scholarly journals Maternal Influence and Murine Housing Confound Impact of NLRP1 Inflammasome on Microbiome Composition

2019 ◽  
Vol 11 (5) ◽  
pp. 416-431 ◽  
Author(s):  
Veronica M. Ringel-Scaia ◽  
Yufeng Qin ◽  
Cassidy A. Thomas ◽  
Kathleen E. Huie ◽  
Dylan K. McDaniel ◽  
...  
Keyword(s):  
Pathogenic Bacteria ◽  
Maternal Influence ◽  
Rrna Gene ◽  
Wild Type ◽  
Microbiome Composition ◽  
Nlrp1 Inflammasome ◽  
Microbiome Research ◽  
Inflammatory Bowel ◽  
The 16S Rrna Gene ◽  
V3 Region

The NLRP1 inflammasome attenuates inflammatory bowel disease (IBD) progression and colitis-associated tumorigenesis. A possible mechanism postulates that the lack of the NLRP1 inflammasome creates permissive niches in the gut for pathogenic bacteria to flourish, causing dysbiosis and increased IBD susceptibility. To evaluate this hypothesis, we characterized the gut microbiome of wild-type, Nlrp1b–/–, and Asc–/– mice under naïve conditions by sequencing the V3 region of the 16s rRNA gene. For both genetically modified mouse lines, the microbiome composition reflected overrepresentation of bacteria associated with dysbiosis relative to wild-type animals. Measurement of short- and medium-chain fatty acids by mass spectrometry further revealed significant differences between genotypes. However, prior to concluding that the NLRP1 inflammasome plays a role in regulating the composition of the microbiome, we evaluated two additional strategies for cohousing wild-type and Nlrp1b–/– mice: breeding homozygous parents and cohousing at weaning, and breeding from heterozygous parents and cohousing littermates. We found that maternal influence was the greater predictor of microbiome composition rather than genotype. With the rise in microbiome research across disciplines, our study should be viewed as a cautionary example that illustrates the importance of careful breeding and housing strategies when evaluating host-microbiome interactions.

scholarly journals Blastocystis Colonization Is Associated with Increased Diversity and Altered Gut Bacterial Communities in Healthy Malian Children

2019 ◽  
Vol 7 (12) ◽  
pp. 649 ◽  
Author(s):  
Aly Kodio ◽  
Drissa Coulibaly ◽  
Abdoulaye Kassoum Koné ◽  
Salimata Konaté ◽  
Safiatou Doumbo ◽  
...  
Keyword(s):  
Bacterial Communities ◽  
Pathogenic Bacteria ◽  
Gastrointestinal Disease ◽  
Illumina Miseq ◽  
Cross Sectional Study ◽  
Rrna Gene ◽  
Healthy Children ◽  
Cross Sectional ◽  
Inflammatory Bowel ◽  
Microbiota Diversity

Blastocystis is the most common protozoan colonizing the gut of vertebrates. It modulates the human digestive microbiota in the absence of inflammation and gastrointestinal disease. Although it has been associated with human diseases, including inflammatory bowel disease, its pathogenicity remains controversial. This study aimed to assess the influence of Blastocystis on the gut bacterial communities in healthy children. We conducted a cross-sectional study on 147 Blastocystis-colonized and 149 Blastocystis-noncolonized Malian children, with Blastocystis colonization assessed by real-time PCR and gut microbial communities characterized via 16S rRNA gene (Illumina MiSeq) sequencing and bioinformatics analysis. The gut microbiota diversity was higher in Blastocystis-colonized compared to Blastocystis-noncolonized children. The phyla Firmicutes, Elusimicrobia, Lentisphaerae, and Euryarchaeota were higher in Blastocystis-colonized children, whereas Actinobacteria, Proteobacteria, unassigned bacteria, and Deinococcus–Thermus were higher in Blastocystis-noncolonized children. Moreover, Faecalibacterium prausnitzii (family Ruminococcaceae) and Roseburia sp. (family Lachnospiraceae) abundance was higher in Blastocystis-colonized children. We conclude that Blastocystis colonization is significantly associated with a higher diversity of the gut bacterial communities in healthy children, while it is not associated with the presence of potentially pathogenic bacteria in the human gut.

scholarly journals Specialized microbiome of the cave-dwelling sponge Plakina kanaky (Porifera, Homoscleromorpha)

2020 ◽  
Vol 96 (4) ◽  
Author(s):  
César Ruiz ◽  
Marcela Villegas-Plazas ◽  
Olivier P Thomas ◽  
Howard Junca ◽  
Thierry Pérez
Keyword(s):  
Extreme Environments ◽  
Amplicon Sequencing ◽  
Sponge Species ◽  
Rrna Gene ◽  
Microbiome Composition ◽  
16S Amplicon Sequencing ◽  
Ecological Success ◽  
Specific Community ◽  
First Time ◽  
The 16S Rrna Gene

ABSTRACT The recent description of the polychromatic sponge Plakina kanaky revealed original microsymbionts, with some morphotypes recorded for the first time in Homoscleromorpha and others never before observed in other sponge groups. