scholarly journals Development of Diagnostic SCAR Markers for Meloidogyne graminicola, M. oryzae, and M. salasi Associated with Irrigated Rice Fields in Americas

Plant Disease ◽  
2019 ◽  
Vol 103 (1) ◽  
pp. 83-88 ◽  
Author(s):  
Vanessa da Silva Mattos ◽  
Karine Mulet ◽  
Juvenil Enrique Cares ◽  
Cesar Bauer Gomes ◽  
Diana Fernandez ◽  
...  
Keyword(s):  
Oryza Sativa L ◽  
Random Amplified Polymorphic Dna ◽  
Rice Fields ◽  
Correct Identification ◽  
Scar Markers ◽  
Irrigated Rice ◽  
Meloidogyne Graminicola ◽  
The World ◽  
Meloidogyne Spp ◽  
Meloidogyne Sp

Root-knot nematodes (RKN) cause important production losses of rice (Oryza sativa L.) in the world. Together with Meloidogyne graminicola Golden and Birchfield 1965, M. oryzae Maas, Sanders and Dede, 1978 and M. salasi López, 1984 have been causing damages in irrigated rice fields in Central and South America. In addition, six other RKN species may occur in rice fields in other regions of the world. Correct identification of Meloidogyne spp. is difficult but essential for the management of rice RKNs. The objective of this study was to develop some species-specific molecular markers for the diagnosis of South American RKN rice-related species. Isozyme phenotypes indicated the occurrence of some RKN species in the Brazilian samples, namely M. graminicola, M. oryzae, M. javanica, and two cryptic species designated as Meloidogyne sp. 2 and Meloidogyne sp. 3. Random amplified polymorphic DNA (RAPD) analysis of 16 isolates revealed interspecific genetic polymorphism between Meloidogyne spp., but isolates belonging to the same species (i.e., sharing the same esterase phenotype) always clustered together, whatever the species considered. Specific SCAR markers of 230, 120, and 160 bp were developed for M. graminicola, M. oryzae, and M. salasi, respectively. These SCAR markers may be potential molecular tools for application in routine diagnostic procedures subject to their validation with other rice RKN field populations in the world.

scholarly journals Meloidogyne graminicola—A Threat to Rice Production: Review Update on Distribution, Biology, Identification, and Management

Biology ◽  
2021 ◽  
Vol 10 (11) ◽  
pp. 1163
Author(s):  
Leidy Rusinque ◽  
Carla Maleita ◽  
Isabel Abrantes ◽  
Juan E. Palomares-Rius ◽  
Maria L. Inácio
Keyword(s):  
Oryza Sativa L ◽  
Rice Production ◽  
World Population ◽  
The European Union ◽  
Low Oxygen ◽  
Irrigated Rice ◽  
Lombardy Region ◽  
Meloidogyne Graminicola ◽  
Meloidogyne Spp ◽  
The Impact

Rice (Oryza sativa L.) is one of the main cultivated crops worldwide and represents a staple food for more than half of the world population. Root-knot nematodes (RKNs), Meloidogyne spp., and particularly M. graminicola, are serious pests of rice, being, probably, the most economically important plant-parasitic nematode in this crop. M. graminicola is an obligate sedentary endoparasite adapted to flooded conditions. Until recently, M. graminicola was present mainly in irrigated rice fields in Asia, parts of the Americas, and South Africa. However, in July 2016, it was found in northern Italy in the Piedmont region and in May 2018 in the Lombardy region in the province of Pavia. Following the first detection in the EPPO region, this pest was included in the EPPO Alert List as its wide host range and ability to survive during long periods in environments with low oxygen content, represent a threat for rice production in the European Union. Considering the impact of this nematode on agriculture, a literature review focusing on M. graminicola distribution, biology, identification, and management was conducted.

scholarly journals Prevalence of plant-parasitic nematodes in rice fields in Ghana

1970 ◽  
Vol 29 (4) ◽  
pp. 471-482
Author(s):  
S.T. Nyaku ◽  
H. Lutuf ◽  
J.O. Honger ◽  
A. Dede ◽  
F.C. Brentu ◽  
...  
Keyword(s):  
Oryza Sativa L ◽  
Rice Fields ◽  
Sub Saharan Africa ◽  
Research Centre ◽  
Parasitic Nematodes ◽  
Eastern Region ◽  
Plant Parasitic Nematodes ◽  
Meloidogyne Spp ◽  
Volta Region ◽  
Plant Parasitic

