay ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Kidney Rejection ◽  
Acute Kidney Rejection

In this work a novel point of care test to detect sIL-2R during acute kidney rejection with high specificity and sensitivity was developed.

scholarly journals A rapid and affordable point of care test for antibodies against SARS-CoV-2 based on hemagglutination and artificial intelligence interpretation

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Vanessa Redecke ◽  
Kazuki Tawaratsumida ◽  
Erin T. Larragoite ◽  
Elizabeth S. C. P. Williams ◽  
Vicente Planelles ◽  
...  
Keyword(s):  
Test Performance ◽  
Learning Algorithm ◽  
Point Of Care ◽  
Method Comparison ◽  
High Specificity ◽  
Turnaround Time ◽  
Analysis Tool ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
A Cell

AbstractDiagnostic tests that detect antibodies (AB) against SARS-CoV-2 for evaluation of seroprevalence and guidance of health care measures are important tools for managing the COVID-19 pandemic. Current tests have certain limitations with regard to turnaround time, costs and availability, particularly in point-of-care (POC) settings. We established a hemagglutination-based AB test that is based on bi-specific proteins which contain a dromedary-derived antibody (nanobody) binding red blood cells (RBD) and a SARS-CoV-2-derived antigen, such as the receptor-binding domain of the Spike protein (Spike-RBD). While the nanobody mediates swift binding to RBC, the antigen moiety directs instantaneous, visually apparent hemagglutination in the presence of SARS-CoV-2-specific AB generated in COVID-19 patients or vaccinated individuals. Method comparison studies with assays cleared by emergency use authorization demonstrate high specificity and sensitivity. To further increase objectivity of test interpretation, we developed an image analysis tool based on digital image acquisition (via a cell phone) and a machine learning algorithm based on defined sample-training and -validation datasets. Preliminary data, including a small clinical study, provides proof of principle for test performance in a POC setting. Together, the data support the interpretation that this AB test format, which we refer to as ‘NanoSpot.ai’, is suitable for POC testing, can be manufactured at very low costs and, based on its generic mode of action, can likely be adapted to a variety of other pathogens.

scholarly journals CASLFA: CRISPR/Cas9-mediated lateral flow nucleic acid assay

2019 ◽  
Author(s):  
Xusheng Wang ◽  
Erhu Xiong ◽  
Tian Tian ◽  
Meng Cheng ◽  
Wei Lin ◽  
...  
Keyword(s):  
Genetically Modified Organisms ◽  
African Swine Fever Virus ◽  
Point Of Care ◽  
African Swine Fever ◽  
Analytical Techniques ◽  
High Specificity ◽  
Lateral Flow ◽  
Lateral Flow Assay ◽  
Nucleic Acid Assay ◽  
Ancillary Equipment

AbstractThe lateral flow assay is one of the oldest and most convenient analytical techniques for analyzing the immune response, but its applicability to precise genetic analyses is limited by the tedious and inefficient hybridization steps. Here, we have introduced a new version of the lateral flow assay, termed Cas9-mediated lateral flow nucleic acids assay (CASLFA), to address such issues. In this study, CASLFA is utilized to identify Listeria monocytogenes, genetically modified organisms (GMOs), and African swine fever virus (ASFV) at a sensitivity of hundreds of copies of genome samples with high specificity within 1 h. CASLFA satisfies some of the characteristics of a next-generation molecular diagnostics tool due to its rapidity and accuracy, allowing for point-of-care use without the need for technical expertise and complex ancillary equipment. This method has great potential for analyzing genes in resource-poor or nonlaboratory environments.

scholarly journals Laboratory diagnosis of human brucellosis in Egypt and persistence of the pathogen following treatment

2011 ◽  
Vol 5 (11) ◽  
pp. 786-791 ◽  
Author(s):  
Ayman Marei ◽  
Ghada Boghdadi ◽  
Nahla Abdel-Hamed ◽  
Rasha Hessin ◽  
Theresia Abdoel ◽  
...  
Keyword(s):  
Point Of Care ◽  
Public Health Problem ◽  
Laboratory Diagnosis ◽  
Diagnostic Value ◽  
Lateral Flow ◽  
Lateral Flow Assay ◽  
Human Brucellosis ◽  
Major Public Health Problem ◽  
Serum Samples ◽  
Point Of Care Test

Introduction: Brucellosis is a major public health problem in Egypt. The Brucella IgM/IgG lateral flow assay was developed as a point-of-care test for the diagnosis of human brucellosis. The aim of this study was to assess the diagnostic value of the lateral flow assay for use in Egypt. Methodology: Fifty samples of patients who presented with clinical suspicion of brucellosis over a one-year period were collected.  All samples were subjected to the Brucella IgM/IgG lateral flow assay, serum agglutination test (SAT), rose bengal RB Test (RB), 2- mercapteoethanol (2-ME), culture and PCR. SAT, 2- ME, culture and PCR were retested after the end of the treatment. Results: Culture and SAT confirmed the diagnosis of brucellosis in twenty patients.  While 90% of the samples were positive by SAT, only 30% and 85% were positive by culture and PCR respectively. The sensitivity of the lateral flow assay calculated for the Brucella IgM/IgG was 95% and specificity was 97%. Conclusion: These data show that the lateral flow assay is more suitable for diagnosis of brucellosis in Egypt than culture and SAT.  Application of the PCR on serum samples collected during follow-up revealed that the DNA of the pathogen was yet not completely cleared almost 60 days after the start of treatment with doxycycline and ciprofloxacin.

