scholarly journals Diagnosis of Bubonic Plague by PCR in Madagascar under Field Conditions

2000 ◽  
Vol 38 (1) ◽  
pp. 260-263
Author(s):  
L. Rahalison ◽  
E. Vololonirina ◽  
M. Ratsitorahina ◽  
S. Chanteau
Keyword(s):  
Control Program ◽  
Diagnostic Value ◽  
Diagnostic Methods ◽  
Field Conditions ◽  
Clinical Samples ◽  
Enzyme Linked Immunosorbent Assay ◽  
Reference Laboratory ◽  
Operational Conditions ◽  
F1 Antigen ◽  
Pcr Method

ABSTRACT The diagnostic value of a PCR assay that amplifies a 501-bp fragment of the Yersinia pestis caf1 gene has been determined in a reference laboratory with 218 bubo aspirates collected from patients with clinically suspected plague managed in a regional hospital in Madagascar. The culture of Y. pestis and the detection of the F1 antigen (Ag) by enzyme-linked immunosorbent assay (ELISA) were used as reference diagnostic methods. The sensitivity of PCR was 89% (57 of 64) for the Y. pestis -positive patients, and 80.7% (63 of 78) for the F1 Ag-positive patients. The specificity of PCR for the culture-, F1 Ag-, and antibody-negative patients ( n = 105) was 100%. Because in Madagascar most patients with plague are managed and their clinical samples are collected in remote villages, the usefulness of PCR was evaluated for routine diagnostic use in the operational conditions of the control program. The sensitivity of PCR was 50% (25 of 50) relative to the results of culture and 35.2% (19 of 54) relative to the results of the F1 Ag immunocapture ELISA. The specificity of PCR under these conditions was 96%. In conclusion, the PCR method was found to be very specific but not as sensitive as culture or the F1 Ag detection method. The limitation in sensitivity may have been due to suboptimal field conditions and the small volumes of samples used for DNA extraction. This technique is not recommended as a routine diagnostic test for plague in Madagascar.

scholarly journals Immunohistochemical Detection of Porcine Epidemic Diarrhea Virus Compared to Other Methods

1998 ◽  
Vol 5 (3) ◽  
pp. 412-414 ◽  
Author(s):  
Franco Guscetti ◽  
Curzio Bernasconi ◽  
Kurt Tobler ◽  
Kristien Van Reeth ◽  
Andreas Pospischil ◽  
...  
Keyword(s):  
Porcine Epidemic Diarrhea Virus ◽  
Clinical Samples ◽  
Enzyme Linked Immunosorbent Assay ◽  
Direct Immunofluorescence ◽  
Good Reliability ◽  
Diarrhea Virus ◽  
Pcr Method ◽  
Porcine Epidemic Diarrhea ◽  
Cryostat Sections ◽  
Formalin Fixed

ABSTRACT An immunohistochemistry method using formalin-fixed tissues, a direct immunofluorescence method using cryostat sections, an enzyme-linked immunosorbent assay (ELISA), and a PCR method were compared for diagnosis in a litter of weaned pigs that had been experimentally inoculated with wild-type porcine epidemic diarrhea virus (PEDV) and killed between 6 and 60 h after onset of diarrhea. The immunohistochemistry method proved to be as reliable as direct immunofluorescence for diagnosis of PEDV in tissues collected postmortem. The good reliability of ELISA for investigating clinical samples was confirmed, whereas the PCR method used was ineffective.

Comparison of parasitological, immunological and molecular methods for evaluation of fecal samples of immunosuppressed rats experimentally infected with Strongyloides venezuelensis

Parasitology ◽  
2015 ◽  
Vol 142 (14) ◽  
pp. 1715-1721 ◽  
Author(s):  
LEILANE A. CHAVES ◽  
ANA LÚCIA R. GONÇALVES ◽  
FABIANA M. PAULA ◽  
NEIDE. M. SILVA ◽  
CLÁUDIO V. SILVA ◽  
...  
Keyword(s):  
Post Infection ◽  
Pcr Amplification ◽  
Conventional Polymerase Chain Reaction ◽  
Diagnostic Value ◽  
Diagnostic Methods ◽  
Enzyme Linked Immunosorbent Assay ◽  
Fecal Samples ◽  
Infection Time ◽  
Time Points ◽  
Strongyloides Venezuelensis

