scholarly journals Congenital Malaria in Newborns Delivered to Mothers with Malaria-Infected Placenta in Blue Nile State, Sudan

2020 ◽  
Vol 66 (4) ◽  
pp. 428-434
Author(s):  
Samia A Omer ◽  
Ishag Adam ◽  
Ali Noureldien ◽  
Hadeel Elhaj ◽  
Laura Guerrero-Latorre ◽  
...  
Keyword(s):  
Cord Blood ◽  
Real Time ◽  
Real Time Pcr ◽  
Peripheral Blood ◽  
Molecular Techniques ◽  
Blue Nile ◽  
Blood Smears ◽  
Polymerase Chain ◽  
Thick Smear ◽  
Congenital Malaria

Abstract Diagnosis of congenital malaria is complicated by the low density of the parasite circulating in the cord blood and/or the peripheral blood of the newborns. Molecular techniques are significantly more sensitive than blood smears in detecting low-level parasitemia. This study investigated the prevalence of congenital malaria by the use of the real-time polymerase chain reaction (real-time PCR) in 102 babies born to mothers with microscopically confirmed infected placenta from Blue Nile state, Sudan. At delivery time, placental, maternal peripheral and cord blood samples in addition to samples collected from the newborns’ peripheral blood were examined for malaria infection using Giemsa-stained thick smear and parasite DNA detection by real-time PCR. The overall prevalence of congenital malaria includes the total babies with cord blood parasitaemia and peripheral blood parasitaemia was 18.6 and 56.8% using microscopy and real-time PCR, respectively. Even though all the neonates were aparasitaemic by microscopy, 19 (18.6%) of the babies had congenital malaria detected by real-time PCR, 15 (25.9%) of the babies with congenital malaria were born to mothers with both placental and peripheral blood malaria infections detected using the two techniques. Congenital malaria was significantly associated with cord blood malaria infections, maternal age and maternal haemoglobin level (p < 0.001). This first study investigating congenital malaria in Blue Nile state, Sudan shows that malaria-infected placenta resulted in infant and cord blood infections.

scholarly journals Real-Time Polymerase Chain Reaction for One-Hour On-Site Diagnosis of Pierce's Disease of Grape in Early Season Asymptomatic Vines

2002 ◽  
Vol 92 (7) ◽  
pp. 721-728 ◽  
Author(s):  
N. W. Schaad ◽  
D. Opgenorth ◽  
P. Gaush
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Xylella Fastidiosa ◽  
Molecular Techniques ◽  
Plant Diseases ◽  
Pierce's Disease ◽  
Chain Reaction ◽  
Pierce’S Disease ◽  
Polymerase Chain

Molecular-based techniques, such as polymerase chain reaction (PCR), can reduce the time needed for diagnosis of plant diseases when compared with classical isolation and pathogenicity tests. However, molecular techniques still require 2 to 3 days to complete. To the best of our knowledge, we describe for the first time a real-time PCR technique using a portable Smart Cycler for one-hour on-site diagnosis of an asymptomatic plant disease. Pierce's disease (PD) of grape, caused by the fastidious bacterium Xylella fastidiosa, causes serious losses in grapes in California and the southeastern United States. The disease has been difficult to diagnose because typical leaf scorching symptoms do not appear until late (June and after) in the season and the organism is very difficult to isolate early in the season. Sap and samples of macerated chips of secondary xylem from trunks of vines were used in a direct real-time PCR without extraction of DNA. Using two different sets of primers and probe, we diagnosed PD in 7 of 27 vines (26%) from four of six vineyards sampled 10 to 12 days after bud break in Kern, Tulare, and Napa counties of California. The diagnosis was confirmed by isolation of Xylella fastidiosa from two of the original PCR positive samples and later from symptomatic leaf petioles of four out of four vines from one vineyard that were originally PCR positive.

Diagnosis and Causative Species of Visceral Leishmaniasis in Southwest Saudi Arabia

2021 ◽  
Author(s):  
Aymen Abdelhaleem ◽  
Nabil Dhayhi ◽  
Mohamed Salih Mahfouz ◽  
Ommer Daffalla ◽  
Mansour Mubarki ◽  
...  
Keyword(s):  
Saudi Arabia ◽  
Visceral Leishmaniasis ◽  
Real Time ◽  
Real Time Pcr ◽  
Leishmania Donovani ◽  
Target Genes ◽  
Sample Volume ◽  
Pcr Products ◽  
Polymerase Chain ◽  
Robust Evidence

Visceral leishmaniasis (VL) is the most severe clinical form of the disease and has been reported in the Jazan region of southwest Saudi Arabia. This study aimed to diagnose VL by real-time polymerase chain reaction (PCR) and the direct agglutination test (DAT) and to identify the causative Leishmania species. A total of 80 participants, including 30 suspected VL patients, 30 healthy endemic control individuals, and 20 malaria disease controls, were enrolled in this study. Blood samples were collected and tested for Leishmania DNA by real-time PCR and for antibody by the DAT. Sequencing of some amplified PCR products was used to identify the causative Leishmania species. The diagnosis of VL was successfully achieved by both real-time PCR and by DAT with 100% sensitivity. Leishmania donovani and Leishmania infantum species were detected by sequencing both by the kDNA and ITS1 target genes, followed a BLASTn search. The detection of VL antibody by the DAT followed by the confirmatory detection of Leishmania DNA in patient blood by PCR could promote the adoption of the much less invasive and more sensitive methods for the routine diagnosis of VL. Further study with high sample volume to evaluate the PCR and the DAT are needed, to generate more robust evidence. Based on the sequencing results, emerging studies on VL should focus on the causative Leishmania species, reservoirs, and vectors that are important in the study area.