A rapid point-of-care test for dengue virus-1 based on a lateral flow assay with a near-infrared fluorescent dye

2018 ◽  
Vol 456 ◽  
pp. 23-27 ◽  
Author(s):  
Lin Chen ◽  
Huagui Wang ◽  
Tongsheng Guo ◽  
Chaohui Xiao ◽  
Licheng Liu ◽  
...  
Keyword(s):  
Dengue Virus ◽  
Near Infrared ◽  
Point Of Care ◽  
Fluorescent Dye ◽  
Lateral Flow ◽  
Lateral Flow Assay ◽  
Point Of Care Test

Rapid Detection of Shellfish Major Allergen Tropomyosin Using Superparamagnetic Nanoparticle-Based Lateral Flow Immunoassay

2011 ◽  
Vol 311-313 ◽  
pp. 436-445 ◽  
Author(s):  
Liang Shi ◽  
Xi Chang Wang ◽  
Yuan Liu ◽  
Ying Lu
Keyword(s):  
Limit Of Detection ◽  
Point Of Care ◽  
High Specificity ◽  
Major Allergen ◽  
Lateral Flow ◽  
Lateral Flow Immunoassay ◽  
Quantitative Detection ◽  
Point Of Care Test ◽  
Western Blot Method ◽  
Food Species

In this study, a competitive assay format using superparamagnetic nanoparticle-based lateral flow immunoassay (LFIA) was developed for rapid, quantitative detection of shellfish major allergen tropomyosin (Tm). Sartorius CN140 nitrocellulose membrane and 0.05mg/mL Tm immobilized in the test line (T line) were optimized in order to improve the performance of the LFIA system. Calibration curves for Tm under PBS-T diluents and carp muscle extraction diluents were established. Limit of detection (LOD) for Tm calibrated by carp muscle matrix was 12.4ng/mL with a work range of 0.01 to 20μg/mL. According to magnetic signals change with the time of sample flowing on the strip, the qualitative time of the LFIA was about 10min, while the quantitative time of the LFIA was about 25min. 30 food species were detected separately by the LFIA and Western blot method to evaluate the specificity of the LFIA. Overall relative agreement of the two methods was 96.7% (29/30). Moreover, intra- and inter-assay precisions of the LFIA for Tm detection were <10.20% and <12.34%, respectively. The average recovery range in different food matrices was 80.3~111.8%, within a reasonable range. Our data confirmed that the superparamagnetic nanoparticle-based LFIA method developed in this study is rapid, simple, high specificity and capable of quantitative test. Consequently, the LFIA has the potential application in the field of point-of-care test of shellfish major allergen Tm.

A Point of Care Lateral Flow Assay for Rapid and Colorimetric Detection of Interleukin 6 and Perspectives in Bedside Diagnostics

2020 ◽  
Author(s):  
Carla Eiras
Keyword(s):  
Interleukin 6 ◽  
Limit Of Detection ◽  
Inflammatory Diseases ◽  
Point Of Care ◽  
Colorimetric Detection ◽  
Lateral Flow ◽  
Lateral Flow Assay ◽  
Aggregation Assay ◽  
Before And After ◽  
Bedside Diagnosis

Interleukin-6 (IL-6) is a multifunctional cytokine and high bloodstream levels of which have been associated with severe inflammatory diseases, such as dengue fever, sepsis, various cancers, and visceral leishmaniasis (VL). Rapid tests for the quantification of IL-6 would be of great assistance for the bedside diagnosis and treatment of diseases such as VL. We have developed a lateral flow assay (LFA) for rapid and colorimetric IL-6 detection, consisting of anti-IL-6 antibodies conjugated to gold nanoparticles (AuNPs). The optimal concentration of anti-IL-6 used in the conjugate was determined to be 800.0 μg/mL, based on an aggregation assay using LFA. A linear relationship between IL-6 standard concentration and color intensity was observed after 20 min, with a linear range between 1.25 ng/mL and 9,000 ng/mL. The limit of detection for this method was estimated a t0.38 ng/mL. The concentration of IL-6 in five patients with severe VL was measured using LFA, and the results were consistent with those obtained using the cytometric bead array (CBA) method. A thorough analysis of the LFA membranes’ surface morphology, before and after sample contact, was performed using atomic force microscopy (AFM).The prototype described here is still being tested and improved, but this LFA will undoubtedly be of great help in the clinical quantification of IL-6.

