scholarly journals Excision of IS492 Requires Flanking Target Sequences and Results in Circle Formation in Pseudoalteromonas atlantica

1999 ◽  
Vol 181 (16) ◽  
pp. 4937-4948 ◽  
Author(s):  
Donna Perkins-Balding ◽  
Guy Duval-Valentin ◽  
Anna C. Glasgow
Keyword(s):  
Insertion Site ◽  
Extracellular Polysaccharide ◽  
Inverse Pcr ◽  
Target Sequence ◽  
Sequence Element ◽  
E Coli ◽  
Precise Excision ◽  
Circular Form ◽  
Pseudoalteromonas Atlantica ◽  
Circle Formation

ABSTRACT The gram-negative marine bacterium Pseudoalteromonas atlantica produces extracellular polysaccharide (EPS) that is important in biofilm formation by this bacterium. Insertion and precise excision of IS492 at a locus essential for extracellular polysaccharide production (eps) controls phase variation of EPS production in P. atlantica. Examination of IS492 transposition in P. atlantica by using a PCR-based assay revealed a circular form of IS492 that may be an intermediate in transposition or a terminal product of excision. The DNA sequence of the IS492 circle junction indicates that the ends of the element are juxtaposed with a 5-bp spacer sequence. This spacer sequence corresponds to the 5-bp duplication of the chromosomal target sequence found at all IS492insertion sites on the P. atlantica chromosome that we identified by using inverse PCR. IS492 circle formation correlated with precise excision of IS492 from the P. atlantica eps target sequence when introduced intoEscherichia coli on a plasmid. Deletion analyses of the flanking host sequences at the eps insertion site for IS492 demonstrated that the 5-bp duplicated target sequence is essential for precise excision of IS492 and circle formation in E. coli. Excision of IS492 inE. coli also depends on the level of expression of the putative transposase, MooV. A regulatory role for the circular form of IS492 is suggested by the creation of a new strong promoter for expression of mooV by the joining of the ends of the insertion sequence element at the circle junction.

scholarly journals Precise Excision of IS5 from the Intergenic Region between the fucPIK and the fucAO Operons and Mutational Control of fucPIK Operon Expression in Escherichia coli

2010 ◽  
Vol 192 (7) ◽  
pp. 2013-2019 ◽  
Author(s):  
Zhongge Zhang ◽  
Ming Ren Yen ◽  
Milton H. Saier
Keyword(s):  
Escherichia Coli ◽  
Insertion Site ◽  
Point Mutations ◽  
Wild Type ◽  
Sequence Element ◽  
Low Frequencies ◽  
Precise Excision ◽  
Wild Type Phenotype ◽  
Unique System ◽  
Operon Expression

ABSTRACT Excision of transposable genetic elements from host DNA occurs at low frequencies and is usually imprecise. A common insertion sequence element in Escherichia coli, IS5, has been shown to provide various benefits to its host by inserting into specific sites. Precise excision of this element had not previously been demonstrated. Using a unique system, the fucose (fuc) regulon, in which IS5 insertion and excision result in two distinct selectable phenotypes, we have demonstrated that IS5 can precisely excise from its insertion site, restoring the wild-type phenotype. In addition to precise excision, several “suppressor” insertion, deletion, and point mutations restore the wild-type Fuc+ phenotype to various degrees without IS5 excision. The possible bases for these observations are discussed.

scholarly journals Sequence Analysis of Tn10 Insertion Sites in a Collection of Escherichia coli Strains Used for Genetic Mapping and Strain Construction

1998 ◽  
Vol 180 (23) ◽  
pp. 6408-6411 ◽  
Author(s):  
Brian P. Nichols ◽  
Obaid Shafiq ◽  
Victoria Meiners
Keyword(s):  
Escherichia Coli ◽  
Sequence Analysis ◽  
Hot Spots ◽  
Insertion Site ◽  
Inverse Pcr ◽  
E Coli ◽  
Chromosome Sequence ◽  
Tn10 Insertion ◽  
Insertion Sites ◽  
Recombination Hot Spots

ABSTRACT The chromosomal insertion sites of Tn10-containingEscherichia coli strains were amplified by inverse PCR, and the nucleotide sequences of the junctions were determined. In 95 strains analyzed, 88 unique Tn10 positions were determined and matched to the E. coli chromosome sequence. Two gaps in insertion site positions were noted, one including the terminus of DNA replication and another bounded by recombination hot spots RhsA and RhsB.

scholarly journals Site-Specific Insertion of IS492 in Pseudoalteromonas atlantica

2009 ◽  
Vol 191 (20) ◽  
pp. 6408-6414 ◽  
Author(s):  
Brian P. Higgins ◽  
Adam C. Popkowski ◽  
Peter R. Caruana ◽  
Anna C. Karls
Keyword(s):  
Extracellular Polysaccharide ◽  
Structural Features ◽  
Target Site ◽  
Recombination Mechanism ◽  
Site Specific ◽  
Precise Excision ◽  
Pseudoalteromonas Atlantica ◽  
A Site ◽  
Site Recognition