SUMMARYDefinitive diagnosis of strongyloidiasis in humans is typically achieved by detection of larvae in fecal samples. However, limitations on sensitivity of parasitological methods emphasize the need for more robust diagnostic methods. The aim of this study was to compare the diagnostic value of three methods: eggs per gram of feces (EPG), coproantigen detection by enzyme linked immunosorbent assay (ELISA), and DNA detection by conventional polymerase chain reaction (PCR). The assays were performed at 0 and 5, 8, 13, 21 and 39 days post-infection (dpi) using fecal samples from experimentally infected immunocompetent and immunosuppressed rats. In immunocompetent rats, eggs were detected in feces on days 5, 8 and 13 dpi; coproantigen detection and PCR amplification were successful at all post-infection time points (5, 8, 13, 21 and 39 dpi). In immunosuppressed rats, eggs were detected at 5, 8, 13 and 21; coproantigen detection and PCR amplification were successful at all post-infection time points. In conclusion, these results suggest that coproantigen detection and PCR may be more sensitive alternatives to traditional methods such as EPG for diagnosis of Strongyloides venezuelensis infection.

scholarly journals Development and Evaluation of ELISA and qRT-PCR for Identification of Squash vein yellowing virus in Cucurbits

Plant Disease ◽  
2017 ◽  
Vol 101 (1) ◽  
pp. 178-185 ◽  
Author(s):  
Craig G. Webster ◽  
William W. Turechek ◽  
Weimin Li ◽  
Chandrasekar S. Kousik ◽  
Scott Adkins
Keyword(s):  
Latent Class ◽  
Detection Method ◽  
Diagnostic Methods ◽  
Enzyme Linked Immunosorbent Assay ◽  
Qrt Pcr ◽  
Wide Range ◽  
Vine Decline ◽  
Pcr Method ◽  
Polymerase Chain ◽  
Yellowing Virus

Squash vein yellowing virus (SqVYV) causes viral watermelon vine decline. To facilitate detection of SqVYV, enzyme linked-immunosorbent assay (ELISA) and quantitative reverse-transcription polymerase chain reaction (qRT-PCR) diagnostic methods were developed. Both methods were capable of detecting SqVYV in a wide range of cucurbit hosts. ELISA was able to detect virus in infected host tissue diluted to at least 1:2,560, which was sufficient for detection in symptomatic squash and watermelon plants. The qRT-PCR method was capable of reliably detecting as few as 3.4 copies of a cloned fragment of SqVYV genomic RNA with an average cycle threshold (Ct) value of 36.4. The sensitivities and specificities for each detection method were estimated by latent class analysis for a set of inoculated squash and watermelon plants at two sampling scales. The scales were hierarchical, with individual plants representing the upper scale and samples from the plant representing the lower scale. The number of samples per plant varied from 1 to 8, and a plant was diagnosed positive if any of its samples tested positive. For all analyses, a cutoff Ct of 35 was chosen for qRT-PCR, which is approximately 2.5 cycles lower than the lowest Ct value achieved for mock-inoculated plants (presumed to be a false positive). qRT-PCR showed high sensitivities (≥0.99) at both sampling scales for squash and watermelon, whereas the sensitivities for ELISA ranged from 0.58 to 0.76. The specificities for both tests were very similar (≥0.94), with ELISA sometimes outperforming qRT-PCR. These diagnostic methods provide additional tools for the identification of SqVYV and management of SqVYV-induced watermelon vine decline.

scholarly journals Utility of Available Methods for Diagnosing SARS-CoV-2 in Clinical Samples

2020 ◽  
Vol 8 (3) ◽  
Author(s):  
Armin Shirvani ◽  
Leila Azimi ◽  
Roxana Mansour Ghanaie ◽  
Masoud Alebouyeh ◽  
Fatemeh Fallah ◽  
...  
Keyword(s):  
Point Of Care ◽  
Laboratory Diagnosis ◽  
Diagnostic Value ◽  
Clinical Findings ◽  
Diagnostic Methods ◽  
Detection Methods ◽  
Clinical Samples ◽  
Clinical Settings ◽  
Rt Pcr ◽  
Serological Tests