Rice (Oryza sativa L.) is one of the most cultivated crops worldwide whose production in sub-Saharan Africa is extensively affected by root nematodes. The objective of this study was to identify and establish the distribution of plant-parasitic nematodes (PPNs), in rice growing fields within different regions of Ghana. Soil and root samples were taken from rice fields, namely fourteen from Volta Region, eleven from the Soil and Irrigation Research Centre (SIREC), Kpong (Eastern Region); and five from Dawhenya (Greater Accra Region). The soil samples were taken from 0-30 cm depths, together with root samples. A total of twenty-four nematode genera were identified in soil and root samples from the three regions. These included: Aphelenchus spp., Belonolaimus spp., Ditylenchus spp., Dolichodorus spp., Helicotylenchus spp., Hemicriconemoides spp. Hemicycliophora spp. Heterodera spp., Hirschmaniella spp., Hoplolaimus spp., Longidorus spp., Meloidogyne spp., Paralongidorous spp., Paratylenchus spp., Pratylenchus spp., Radopholus spp., Rhabditida spp., Rotylenchulus spp., Scutellonema spp., Trichodorus spp., Tylenchornchus spp., Tylenchulus spp., Tylenchus spp. and Xiphinema spp. In the Volta Region, Tylenchus spp. was the most abundant (29.01%) in the soil; while Meloidogyne spp. was most the abundant (36.86%) in the roots. In Dawhenya regions, Meloidogyne spp. was the most abundant (26.96%) in the soil; while Tylenchus spp. was the most abundant (25.94%) in the roots. In the Eastern Region, Meloidogyne spp. was the most abundant (41.7%) in the soil; while Pratylenchus spp. was the most abundant (36.1%) in the roots. These nematodes threaten rice production in Ghana, if not managed well in farmer’s fields.

scholarly journals Ketahanan Enam Varietas Padi Terhadap Penyakit Blas (Pyricularia oryzea Cav.) pada Lahan Sawah Irigasi dan Sawah Tadah Hujan

2020 ◽  
Vol 16 (2) ◽  
pp. 147-156
Author(s):  
Christoffol Leiwakabessy ◽  
Fahra Inayatri ◽  
Edizon Jambormias ◽  
Jogeneis Patty ◽  
Rhony E Ririhena
Keyword(s):  
Oryza Sativa ◽  
Oryza Sativa L ◽  
The Philippines ◽  
Rice Fields ◽  
Blast Disease ◽  
Resistant Variety ◽  
Irrigated Rice ◽  
Resistant Varieties ◽  
Rainfed Lowland ◽  
Moderate Resistance

Rice (Oryza sativa L) is an economically important carbohydrate-producing plant that ranks second only to wheat. In Indonesia, Malaysia, the Philippines, and several other countries, rice is used as a staple food source. The commodity projection is expected in the coming years to grow to reach 70 percent. Blast disease is known as one of the main obstacles in rice cultivation today. Recommended control alternative to the disease was through the utilization of economically beneficial and environmentally friendly resistant varieties. The study used six varieties tested on different cultivated land and designed using a split plot experiment. The results showed that the resistance of the six varieties of rice to blast disease, with the criteria from susceptible to resistance was: Kabir07 (5%) and IPB8G (3%) classified as susceptible, followed by IPB9G 1.8% (moderate resistance), Inpari32 1.8% (moderate resistant), Fas Memeye 1.8% (moderate resistant), and IPB3S 1.2% (resistant). The study found that irrigated rice fields had a higher severity of blast disease than rain-fed rice fields. Keywords: blast disease, resistant variety, rice fields irrigated, rice rainfed lowland   ABSTRAK Padi (Oryza sativa L) adalah tanaman penghasil karbohidrat penting secara ekonomi yang menempati peringkat kedua setelah gandum. Di Indonesia, Malaysia, Filipina, dan beberapa negara lain, padi digunakan sebagai sumber makanan pokok. Proyeksi komoditas tersebut diharapkan pada tahun-tahun mendatang tumbuh mencapai 70 persen. Penyakit blas dikenal sebagai salah satu kendala utama dalam budidaya padi saat ini. Alternatif yang direkomendasikan untuk pengendalian terhadap penyakit ini adalah melalui varietas tahan yang bermanfaat secara ekonomi dan ramah lingkungan. Penelitian bertujuan mengevaluasi ketahanan enam varietas padi pada lahan padi sawah dan sawah tadah hujan terhadap penyakit blas. Penelitian ini menggunakan enam varietas diuji pada lahan budidaya yang berbeda dan dirancang menggunakan percobaan petak terpisah. Hasil penelitian menunjukkan bahwa tingkat ketahanan keenam varietas padi terhadap penyakit blas, dengan kriteria dari rentan sampai tahan adalah: Kabir07 (5%) dan IPB8G (3%) tergolong rentan, diikuti oleh IPB9G 1,8% (moderat tahan), Inpari32 1,8% (moderat tahan), Fas Memeye 1,8% (moderat tahan), dan IPB3S 1,2% (tahan). Ditemukan bahwa lahan sawah irigasi memiliki keparahan penyakit blas lebih tinggi dibandingkan dengan sawah tadah hujan. Kata kunci: penyakit blas, sawah tadah hujan, sawah irigasi, varietas resisten