ABSTRACT Reversible insertion of IS492 at a site within epsG on the Pseudoalteromonas atlantica chromosome controls peripheral extracellular polysaccharide production and biofilm formation by P. atlantica. High-frequency precise excision of IS492 from epsG requires 5 and 7 bp of flanking DNA, suggesting that IS492 transposition involves a site-specific recombination mechanism. The site specificity of IS492 insertion was examined in P. atlantica and shown to be specific for a 7-bp target, 5′-CTTGTTA-3′. Characterization of numerous insertion events at the target site in epsG indicated that insertion is also orientation specific. The frequency of IS492 insertion at the epsG target site (2.7 × 10−7/cell/generation), determined by quantitative PCR, is 4 to 5 orders of magnitude lower than the frequency of IS492 precise excision from the same site. Comparison of insertion sites for IS492 and the highly related ISPtu2 from Pseudoalteromonas tunicata suggests DNA sequence and/or structural features that may contribute to site recognition and recombination by the transposase of IS492.

scholarly journals Identification of the insertion site of transgenic DNA based on cyclization of the target gene with the flanking sequence and nested inverse PCR

Talanta Open ◽  
2021 ◽  
Vol 3 ◽  
pp. 100033
Author(s):  
Jiayu Wang ◽  
Xuetong Bi ◽  
Wei Chen ◽  
Qinyue Zhao ◽  
Jinqi Yang ◽  
...  
Keyword(s):  
Target Gene ◽  
Insertion Site ◽  
Inverse Pcr ◽  
Flanking Sequence

Unique insertion site of Tn7 in the E. coli chromosome

Nature ◽  
1982 ◽  
Vol 297 (5867) ◽  
pp. 601-603 ◽  
Author(s):  
Conrad Lichtenstein ◽  
Sydney Brenner
Keyword(s):  
Insertion Site ◽  
E Coli

scholarly journals Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

2015 ◽  
Author(s):  
◽  
Blanca Estela Chavez-Sandoval
Keyword(s):  
Escherichia Coli ◽  
Good Alternative ◽  
Noble Metal Nanoparticles ◽  
Biological Synthesis ◽  
Target Sequence ◽  
Inorganic Synthesis ◽  
Fish Farms ◽  
E Coli ◽  
Synthesis Of Nanomaterials

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Molecular analysis of the maize wx-B3 allele indicates that precise excision of the transposable Ac element is rare.

Genetics ◽  
1992 ◽  
Vol 130 (2) ◽  
pp. 377-384 ◽  
Author(s):  
G Baran ◽  
C Echt ◽  
T Bureau ◽  
S Wessler
Keyword(s):  
Insertion Site ◽  
Pollen Grains ◽  
Genetic Maps ◽  
Null Alleles ◽  
P Elements ◽  
Ac Element ◽  
Precise Excision ◽  
Wx Gene ◽  
Low Levels

Abstract The somatic and germinal behavior of the maize wx-B3 mutation indicates that this Ac allele rarely reverts. Endosperms containing wx-B3 display tiny and infrequent Wx revertant sectors while no significant reversion is detected when wx-B3 pollen is stained with I/KI. Previous studies of other transposable element alleles that revert infrequently have implicated low levels of element excision. Unlike these other alleles, the wx-B3 Ac element is indistinguishable from fully active Ac elements with respect to its structure, and its ability to transpose from the Wx gene or to trans-activate a Ds element. Characterization of somatic and germinal excision events lead us to conclude that excision of the wx-B3 Ac element almost always produces null alleles. Furthermore, the excellent correlation between the position of the wx-B3 mutation on the physical and genetic maps indicates that the Ac insertion is the only lesion of wx-B3. As a result, precise excision of this Ac should restore Wx function. The fact that revertant sectors and pollen grains are rare indicates that precise excision of Ac is also rare. The finding that the wx-B3 reversion frequency is comparable whether wx-B3 is hemizygous or over a wx allele with a wild-type insertion site illustrates a fundamental difference between the excision mechanisms of Ac and Drosophila P elements.

scholarly journals Validation of iQ-Check E. coli O157:H7 Real-Time PCR Test Kit for Detection of Escherichia coli O157:H7 in Selected Foods

2009 ◽  
Vol 92 (4) ◽  
pp. 1095-1104 ◽  
Author(s):  
Wendy F Lauer ◽  
Sylvie Tymciu ◽  
Caroline D Sidi ◽  
Pierre Sonigo
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Ground Beef ◽  
Reference Method ◽  
Target Sequence ◽  
Apple Cider ◽  
E Coli ◽  
Test Kit ◽  
Significant Difference ◽  
The U.S

