A rapid and affordable point of care test for antibodies against SARS-CoV-2 based on hemagglutination and artificial intelligence interpretation

AbstractDiagnostic tests that detect antibodies (AB) against SARS-CoV-2 for evaluation of seroprevalence and guidance of health care measures are important tools for managing the COVID-19 pandemic. Current tests have certain limitations with regard to turnaround time, costs and availability, particularly in point-of-care (POC) settings. We established a hemagglutination-based AB test that is based on bi-specific proteins which contain a dromedary-derived antibody (nanobody) binding red blood cells (RBD) and a SARS-CoV-2-derived antigen, such as the receptor-binding domain of the Spike protein (Spike-RBD). While the nanobody mediates swift binding to RBC, the antigen moiety directs instantaneous, visually apparent hemagglutination in the presence of SARS-CoV-2-specific AB generated in COVID-19 patients or vaccinated individuals. Method comparison studies with assays cleared by emergency use authorization demonstrate high specificity and sensitivity. To further increase objectivity of test interpretation, we developed an image analysis tool based on digital image acquisition (via a cell phone) and a machine learning algorithm based on defined sample-training and -validation datasets. Preliminary data, including a small clinical study, provides proof of principle for test performance in a POC setting. Together, the data support the interpretation that this AB test format, which we refer to as ‘NanoSpot.ai’, is suitable for POC testing, can be manufactured at very low costs and, based on its generic mode of action, can likely be adapted to a variety of other pathogens.

Download Full-text

A new lateral flow assay to detect sIL-2R during T-cell mediated rejection after kidney transplantation

The Analyst ◽

10.1039/d1an01001h ◽

2021 ◽

Author(s):

Lisa K. Seiler ◽

Rebecca Jonczyk ◽

Patrick Lindner ◽

Ncog Linh Phung ◽

Christine S. Falk ◽

...

Keyword(s):

Kidney Transplantation ◽

T Cell ◽

Point Of Care ◽

High Specificity ◽

Lateral Flow ◽

Lateral Flow Assay ◽

Point Of Care Test ◽

Specificity And Sensitivity ◽

Kidney Rejection ◽

Acute Kidney Rejection

In this work a novel point of care test to detect sIL-2R during acute kidney rejection with high specificity and sensitivity was developed.

Download Full-text

Comparison of Four Commercially Available Point-of-Care Tests to Detect Antibodies against Canine Parvovirus in Dogs

Viruses ◽

10.3390/v13010018 ◽

2020 ◽

Vol 13 (1) ◽

pp. 18

Author(s):

Michèle Bergmann ◽

Mike Holzheu ◽

Yury Zablotski ◽

Stephanie Speck ◽

Uwe Truyen ◽

...

Keyword(s):

Test Performance ◽

Point Of Care ◽

Reference Method ◽

Canine Parvovirus ◽

P Value ◽

Important Indicator ◽

Specificity And Sensitivity ◽

Specific Pathogen ◽

The One ◽

Point Of Care Tests

Measuring antibodies to evaluate dogs´ immunity against canine parvovirus (CPV) is useful to avoid unnecessary re-vaccinations. The study aimed to evaluate the quality and practicability of four point-of-care (POC) tests for detection of anti-CPV antibodies. The sera of 198 client-owned and 43 specific pathogen-free (SPF) dogs were included; virus neutralization was the reference method. Specificity, sensitivity, positive and negative predictive value (PPV and NPV), and overall accuracy (OA) were calculated. Specificity was considered to be the most important indicator for POC test performance. Differences between specificity and sensitivity of POC tests in the sera of all dogs were determined by McNemar, agreement by Cohen´s kappa. Prevalence of anti-CPV antibodies in all dogs was 80% (192/241); in the subgroup of client-owned dogs, it was 97% (192/198); and in the subgroup of SPF dogs, it was 0% (0/43). FASTest® and CanTiCheck® were easiest to perform. Specificity was highest in the CanTiCheck® (overall dogs, 98%; client-owned dogs, 83%; SPF dogs, 100%) and the TiterCHEK® (overall dogs, 96%; client-owned dogs, 67%; SPF dogs, 100%); no significant differences in specificity were observed between the ImmunoComb®, the TiterCHEK®, and the CanTiCheck®. Sensitivity was highest in the FASTest® (overall dogs, 95%; client-owned dogs, 95%) and the CanTiCheck® (overall dogs, 80%; client-owned dogs, 80%); sensitivity of the FASTest® was significantly higher compared to the one of the other three tests (McNemars p-value in each comparison: <0.001). CanTiCheck® would be the POC test of choice when considering specificity and practicability. However, differences in the number of false positive results between CanTiCheck®, TiterCHEK®, and ImmunoComb® were minimal.