: The laboratory diagnosis of SARS-CoV-2 should be done to confirm coronavirus disease 2019 (COVID-19) in suspected patients. Although several diagnostic methods have been developed in this regard, their accuracy for clinical application is not very clear yet. To compare the diagnostic value of laboratory tests for the detection of COVID-19 infection, this study provides an upcoming review of the newly developed detection methods. Sensitivity, specificity, detection limit, and turn-around-time of these methods are compared and challenges for their application in clinical settings are reviewed. PubMed and Google Scholar web sites were used for the systematic search until April 9, 2020 to identify the published studies based on the following keywords: “Detection”, “Coronavirus 2019”, “SARS-CoV-2”, and “Sensitivity”. Out of 526 results, a total of 54 articles, including 46 studies on detection methods, were considered eligible for the review. The results showed that most of the proposed tests focused on molecular methods, while immunological and point-of-care tests were investigated in 13 studies. There were also a few commercial automated methods for the qualitative detection of SARS-CoV-2 in clinical samples, most of which are not examined in the current review, as no data about their sensitivity and specificity were presented. Although the assessment of publication biases showed that 64% sensitivity and nearly 100% specificity for RT-PCR are close to reality, most of the related reports for serological methods are not valid and further studies are needed to confirm their utility in clinical settings. Moreover, the RT-PCR test alone cannot act as a gold standard because of bias in measurements. Therefore, antibody tests and other proposed methods could be used as supplementary diagnostic tests to improve RT-PCR accuracy. Although clinical findings are invaluable, in many cases, they can provide more valuable supportive data than serological tests.

Investigation of duck plague virus in hoar areas of Bangladesh

2020 ◽  
Vol 26 (1-2) ◽  
pp. 73-78
Author(s):  
A Hossen ◽  
MH Rahman ◽  
MZ Ali ◽  
MA Yousuf ◽  
MZ Hassan ◽  
...  
Keyword(s):  
Cytopathic Effect ◽  
Clinical Sample ◽  
Chorioallantoic Membrane ◽  
Clinical Samples ◽  
Isolation And Identification ◽  
Duck Plague Virus ◽  
Pcr Method ◽  
Polymerase Chain ◽  
The Individual ◽  
Free Ranging

Duck plague (DP) is the most important infectious disease of geese, ducks and free-ranging water birds. The present study was conducted to determine the prevalence of duck plague virus followed by isolation and identification. For these purposes, a total of 155 cloacal swabs samples were collected randomly from duck of different haor areas of Bangladesh including 45 (41 surveillance and 4 clinical) samples from Netrokona; 42 (40 surveillance and 2 clinical) samples from Kishoregonj; 30 samples from Brahmanbaria and 38 samples from Sunamganj. The samples were processed and pooled (1:5 ratio) for initial screening of target polymerase gene of duck plague virus by polymerase chain reaction (PCR) method. All the samples of a positive pool were then tested individually for identifying the individual positive samples. The result showed that out of 155 samples, 41 (26.45%) were found positive in which 17 were from Netrokona, where 15 (36.58%) were from surveillance samples and 2 (50%) were from clinical sample; 16 were from Kishoregonj, where 14 (35%) were from surveillance samples and 2 (100%) were from clinical sample; 2 (6.6%) were from Brahmanbaria and 5 (13.15%) were from Sunamganj. These positive samples were inoculated into 9-10 days embryonated duck eggs (EDE) through chorioallantoic membrane (CAM) route for the isolation of virus. The EDE died earlier was also chilled, and in a similar way, the CAMs were collected and again performed PCR for id entification of virus. Out of 41 PCR positive samples, 26 samples were isolated and reconfirmed by PCR. Subsequently, DPV was isolated in primary duck embryo fibroblasts cell culture and confirmed by observing cytopathic effect (CPE). Bang. J. Livs. Res. Vol. 26 (1&2), 2019: P. 73-78