Pengaruh Konversi Lahan terhadap Strategi Pemanfaatan Modal Nafkah Rumah Tangga Buruh Tani

2020 ◽  
Vol 4 (3) ◽  
pp. 407
Author(s):  
Hesti Prastiwi ◽  
Martua Sihaloho
Keyword(s):  
Qualitative Data ◽  
Rice Fields ◽  
Livelihood Strategies ◽  
Quantitative Approach ◽  
Survey Method ◽  
Land Conversion ◽  
Literature Study ◽  
Irrigated Rice ◽  
Sustainable Food ◽  
The Impact

Lahan merupakan salah satu sumber daya agraria yang sangat penting bagi petani dikarenakan lahan merupakan salah satu sumber untuk bertahan hidup. Sesuai dengan Undang-Undang Dasar Nomor 41 Tahun 2009 tentang Perlindungan Lahan Pertanian Pangan Berkelanjutan. Pembangunan yang terjadi di Indonesia semakin masif, menimbulkan konversi lahan bersifat permanen ketika lahan sawah beririgasi berubah menjadi kawasan pemukiman atau industri. Konversi lahan yang terjadi menyebabkan hilangnya beberapa atau seluruh modal nafkah yang ada. Perubahan modal nafkah ini akan mengakibatkan perubahan strategi nafkah petani. Penelitian ini bertujuan untuk menganalisis dampak konversi lahan terhadap strategi nafkah dan pengaruh pemanfaatan  modal nafkah  terhadap strategi nafkah rumah tangga. Lokasi penelitian ini yaitu Desa Pasirgaok, Kecamatan Rancabungur, Kabupaten Bogor. Metode yang digunakan untuk menggali fakta, data, dan informasi dalam penelitian adalah pendekatan kuantitatif melalui metode survei dengan kuesioner yang didukung oleh data kualitatif melalui wawancara dan studi literatur hingga diperoleh hasil bahwa dampak konversi lahan mempengaruhi modal dan strategi nafkah.Kata Kunci: buruh tani, konversi lahan, modal nafkah, strategi nafkah=====ABSTRACTLand is one of the most important agrarian resources for farmers because land is one source of livelihood survival. According to Constitution Number 41 Year 2009 on concerning The Protection of Sustainable Food Agriculture. The development that is taking place in Indonesia is increasingly massive leading to permanent land conversion when technical irrigated rice fields change into residential or industrial areas. The land conversion that occurs causes a loss of some or all existing livelihood asset. This change in livelihood asset will result in a change in farmers livelihood strategies. This study aims to analyze the influence of the impact of land conversion towards livelihood strategies and the influence of the utilization of livelihood asset towards the livelihood strategies households. The location of this research is Pasirgaok Village, Rancabungur District, Bogor Regency. The method used to extract facts, data, and information in the research is the quantitative approach through survey method with questionnaires supported by qualitative data through interview and literature study until it is obtained that the impact of land conversion towards landless farmer household’s assets and livelihood strategies.Keywords: land conversion, landless farmer, livelihood asset, livelihood strategies

scholarly journals SNP and SCAR Markers for Specific Discrimination of Antler-Shaped Ganoderma lucidum