scholarly journals Detection of Peanut Allergen Traces with a Real Time PCR Assay - The Challenge to Protect Food-Allergic Consumers

2017 ◽  
Vol 7 (1) ◽  
pp. 32 ◽  
Author(s):  
Dimitra Houhoula ◽  
Stamatios Koussissis ◽  
Vladimiros Lougovois ◽  
John Tsaknis ◽  
Dimitra Kassavita ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Rapid Detection ◽  
Food Products ◽  
Molecular Techniques ◽  
Food Allergens ◽  
Pcr Assay ◽  
Peanut Allergen ◽  
Pcr Method ◽  
Detection And Quantification

The aim of the present study was the implementation of molecular techniques in the detection and quantification of allergic substances of peanut in various kinds of food products, e.g., breakfast cereals, chocolates and biscuits that are frequently related to allergies. In some cases, the presence of peanuts can be due to contamination during production and are not declared on the label. A total of 152 samples were collected from supermarkets and were analysed by a Real Time PCR method. The results indicated that 125 samples (83,3%) were found positive in peanut traces but the most important finding is that from the 84 samples that had no allergen declaration for peanuts, 48 (57,1%) of them were found positive. In conclusion, Real Time PCR can be a very important tool for the rapid detection and quantification of food allergens.

scholarly journals Detection of β-Herpesviruses in Polish Adult Cord Blood Stem Cell Recipients by Real-Time PCR: Single Centre Study

2010 ◽  
Vol 58 (6) ◽  
pp. 467-472
Author(s):  
Tomasz Dzieciątkowski ◽  
Maciej Przybylski ◽  
Grzegorz Władysław Basak ◽  
Tigran Torosian ◽  
Agnieszka Tomaszewska ◽  
...  
Keyword(s):  
Stem Cell ◽  
Cord Blood ◽  
Real Time ◽  
Real Time Pcr ◽  
Blood Stem Cell ◽  
Single Centre ◽  
Centre Study ◽  
Cord Blood Stem Cell ◽  
Single Centre Study

scholarly journals DETEKSI CLOSTRIDIUM DIFFICILE TOKSIGENIK MENGGUNAKAN UJI CEPAT TOKSIN DAN REAL TIME POLYMERASE CHAIN REACTION (Toxigenic Clostridium Difficile Detection Using Toxin Rapid Test and Real Time Polymerase Chain Reaction)

2018 ◽  
Vol 22 (1) ◽  
pp. 22
Author(s):  
Ika Yasma Yanti ◽  
Dalima Ari Wahono Astrawinata
Keyword(s):  
Polymerase Chain Reaction ◽  
Clostridium Difficile ◽  
Antibiotic Therapy ◽  
Real Time ◽  
Real Time Pcr ◽  
Rapid Test ◽  
Chain Reaction ◽  
Chi Square ◽  
Polymerase Chain ◽  
Clostridium Difficile Associated Diarrhea

Toxigenic Clostridium difficile infection, causing a Pseudo Membrane Colitis (PMC) and Clostridium Difficile Associated Diarrhea(CDAD) has increased sharply. The largest risk factor is the use of antibiotics. The purpose of this study was to know how to determinethe prevalence and characteristics of subjects with Toxigenic Clostridium difficile and to assess the ability of the toxin rapid test comparedto real-time PCR. Ninety adult subjects with antibiotic therapy more than two (2) weeks were enrolled in this study. The results of toxinrapid test and real-time PCR were presented in a 2x2 table, statistical test used was Chi square. The prevalence of Toxigenic Clostridiumdifficile based on the toxin rapid test and by real-time PCR was 27.3% and 37.5%, respectively. There were significant differences betweenstool consistency and number of antibiotics used with the detection of Toxigenic Clostridium difficile. There was a relationship betweenthe duration of antibiotic therapy with the detection of Toxigenic Clostridium difficile using real-time PCR (p=0.010, RR=2.116). Thesensitivity, specificity, PPV, NPV, PLR and NLR rapid test against real-time PCR were 69.7%; 98.2%; 95.8%; 84.4%; 39.2 and 0.31,respectively. This study concluded that the prevalence of Clostridium difficile in RSCM was higher compared to that in Malaysia, Thailandand India; the subjects with antibiotic therapy for more than four (4) weeks had a double risk to have Toxigenic Clostridium difficilethan subjects with antibiotic therapy for less than that time (4 weeks). Thus, in this study, toxin rapid test could be used as a tool todetect Toxigenic Clostridium difficile.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Sign in / Sign up

Export Citation Format

Share Document