scholarly journals A Dual Point-of-Care Test Shows Good Performance in Simultaneously Detecting Nontreponemal and Treponemal Antibodies in Patients With Syphilis: A Multisite Evaluation Study in China

2012 ◽  
Vol 56 (5) ◽  
pp. 659-665 ◽  
Author(s):  
Yue-Ping Yin ◽  
Xiang-Sheng Chen ◽  
Wan-Hui Wei ◽  
Kuang-Long Gong ◽  
Wen-Ling Cao ◽  
...  
PLoS ONE ◽  
2012 ◽  
Vol 7 (2) ◽  
pp. e32122 ◽  
Author(s):  
Jannie J. van der Helm ◽  
Leslie O. A. Sabajo ◽  
Antoon W. Grunberg ◽  
Servaas A. Morré ◽  
Arjen G. C. L. Speksnijder ◽  
...  

2017 ◽  
Vol 4 (10) ◽  
pp. e442-e448 ◽  
Author(s):  
Karl-Günter Technau ◽  
Louise Kuhn ◽  
Ashraf Coovadia ◽  
Pamela M Murnane ◽  
Gayle Sherman

2018 ◽  
Vol 14 (3) ◽  
pp. 229-240
Author(s):  
Johanna Lindell

As antibiotic resistance becomes a growing health emergency, effective strategies are needed to reduce inappropriate antibiotic use. In this article, one such strategy – communicative practices associated with the C-reactive protein point-of care test – is investigated. Building on a collection of 31 videorecorded consultations from Danish primary care, and using conversation analysis, this study finds that the rapid test can be used throughout the consultation to incrementally build the case for a nonantibiotic treatment recommendation, both when the test result is forecast and reported. The study also finds that the format of reports of elevated results differs from that of ‘normal’ results, resulting in a subtle shift of authority from doctor to test.


Author(s):  
Tobias Broger ◽  
Bianca Sossen ◽  
Elloise du Toit ◽  
Andrew D. Kerkhoff ◽  
Charlotte Schutz ◽  
...  

2020 ◽  
Vol 79 (Suppl 1) ◽  
pp. 946.1-946
Author(s):  
S. Dauth ◽  
M. Köhm ◽  
T. Oberwahrenbrock ◽  
U. Henkemeier ◽  
T. Rossmanith ◽  
...  

Background:Rheumatoid Arthritis (RA) is a chronic inflammatory joint disease. Strategies for its early detection and diagnosis are of high importance as prompt treatment improves clinical and structural outcome. Autoantibodies against cyclic citrullinated proteins (anti-CCP) have been associated with RA-development. Non-specific musculoskeletal (nsMSK) symptoms are often described prior to RA development. Majority of patients with nsMSK symptoms present to their general practice (GP) first. Studies of early arthritis cohorts have shown that many early arthritis patients cannot be accurately diagnosed at their first visit and are often referred as undifferentiated arthritis patients.Objectives:To evaluate the incidence of anti-CCP positivity in patients with new onset of nsMSK symptoms and the incidence of RA in these patients over a 3-year follow-up period compared to anti-CPP negative patients.Methods:In this prospective study (PANORA), 978 patients with new onset of nsMSK symptoms were included in 77 GP sites in Germany. Patients with a positive anti-CCP rapid-test (CCPoint®) were referred to Rheumatology Department (RD) for rheumatological assessment, RA-evaluation and an anti-CCP validation test (ELISA). ELISA anti-CCP positive patients without RA were monitored every 6 months for a total follow-up of 36 months or until RA-diagnosis. Patients with a negative anti-CPP result (CCPoint® or ELISA) are followed up with a questionnaire after 1 and 3 y.Results:From 978 included patients, 105 (10.7%) were CCPoint® positive. 96 were tested with ELISA and 27 (28.1%) were confirmed anti-CCP positive. 9 (33.3%) were diagnosed with RA at the first RD visit (study visit 2); 4 further patients were diagnosed with RA during the follow-up (FU) period so far. Overall, 48.1% of ELISA-positive (ELISA+) patients were diagnosed with RA up to now; 11 ELISA+ patients are still in the FU period of the study. Of the 868 CCPoint® negative patients, currently, 282 have filled out a 1-year FU questionnaire; 3.5% of those reported a RA diagnosis (Table 1). As expected, clinical parameters at V2 (e.g. CRP, swollen and tender joint count) were worse in the ELISA+/RA+ group compared to the ELISA-/RA- group, but no obvious differences were detected between ELISA+ patients who were diagnosed with RA during the FU period (after V2) and ELISA-/RA- patientsTable 1.Number and percentage of patients with a RA diagnosisAnti-CCP statusVisit 2Follow-up*TotalPoint-of-Care Test --3.5% (10 of 282)#3.5% (10 of 282)#Point-of-Care Test + / ELISA -2.9% (2 of 69)0% (0 of 34)#2.9% (2 of 69)Point-of-Care Test + / ELISA +33.3% (9 of 27)14.8% (4 of 27)48.1% (13 of 27)$* 1 year-questionnaire for Point-of-Care Test and ELISA negative patients or every 6 months follow-up for ELISA positive patients;#Patient-reported;$11 patients are still in the follow-up phase of the studyConclusion:Currently, 48.1% of anti-CCP+ (ELISA) patients have received a RA diagnosis, whereas 3.5% of the anti-CCP- (CCPoint®) received a RA diagnosis (patient reported), which underlines, that anti-CCP can be used as a marker to identify high-risk patients in GP setting. While clinical parameters are correlated with the diagnosis of RA, they are not suited for predicting future RA development alone. Anti-CCP, possibly in combination with additional parameters imaging, might increase the likelihood to early diagnose or predict RA development.Figure 1.Study overview: Patient distribution depending on anti-CCP results and RA diagnosis.Disclosure of Interests:Stephanie Dauth Grant/research support from: BMS, Michaela Köhm Grant/research support from: Pfizer, Janssen, BMS, LEO, Consultant of: BMS, Pfizer, Speakers bureau: Pfizer, BMS, Janssen, Novartis, Timm Oberwahrenbrock Grant/research support from: BMS, Ulf Henkemeier: None declared, Tanja Rossmanith Grant/research support from: Janssen, BMS, LEO, Pfizer, Karola Mergenthal Grant/research support from: BMS, Juliana J. Petersen Grant/research support from: BMS, Harald Burkhardt Grant/research support from: Pfizer, Roche, Abbvie, Consultant of: Sanofi, Pfizer, Roche, Abbvie, Boehringer Ingelheim, UCB, Eli Lilly, Chugai, Bristol Myer Scripps, Janssen, and Novartis, Speakers bureau: Sanofi, Pfizer, Roche, Abbvie, Boehringer Ingelheim, UCB, Eli Lilly, Chugai, Bristol Myer Scripps, Janssen, and Novartis, Frank Behrens Grant/research support from: Pfizer, Janssen, Chugai, Celgene, Lilly and Roche, Consultant of: Pfizer, AbbVie, Sanofi, Lilly, Novartis, Genzyme, Boehringer, Janssen, MSD, Celgene, Roche and Chugai


2021 ◽  
Vol 7 (3) ◽  
pp. 233
Author(s):  
Philipp Foessleitner ◽  
Herbert Kiss ◽  
Julia Deinsberger ◽  
Julia Ott ◽  
Lorenz Zierhut ◽  
...  

Pregnant women have an increased risk of vulvovaginal candidosis. Recurrent candidosis is under debate as a contributor to preterm birth, and vertical transmission may cause diaper dermatitis and oral thrush in the newborn. Apart from cultural methods, the gold standard for diagnosing candidosis is Gram staining, which is time-consuming and requires laboratory facilities. The objective of this prospective study was to validate a point-of-care vaginal yeast detection assay (SavvyCheckÔ Vaginal Yeast Test) and to evaluate it in asymptomatic pregnant women. We enrolled 200 participants, 100 of whom had vulvovaginal candidosis according to Gram stain (study group) and 100 were healthy pregnant controls (control group). Of these, 22 participants (11%) had invalid test results. The point-of-care test of the remaining 85 and 93 study participants in the study and control groups, respectively, showed a sensitivity of 94.1%, specificity of 98.9%, positive predictive value of 90.3%, and negative predictive value of 99.4% when compared with Gram stain. In conclusion, we found a high correlation between the SavvyCheckÔ Vaginal Yeast Test and Gram-stained smears during pregnancy. This suggests a potential role of this point-of-care test as a screening tool for asymptomatic pregnant women in early gestation.


2021 ◽  
pp. 1098612X2110230
Author(s):  
Kyrsten J Janke ◽  
Linda S Jacobson ◽  
Jolene A Giacinti ◽  
J Scott Weese

Objectives The aims of this study were to determine the magnitude and duration of fecal viral DNA shedding after diagnosis of feline panleukopenia (FP) in a group of shelter cats using quantitative real-time PCR (qPCR); to assess the utility of a negative point-of-care test or the resolution of diarrhea and systemic signs as proxy measures for qPCR positivity; and to investigate patterns of additional enteric pathogens in relation to feline panleukopenia viral shedding duration. Methods Feline panleukopenia virus (FPV) infection in clinically affected shelter cats was confirmed by a commercial qPCR test. Observations were made on days 0, 3, 7, 14 and 21 post-diagnosis. Fecal flotation, FPV qPCR and the canine parvovirus IDEXX SNAP Parvo ELISA (SNAP) test were performed on fecal samples. Results Forty cats and kittens with confirmed panleukopenia were initially enrolled. Sixteen kittens were sampled until day 14, and 12 were followed to day 21. Median DNA viral copy numbers fell below the diagnostic cut-off by day 7, with 13/16, 6/16, 1/16 and 0/12 testing PCR-positive on days 3, 7, 14 and 21, respectively. The SNAP test was positive in 12/16 kittens on day 0 and only 3/16 on day 3. SNAP test results, diarrhea and systemic signs were inconsistent in relation to qPCR positivity post-diagnosis. Additional enteric pathogens were common. The presence of additional pathogen types was suggestive of a longer PCR shedding duration, but this was not tested statistically owing to the small sample size. Conclusions and relevance These findings suggest that cats should be isolated for at least 14 days after a diagnosis of FP, but that release from isolation after this point is reasonable, in association with a multifaceted infection control strategy. The study findings did not support using SNAP test results, diarrhea or systemic signs as proxy measures for virus shedding.


2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.


Sign in / Sign up

Export Citation Format

Share Document