2019 ◽  
Vol 7 (1) ◽  
pp. 12 ◽  
Author(s):  
O-Chul Kwon ◽  
Chang-Soo Lee ◽  
Young-Jin Park
Keyword(s):  
Ganoderma Lucidum ◽  
Gene Sequence ◽  
Rapd Analysis ◽  
Random Amplified Polymorphic Dna ◽  
Morphological Characteristics ◽  
Pcr Analysis ◽  
Scar Markers ◽  
Nucleotide Polymorphism ◽  
Single Nucleotide ◽  
Specific Fragment

In this study we identified single nucleotide polymorphism (SNP) and sequence characteristic amplification region (SCAR) markers for specific identification of antler-shaped Ganoderma lucidum strains. When the partial mitochondrial SSU rDNA gene sequence of various antler- and kidney-shaped G. lucidum strains were analyzed and aligned, an SNP was found only in the antler-shaped G. lucidum strain at position 456 bp. In addition, this SNP of antler-shaped strains was digested by HinfI restriction enzyme. We further analyzed the polymorphism of various G. lucidum strains by random amplified polymorphic DNA (RAPD) analysis. In RAPD analysis, we isolated and sequenced a fragment, specific for antler-shaped G. lucidum strains. Based on this specific fragment sequence, two sets of specific primer pairs for antler-shaped G. lucidum strains were designed. PCR analysis revealed that two specific bands were observed only from antler-shaped strains. These two molecular markers will be helpful for identification of morphological characteristics of G. lucidum.

scholarly journals Leaching and residual activity of imidazolinone herbicides in lowland soils

2017 ◽  
Vol 47 (5) ◽  
Author(s):  
João Paulo Refatti ◽  
Luis Antonio de Avila ◽  
José Alberto Noldin ◽  
Igor Pacheco ◽  
Rodrigo Ribeiro Pestana
Keyword(s):  
Oryza Sativa L ◽  
Residual Activity ◽  
Underground Water ◽  
Soil Samples ◽  
Treatment Control ◽  
Irrigated Rice ◽  
Leaching Potential ◽  
Phytotoxic Activity ◽  
Lowland Area ◽  
Imidazolinone Herbicides

ABSTRACT: Herbicides used in the Clearfield® rice (Oryza sativa L.) production system have a potential for leaching. This can result in contamination of underground water resources and cause injury to not tolerant crops that are sown in a succession and/or crop rotation. The objective of this study was to determine the leaching potential and the residual activity of the herbicides used in the Clearfield® rice system. The experiment was conducted over a period of two years and consisted of conducting a field test to be followed by two bioassays with a year of difference between their implementation. Initially an experiment was conducted in lowland area where it was planted the cultivar of rice ‘PUITA INTA CL’. Approximately one and two years thereafter, soil samples from each plot were collected at intervals of 5cm to a depth of 30cm (B factor) for the bioassay to evaluate persistence of herbicides. Factor A was composed of mixtures formulated of imazethapyr + imazapic (75 + 25g a.i. L-1), imazapyr + imazapic (525 + 175g a.i. kg-1) in two doses, imazethapyr (100g a.i. L-1) and treatment control without application. Basing on results, it was concluded that the mixtures imazethapyr + imazapic, imazapyr + imazapic and imazethapyr leached into the soil, reaching depths of up to 25cm in lowland soil. Imidazolinone herbicides used today in the irrigated rice Clearfield® system are persistent in soil, and their phytotoxic activity can be observed up to two years after application.

scholarly journals Globe fringerush (Fimbristylis miliacea) cross resistance to als-inhibitor herbicides under field conditions in irrigated rice in the south of Brazil

2013 ◽  
Vol 31 (4) ◽  
pp. 893-902 ◽  
Author(s):  
C.E. Schaedler ◽  
J.A. Noldin ◽  
D.S. Eberhardt ◽  
D. Agostinetto ◽  
N.R. Burgos
Keyword(s):  
Grain Yield ◽  
Weed Control ◽  
Rice Fields ◽  
Field Conditions ◽  
Cross Resistance ◽  
Herbicide Application ◽  
The South ◽  
Santa Catarina ◽  
Irrigated Rice ◽  
South Of Brazil

ALS-inhibiting herbicides usually provide adequate weed control in irrigated rice fields. After consecutive years of use, the Cyperaceae species, globe fringerush (Fimbristylis miliacea) began to show resistance to ALS (acetolactate synthase) inhibitors. Globe fringerush is one of the most problematic herbicide-resistant weeds in irrigated rice in the state of Santa Catarina in the South of Brazil. The objective of this research was to examine cross resistance of globe fringerush to ALS inhibitors, under field conditions. Two experiments were conducted in a rice field naturally infested with ALS-resistant globe fringerush in Santa Catarina, in the 2008/09 and 2009/10 cropping seasons. The experimental units were arranged in randomized complete block design, with five replicates, consisting of two factors (herbicide and dose) in a 4 x 5 factorial arrangement. ALS herbicides included bispyribac-sodium, ethoxysulfuron, pyrazosulfuron-ethyl and penoxsulam. Six-leaf globe fringerush was sprayed with herbicide doses of 0, 0.5, 1, 2 and 4X the recommended doses in a spray volume of 200 L ha-1. The number of rice culm, filled and sterile grains, plant height, dry shoot biomass and grain yield were recorded. Globe fringerush control was evaluated 28 and 70 days after herbicide application (DAA); shoots were harvested at 13 weeks after herbicide application and dry weight recorded. Competition with globe fringerush reduced the number of culm and rice grain yield. The globe fringerush biotype in this field was resistant to all ALS herbicides tested. Penoxsulam had the highest level of activity among treatments at 28 and 70 DAA, but the control level was only 50% and 42%, respectively, in the second year of assessment. This was not enough to prevent rice yield loss. Alternative herbicides and weed control strategies are necessary to avoid yield losses in rice fields infested with ALS-resistant biotypes of globe fringerush.

scholarly journals First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 702-702 ◽  
Author(s):  
B. Gao ◽  
R. Y. Wang ◽  
S. L. Chen ◽  
X. H. Li ◽  
J. Ma
Keyword(s):  
Sweet Potato ◽  
Dna Sequences ◽  
Molecular Characteristics ◽  
28S Rrna ◽  
Storage Roots ◽  
Specific Primers ◽  
First Report ◽  
Meloidogyne Enterolobii ◽  
Meloidogyne Spp ◽  
Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals Manipulation of Chemical Properties in Soil under Wetland Rice through Industrial Effluents

2019 ◽  
pp. 1-15
Author(s):  
Md. Rafiqul Islam ◽  
Golam Kibria Muhammad Mustafizur Rahman ◽  
Md. Abu Saleque
Keyword(s):  
Electrical Conductivity ◽  
Organic Carbon ◽  
Carbon Content ◽  
Rice Field ◽  
Soil Depth ◽  
Chemical Properties ◽  
Industrial Effluents ◽  
Rice Fields ◽  
Organic Carbon Content ◽  
Irrigated Rice

A laboratory experiment was conducted in Soil Science Division of Bangladesh Rice Research Institute (BRRI) during 2010-11 aimed to determine the effects of different industrial effluents on some soil chemical properties under long-term industrial wastewater irrigated rice field. Effluents irrigation created some differences in soil pH, electrical conductivity and organic carbon. The pH in all soil depth was higher with wastewater irrigated rice field. Irrigation with wastewater increased in all the effluents irrigated rice fields; the electrical conductivity (EC) was remarkable higher with  all soil depth than the control field. In all the rice fields soil (Control + effluents irrigated fields), the organic carbon content (%) started to decrease sharply with the increase in soil depth. Organic carbon content was slightly higher with wastewater irrigated rice soils. Exchangeable cations (Ca, Mg, K and Na), trace elements (Zn, Fe, Mn and Cu) and heavy metals (Pb, Cd, Cr and Ni) were increased through irrigation with wastewater in rice–rice cropping pattern.

Sign in / Sign up

Export Citation Format

Share Document