Abstract iQ-Check E. coli O157:H7 (Bio-Rad Laboratories, Hercules, CA) is a real-time PCR kit for detection of E. coli O157:H7 from selected foods. Specific fluorescent oligonucleotide probes are used to detect target DNA during the amplification, by hybridizing to the amplicons. These fluorescent probes are linked to a fluorophore which fluoresces only when hybridized to the target sequence. Three foods (ground beef, apple cider, fresh spinach) were selected to compare the performance of iQ-Check E. coli O157:H7 to the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook (MLG) reference method for ground beef and the U.S. Food and Drug Administration/Bacteriological Analytical Manual reference method for apple cider and fresh spinach. Three protocols were tested in this study: a shortened 8 h primary enrichment in buffered peptone water (BPW), a 24 h enrichment in BPW, and an enrichment in appropriate reference method enrichment broth. The iQ-Check E. coli O157:H7 method was able to identify more true/confirmed positive samples than the reference method. Inclusivity and exclusivity rates of the method were 100. iQ-Check E. coli O157:H7 performed as expected when minor procedural variations were introduced, validating the ruggedness of the method. There was no significant difference observed in performance over the shelf life of the kit.

scholarly journals Two C—P Lyase Operons in Pseudomonas stutzeri and Their Roles in the Oxidation of Phosphonates, Phosphite, and Hypophosphite

2004 ◽  
Vol 186 (14) ◽  
pp. 4730-4739 ◽  
Author(s):  
Andrea K. White ◽  
William W. Metcalf
Keyword(s):  
Insertion Site ◽  
Pseudomonas Stutzeri ◽  
Gene Organization ◽  
Amino Acid Sequences ◽  
Open Reading Frames ◽  
E Coli ◽  
Reverse Transcription Pcr ◽  
Transposon Insertion ◽  
Intergenic Sequences ◽  
Reading Frames

ABSTRACT DNA sequencing and analysis of two distinct C—P lyase operons in Pseudomonas stutzeri WM88 were completed. The htxABCDEFGHIJKLMN operon encodes a hypophosphite-2-oxoglutarate dioxygenase (HtxA), whereas the predicted amino acid sequences of HtxB to HtxN are each homologous to the components of the Escherichia coli phn operon, which encodes C—P lyase, although homologs of E. coli phnF and phnO are absent. The genes in the htx operon are cotranscribed based on gene organization, and the presence of the intergenic sequences is verified by reverse transcription-PCR with total RNA. Deletion of the htx locus does not affect the ability of P. stutzeri to grow on phosphonates, indicating the presence of an additional C—P lyase pathway in this organism. To identify the genes comprising this pathway, a Δhtx strain was mutagenized and one mutant lacking the ability to grow on methylphosphonate as the sole P source was isolated. A ca.-10.6-kbp region surrounding the transposon insertion site of this mutant was sequenced, revealing 13 open reading frames, designated phnCDEFGHIJKLMNP, which were homologous to the E. coli phn genes. Deletion of both the htx and phn operons of P. stutzeri abolishes all growth on methylphosphonate and aminoethylphosphonate. Both operons individually support growth on methylphosphonate; however, the phn operon supports growth on aminoethylphosphonate and phosphite, as well. The substrate ranges of both C—P lyases are limited, as growth on other phosphonate compounds, including glyphosate and phenylphosphonate, was not observed.

scholarly journals Induction of a DNA Nickase in the Presence of Its Target Site Stimulates Adaptive Mutation in Escherichia coli

2002 ◽  
Vol 184 (20) ◽  
pp. 5599-5608 ◽  
Author(s):  
Cesar Rodriguez ◽  
Joshua Tompkin ◽  
Jill Hazel ◽  
Patricia L. Foster
Keyword(s):  
Escherichia Coli ◽  
Single Strand ◽  
Target Site ◽  
Adaptive Mutation ◽  
Target Sequence ◽  
Induced Mutations ◽  
Single Base ◽  
Adaptive Mutations ◽  
E Coli ◽  
Nicking Enzyme

ABSTRACT Adaptive mutation to Lac+ in Escherichia coli strain FC40 depends on recombination functions and is enhanced by the expression of conjugal functions. To test the hypothesis that the conjugal function that is important for adaptive mutation is the production of a single-strand nick at the conjugal origin, we supplied an exogenous nicking enzyme, the gene II protein (gIIp) of bacteriophage f1, and placed its target sequence near the lac allele. When both gIIp and its target site were present, adaptive mutation was stimulated three- to fourfold. Like normal adaptive mutations, gIIp-induced mutations were recA+ and ruvC+ dependent and were mainly single-base deletions in runs of iterated bases. In addition, gIIp with its target site could substitute for conjugal functions in adaptive mutation. These results support the hypothesis that nicking at the conjugal origin initiates the recombination that produces adaptive mutations in this strain of E. coli, and they suggest that nicking may be the only conjugal function required for adaptive mutation.

Sign in / Sign up

Export Citation Format

Share Document