Download Full-text

COVID-19 Biomarkers and Advanced Sensing Technologies for Point-of-Care (POC) Diagnosis

Bioengineering ◽

10.3390/bioengineering8070098 ◽

2021 ◽

Vol 8 (7) ◽

pp. 98

Author(s):

Ernst Emmanuel Etienne ◽

Bharath Babu Nunna ◽

Niladri Talukder ◽

Yudong Wang ◽

Eon Soo Lee

Keyword(s):

Response Times ◽

Rna Virus ◽

Point Of Care ◽

Protein Detection ◽

Turnaround Time ◽

Quantitative Detection ◽

Rt Pcr ◽

Specificity And Sensitivity ◽

Small Market ◽

Multiple Biomarkers

COVID-19, also known as SARS-CoV-2 is a novel, respiratory virus currently plaguing humanity. Genetically, at its core, it is a single-strand positive-sense RNA virus. It is a beta-type Coronavirus and is distinct in its structure and binding mechanism compared to other types of coronaviruses. Testing for the virus remains a challenge due to the small market available for at-home detection. Currently, there are three main types of tests for biomarker detection: viral, antigen and antibody. Reverse Transcription-Polymerase Chain Reaction (RT-PCR) remains the gold standard for viral testing. However, the lack of quantitative detection and turnaround time for results are drawbacks. This manuscript focuses on recent advances in COVID-19 detection that have lower limits of detection and faster response times than RT-PCR testing. The advancements in sensing platforms have amplified the detection levels and provided real-time results for SARS-CoV-2 spike protein detection with limits as low as 1 fg/mL in the Graphene Field Effect Transistor (FET) sensor. Additionally, using multiple biomarkers, detection levels can achieve a specificity and sensitivity level comparable to that of PCR testing. Proper biomarker selection coupled with nano sensing detection platforms are key in the widespread use of Point of Care (POC) diagnosis in COVID-19 detection.

Download Full-text

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

Scientific Reports ◽

10.1038/s41598-021-91826-8 ◽

2021 ◽

Vol 11 (1) ◽

Author(s):

Tahmineh Jalali ◽

Mostafa Salehi-Vaziri ◽

Mohammad Hassan Pouriayevali ◽

Seyed Latif Mousavi Gargari

Keyword(s):

Point Of Care ◽

Hemorrhagic Fever ◽

Diagnostic Methods ◽

Clinical Samples ◽

Crimean Congo Hemorrhagic Fever ◽

Point Of Care Test ◽

Specificity And Sensitivity ◽

Rural And Remote Areas ◽

Cchf Virus ◽

Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Download Full-text

Competitive SNP-LAMP probes for rapid and robust single-nucleotide polymorphism detection

10.1101/2021.03.29.437576 ◽

2021 ◽

Author(s):

Leland B Hyman ◽

Clare R Christopher ◽

Philip A Romero

Keyword(s):

Point Of Care ◽

High Specificity ◽

Common Source ◽

Lamp Method ◽

Universal Method ◽

Nucleotide Polymorphisms ◽

One Pot ◽

Single Nucleotide ◽

Specificity And Sensitivity ◽

And Shifts

Single-nucleotide polymorphisms (SNPs) are the most common source of genetic variation between individuals and have implications in human disease, pathogen drug resistance, and agriculture. SNPs are typically detected using DNA sequencing, which requires advanced sample preparation and instrumentation, and thus cannot be deployed for on-site testing or in low-resource settings. In this work we have developed a simple and robust assay to rapidly detect SNPs in nucleic acid samples. Our approach combines LAMP-based target amplification with fluorescent probes to detect SNPs with high specificity in a one-pot reaction format. A competitive "sink" strand preferentially binds to off-target products and shifts the free energy landscape to favor specific activation by SNP products. We demonstrated the broad utility and reliability of our SNP-LAMP method by detecting three distinct SNPs across the human genome. We also designed an assay to rapidly detect highly transmissible SARS-CoV-2 variants. This work demonstrates that competitive SNP-LAMP is a powerful and universal method that could be applied in point-of-care settings to detect any target SNP with high specificity and sensitivity.

Download Full-text

Cytohistopathological Study of Salivary Gland Lesions in Bundelkhand Region, Uttar Pradesh, India

Pathology Research International ◽

10.1155/2014/804265 ◽

2014 ◽

Vol 2014 ◽

pp. 1-5 ◽

Cited By ~ 5

Author(s):

Anita Omhare ◽

Sanjeev Kumar Singh ◽

Jitendra Singh Nigam ◽

Ankit Sharma

Keyword(s):

Salivary Gland ◽

Low Cost ◽

Uttar Pradesh ◽

Diagnostic Technique ◽

High Specificity ◽

Turnaround Time ◽

Malignant Tumours ◽

Female Ratio ◽

Specificity And Sensitivity ◽

Benign Tumours

Background. FNAC is a useful method for evaluating suspicious salivary glands lesions due to its low cost, minimum morbidity, rapid turnaround time, high specificity, and sensitivity. Aim. To know the frequency of the salivary gland lesions and cytohistological correlation in the Jhansi region, Uttar Pradesh, India. Material and Methods. In present study 124 cases were included and cytohistological correlation was made in 86 cases only. FNA was performed by using a 23/24-gauge needle without local anaesthesia. Air dried and 95% ethyl alcohol fixed wet smears were stained with Giemsa stain and Papanicolaou stain, respectively. Paraffin embedded tissue sections were stained with Haematoxylin and Eosin. Results. Parotid gland was the most commonly involved salivary gland. The commonest age group was 20 to 29 years, 30 to 39 years, and 60 to 69 years for nonneoplastic lesions, benign tumours, and malignant tumours, respectively. The overall male to female ratio was 1.17 : 1. The diagnostic accuracy of FNAC was 100%, 93.3%, and 88.2% for nonneoplastic lesions, benign tumours, and malignant tumours, respectively. Conclusion. The high accuracy, sensitivity, and specificity of FNAC confirm that preoperative cytology is a useful, quick, reliable diagnostic technique for rapid diagnosis and suitable for developing countries.

Download Full-text

Bolus Residue Scale: An Easy-to-Use and Reliable Videofluoroscopic Analysis Tool to Score Bolus Residue in Patients with Dysphagia

International Journal of Otolaryngology ◽

10.1155/2015/780197 ◽

2015 ◽

Vol 2015 ◽

pp. 1-7 ◽

Cited By ~ 11

Author(s):

Nathalie Rommel ◽

Charlotte Borgers ◽

Dirk Van Beckevoort ◽

Ann Goeleven ◽

Eddy Dejaeger ◽

...

Keyword(s):

Rating Scale ◽

Intraclass Correlation ◽

Correlation Coefficients ◽

Posterior Pharyngeal Wall ◽

High Specificity ◽

Analysis Tool ◽

Pharyngeal Wall ◽

Specificity And Sensitivity ◽

Low Sensitivity ◽

Sensitivity Specificity

Background. We aimed to validate an easy-to-use videofluoroscopic analysis tool, the bolus residue scale (BRS), for detection and classification of pharyngeal retention in the valleculae, piriform sinuses, and/or the posterior pharyngeal wall.Methods. 50 randomly selected videofluoroscopic images of 10 mL swallows (recorded in 18 dysphagia patients and 8 controls) were analyzed by 4 experts and 6 nonexpert observers. A score from 1 to 6 was assigned according to the number of structures affected by residue. Inter- and intrarater reliabilities were assessed by calculation of intraclass correlation coefficients (ICCs) for expert and nonexpert observers. Sensitivity, specificity, and interrater agreement were analyzed for different BRS levels.Results. Intrarater reproducibility was almost perfect for experts (mean ICC 0.972) and ranged from substantial to almost perfect for nonexperts (mean ICC 0.835). Interjudge agreement of the experts ranged from substantial to almost perfect (mean ICC 0.780), but interrater reliability of nonexperts ranged from substantial to good (mean 0.719). BRS shows for experts a high specificity and sensitivity and for nonexperts a low sensitivity and high specificity.Conclusions. The BRS is a simple, easy-to-carry-out, and accessible rating scale to locate pharyngeal retention on videofluoroscopic images with a good specificity and reproducibility for observers of different expertise levels.

Download Full-text

ASSESSMENT OF PERFORMANCE AND IMPLEMENTATION CHARACTERISTICS OF RAPID POINT OF CARE SARS-CoV-2 ANTIGEN TESTING IN KENYA

10.1101/2021.06.03.21258290 ◽

2021 ◽

Author(s):

Jesse Gitaka ◽

Eva Muthamia ◽

Samuel Mbugua ◽

Mary Mungai ◽

Gama Bandawe ◽

...