Diagnosis of helicobacter pylori infection: problems and prospects

2020 ◽  
pp. 54-59
Author(s):  
A. S. Molostova ◽  
N. S. Gladyshev ◽  
A. V. Svarval ◽  
R. S. Ferman ◽  
A. B. Karasyova ◽  
...  
Keyword(s):  
Helicobacter Pylori ◽  
Urease Activity ◽  
Diagnostic Methods ◽  
Study Group ◽  
Biochemical Method ◽  
Antimicrobial Drugs ◽  
Non Invasive ◽  
Number Of Patients ◽  
Pcr Method ◽  
Positive Results

(HP) infection was performed using invasive and non-invasive methods. The study group consisted of 95 patients with dyspepsia. HP infection was detected in 47 patients (49.4 %). The expediency of using a set of diagnostic methods for detecting HP (PCR, immunochromatographic, bacteriological and method for determining urease activity) is proved. Most often (100 %) in patients HP infection was detected in biopsies using the PCR method. Somewhat less frequently it was detected when examining biopsies with an invasive biochemical method (AMA RUT Reader) (82 %) and fecal immunochromatographic method (83 %). Despite the fact that helicobacteriosis was detected bacteriologically in a small number of patients (24 %), this method is of particular value, since it allows you to assess the sensitivity to antimicrobial drugs and probiotics, and does not give false positive results.

Diagnostic Value of Non-Invasive Prenatal Screening of β-thalassemia by Cell Free Fetal DNA and Fetal NRBC

2019 ◽  
Vol 19 (2) ◽  
pp. 105-111
Author(s):  
Nadia Shafei ◽  
Mohammad Saeed Hakhamaneshi ◽  
Massoud Houshmand ◽  
Siavash Gerayeshnejad ◽  
Fardin Fathi ◽  
...  
Keyword(s):  
Sensitivity And Specificity ◽  
Multiple Displacement Amplification ◽  
Diagnostic Value ◽  
Diagnostic Methods ◽  
Beta Thalassemia ◽  
Non Invasive ◽  
Fetal Dna ◽  
Prenatal Diagnostic ◽  
Cell Free Fetal Dna ◽  
Invasive Techniques

Background: Beta thalassemia is a common disorder with autosomal recessive inheritance. The most prenatal diagnostic methods are the invasive techniques that have the risk of miscarriage. Now the non-invasive methods will be gradually alternative for these invasive techniques. Objective: The aim of this study is to evaluate and compare the diagnostic value of two non-invasive diagnostic methods for fetal thalassemia using cell free fetal DNA (cff-DNA) and nucleated RBC (NRBC) in one sampling community. Methods: 10 ml of blood was taken in two k3EDTA tube from 32 pregnant women (mean of gestational age = 11 weeks), who themselves and their husbands had minor thalassemia. One tube was used to enrich NRBC and other was used for cff-DNA extraction. NRBCs were isolated by MACS method and immunohistochemistry; the genome of stained cells was amplified by multiple displacement amplification (MDA) procedure. These products were used as template in b-globin segments PCR. cff-DNA was extracted by THP method and 300 bp areas were recovered from the agarose gel as fetus DNA. These DNA were used as template in touch down PCR to amplify b-globin gen. The amplified b-globin segments were sequenced and the results compared with CVS resul. Results: The data showed that sensitivity and specificity of thalassemia diagnosis by NRBC were 100% and 92% respectively and sensitivity and specificity of thalassemia diagnosis by cff-DNA were 100% and 84% respectively. Conclusion: These methods with high sensitivity can be used as screening test but due to their lower specificity than CVS, they cannot be used as diagnostic test.

scholarly journals SARS-CoV-2 IgG Antibodies Seroprevalence and Sera Neutralizing Activity in MEXICO: A National Cross-Sectional Study during 2020