A Point of Care Lateral Flow Assay for Rapid and Colorimetric Detection of Interleukin 6 and Perspectives in Bedside Diagnostics

2020 ◽  
Author(s):  
Carla Eiras
Keyword(s):  
Interleukin 6 ◽  
Limit Of Detection ◽  
Inflammatory Diseases ◽  
Point Of Care ◽  
Colorimetric Detection ◽  
Lateral Flow ◽  
Lateral Flow Assay ◽  
Aggregation Assay ◽  
Before And After ◽  
Bedside Diagnosis

Interleukin-6 (IL-6) is a multifunctional cytokine and high bloodstream levels of which have been associated with severe inflammatory diseases, such as dengue fever, sepsis, various cancers, and visceral leishmaniasis (VL). Rapid tests for the quantification of IL-6 would be of great assistance for the bedside diagnosis and treatment of diseases such as VL. We have developed a lateral flow assay (LFA) for rapid and colorimetric IL-6 detection, consisting of anti-IL-6 antibodies conjugated to gold nanoparticles (AuNPs). The optimal concentration of anti-IL-6 used in the conjugate was determined to be 800.0 μg/mL, based on an aggregation assay using LFA. A linear relationship between IL-6 standard concentration and color intensity was observed after 20 min, with a linear range between 1.25 ng/mL and 9,000 ng/mL. The limit of detection for this method was estimated at a t0.38 ng/mL. The concentration of IL-6 in five patients with severe VL was measured using LFA, and the results were consistent with those obtained using the cytometric bead array (CBA) method. A thorough analysis of the LFA membranes’ surface morphology, before and after sample contact, was performed using atomic force microscopy (AFM). The prototype described here is still being tested and improved, but this LFA will undoubtedly be of great help in the clinical quantification of IL-6.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

scholarly journals Comparative Analysis of the Euroimmun CXCL13 Enzyme-Linked Immunosorbent Assay and the ReaScan Lateral Flow Immunoassay for Diagnosis of Lyme Neuroborreliosis

2020 ◽  
Vol 58 (9) ◽  
Author(s):  
Katharina Ziegler ◽  
Anca Rath ◽  
Christoph Schoerner ◽  
Renate Meyer ◽  
Thomas Bertsch ◽  
...  
Keyword(s):  
Immunosorbent Assay ◽  
Roc Curve ◽  
Point Of Care ◽  
Lateral Flow ◽  
Lyme Neuroborreliosis ◽  
Diagnostic Tools ◽  
Lateral Flow Immunoassay ◽  
Enzyme Linked Immunosorbent Assay ◽  
European Federation ◽  
Point Of Care Test

ABSTRACT Diagnosis of Lyme neuroborreliosis (LNB) is challenging, as long as Borrelia-specific intrathecal antibodies are not yet detectable. The chemokine CXCL13 is elevated in the cerebrospinal fluid (CSF) of LNB patients. Here, we compared the performances of the Euroimmun CXCL13 enzyme-linked immunosorbent assay (CXCL13 ELISA) and the ReaScan CXCL13 lateral flow immunoassay (CXCL13 LFA), a rapid point-of-care test, to support the diagnosis of LNB. In a dual-center case-control study, CSF samples from 90 patients (34 with definite LNB, 10 with possible LNB, and 46 with other central nervous system [CNS] diseases [non-LNB group]) were analyzed with the CXCL13 ELISA and the CXCL13 LFA. Classification of patients followed the European Federation of Neurological Societies (EFNS) guidelines on LNB. The CXCL13 ELISA detected elevated CXCL13 levels in all patients with definite LNB (median, 1,409 pg/ml) compared to the non-LNB controls (median, 20.7 pg/ml; P < 0.0001), with a sensitivity of 100% and a specificity of 84.8% (cutoff value, 78.6 pg/ml; area under the receiver operating characteristic [ROC] curve, 0.93). Similarly, the CXCL13 LFA yielded elevated CXCL13 levels in 31 patients with definite LNB (median arbitrary value, 223.5) compared to the non-LNB control patients (median arbitrary value, 0; P < 0.0001) and had a sensitivity and specificity of 91.2% and 93.5%, respectively (cutoff arbitrary value, 22.5; area under the ROC curve, 0.94). The correlation between the CXCL13 levels obtained by ELISA and LFA was strong (Spearman correlation coefficient r = 0.89; P < 0.0001). The CXCL13 ELISA and the CXCL13 LFA are comparable diagnostic tools for the detection of CXCL13 in the CSF of patients with definite LNB. The advantage of the CXCL13 LFA is the shorter time to result.

Sign in / Sign up

Export Citation Format

Share Document