Keyword(s):

Confidence Interval ◽

Test Performance ◽

Gold Standard ◽

Point Of Care ◽

Turnaround Time ◽

Ease Of Use ◽

Control Measures ◽

Antigen Test ◽

Rt Pcr ◽

Predictive Values

Abstract Background: The COVID-19 pandemic has resulted in a need for rapid identification of infectious cases. Testing barriers have prohibited adequate screening for SARS COV2, resulting in significant delays in treatment provision and commencement of outbreak control measures. This study aimed to generate evidence on the performance and implementation characteristics of the BD Veritor rapid antigen test as compared to the gold standard test for diagnosis of SARS COV2 in Kenya. Methods: This was a field test performance evaluation in symptomatic and asymptomatic adults undergoing testing for SARS COV2. Recruited participants were classified as SARS-CoV2-positive based on the locally implemented gold standard reverse transcription polymerase chain reaction (RT-PCR) test performed on nasopharyngeal swabs. 272 antigen tests were performed with simultaneous gold standard testing, allowing us to estimate sensitivity, specificity, positive and negative predictive values for the BD Veritor rapid antigen test platform. Implementation characteristics were assessed using the Consolidated Framework for Implementation Research for feasibility, acceptability, turn-around time, and ease-of-use metrics. Results and Discussion: We enrolled 97 PCR negative symptomatic and 128 PCR negative asymptomatic, and 28 PCR positive symptomatic and 19 PCR positive asymptomatic participants. Compared to the gold standard, the sensitivity of the BD Veritor antigen test was 94% (95% confidence interval [CI] 86.6 to 100.0) while the specificity was 98% (95% confidence interval [CI] 96 to 100). The sensitivity of BD Veritor antigen test was higher among symptomatic (100%) compared to asymptomatic (84%) participants, although this difference was not statistically significant. There was also a lack of association between cycle threshold value and sensitivity of BD Veritor test. The BD Veritor test had quick turnaround time and minimal resource requirements, and laboratory personnel conducting testing felt that it was easier to use than the gold standard RT-PCR. Conclusion: The BD Veritor rapid antigen test exhibited excellent sensitivity and specificity when used to detect SARS-CoV-2 infection among both symptomatic and asymptomatic individuals in varied population settings in Kenya. It was feasible to implement and easy to use, with rapid turnaround time.

Download Full-text

Antibodies and antibody-derived analytical biosensors

Essays in Biochemistry ◽

10.1042/ebc20150002 ◽

2016 ◽

Vol 60 (1) ◽

pp. 9-18 ◽

Cited By ~ 91

Author(s):

Shikha Sharma ◽

Hannah Byrne ◽

Richard J. O'Kennedy

Keyword(s):

Illicit Drugs ◽

Point Of Care ◽

High Specificity ◽

Biological Warfare ◽

Rapid Diagnostics ◽

Timely Initiation ◽

Specificity And Sensitivity ◽

Appropriate Treatment ◽

Biological Warfare Agents ◽

Warfare Agents

The rapid diagnosis of many diseases and timely initiation of appropriate treatment are critical determinants that promote optimal clinical outcomes and general public health. Biosensors are now being applied for rapid diagnostics due to their capacity for point-of-care use with minimum need for operator input. Antibody-based biosensors or immunosensors have revolutionized diagnostics for the detection of a plethora of analytes such as disease markers, food and environmental contaminants, biological warfare agents and illicit drugs. Antibodies are ideal biorecognition elements that provide sensors with high specificity and sensitivity. This review describes monoclonal and recombinant antibodies and different immobilization approaches crucial for antibody utilization in biosensors. Examples of applications of a variety of antibody-based sensor formats are also described.

Download Full-text

Glycoprotein- and Lectin-Based Approaches for Detection of Pathogens

Pathogens ◽

10.3390/pathogens9090694 ◽

2020 ◽

Vol 9 (9) ◽

pp. 694

Author(s):

Sammer-ul Hassan ◽

Ahmed Donia ◽

Usman Sial ◽

Xunli Zhang ◽

Habib Bokhari

Keyword(s):

Infectious Diseases ◽

Point Of Care ◽

Healthcare Providers ◽

Basic Research ◽

High Specificity ◽

Cost Effective ◽

Emerging Diseases ◽

Public Healthcare ◽

Point Of Use ◽

Specificity And Sensitivity

Infectious diseases alone are estimated to result in approximately 40% of the 50 million total annual deaths globally. The importance of basic research in the control of emerging and re-emerging diseases cannot be overemphasized. However, new nanotechnology-based methodologies exploiting unique surface-located glycoproteins or their patterns can be exploited to detect pathogens at the point of use or on-site with high specificity and sensitivity. These technologies will, therefore, affect our ability in the future to more accurately assess risk. The critical challenge is making these new methodologies cost-effective, as well as simple to use, for the diagnostics industry and public healthcare providers. Miniaturization of biochemical assays in lab-on-a-chip devices has emerged as a promising tool. Miniaturization has the potential to shape modern biotechnology and how point-of-care testing of infectious diseases will be performed by developing smart microdevices that require minute amounts of sample and reagents and are cost-effective, robust, and sensitive and specific. The current review provides a short overview of some of the futuristic approaches using simple molecular interactions between glycoproteins and glycoprotein-binding molecules for the efficient and rapid detection of various pathogens at the point of use, advancing the emerging field of glyconanodiagnostics.

Download Full-text