2021 ◽  
Vol 9 (4) ◽  
pp. 850
Author(s):  
José Esteban Muñoz-Medina ◽  
Concepción Grajales-Muñiz ◽  
Angel Gustavo Salas-Lais ◽  
Larissa Fernandes-Matano ◽  
Constantino López-Macías ◽  
...  
Keyword(s):  
Immunosorbent Assay ◽  
Neutralizing Antibodies ◽  
Herd Immunity ◽  
Cross Sectional Study ◽  
Molecular Techniques ◽  
Diagnostic Methods ◽  
Molecular Diagnostic ◽  
Enzyme Linked Immunosorbent Assay ◽  
Cross Sectional ◽  
Neutralizing Activity

Until recently, the incidence of COVID-19 was primarily estimated using molecular diagnostic methods. However, the number of cases is vastly underreported using these methods. Seroprevalence studies estimate cumulative infection incidences and allow monitoring of transmission dynamics, and the presence of neutralizing antibodies in the population. In February 2020, the Mexican Social Security Institute began conducting anonymous unrelated sampling of residual sera from specimens across the country, excluding patients with fever within the previous two weeks and/or patients with an acute respiratory infection. Sampling was carried out weekly and began 17 days before Mexico’s first officially confirmed case. The 24,273 sera obtained were analyzed by chemiluminescent-linked immunosorbent assay (CLIA) IgG S1/S2 and, later, positive cases using this technique were also analyzed to determine the rate of neutralization using the enzyme-linked immunosorbent assay (ELISA). We identified 40 CLIA IgG positive cases before the first official report of SARS-CoV-2 infection in Mexico. The national seroprevalence was 3.5% in February and 33.5% in December. Neutralizing activity among IgG positives patients during overall study period was 86.1%. The extent of the SARS-CoV-2 infection in Mexico is 21 times higher than that reported by molecular techniques. Although the general population is still far from achieving herd immunity, epidemiological indicators should be re-estimated based on serological studies of this type.

Urine β-2-glycoprotein 1 as a biomarker for diagnosis of systemic lupus erythematosus

Lupus ◽  
2021 ◽  
pp. 096120332110142
Author(s):  
Jung Sun Lee ◽  
Eun-Ju Lee ◽  
Jeonghun Yeom ◽  
Ji Seon Oh ◽  
Seokchan Hong ◽  
...  
Keyword(s):  
Systemic Lupus Erythematosus ◽  
Lupus Erythematosus ◽  
Medical Center ◽  
Characteristic Curve ◽  
Area Under The Curve ◽  
Diagnostic Value ◽  
Urine Samples ◽  
Enzyme Linked Immunosorbent Assay ◽  
Systemic Lupus ◽  
Asan Medical

Objective The need for a biomarker with robust sensitivity and specificity in diagnosing systemic lupus erythematosus (SLE) remains unmet. Compared with blood samples, urine samples are more easily collected; thus, we aimed to identify such a biomarker based on urinary proteomics which could distinguish patients with SLE from healthy controls (HCs). Methods Urine samples were collected from 76 SLE patients who visited rheumatology clinic in 2019 at Asan medical center and from 25 HCs. Urine proteins were analyzed using sequential windowed acquisition of all theoretical fragment ion spectra-mass spectrometry, and the candidate marker was confirmed by enzyme-linked immunosorbent assay (ELISA). Receiver operating characteristic curve analysis was used to determine the diagnostic value of the candidate biomarker. Results Of 1157 proteins quantified, 153 were differentially expressed in urine samples from HCs. Among them were previously known markers including α-1-acid glycoprotein 1, α-2-HS-glycoprotein, ceruloplasmin, and prostaglandin-H2 D-isomerase. Moreover, the amount of β-2 glycoprotein (APOH) was increased in the urine of patients with SLE. The ELISA results also showed the level of urine APOH was higher in patients with SLE than in HCs and patients with rheumatoid arthritis. Moreover, the level was not different between SLE patients with and without nephritis. The urine APOH had an area under the curve value of 0.946 at a cut-off value of 228.53 ng/mg (sensitivity 91.5%, specificity 92.0%) for the diagnosis of SLE. Conclusion The results indicate that the urine APOH level can be an appropriate screening tool in a clinical setting when SLE is suspected.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Sign in / Sign up

Export Citation Format

Share Document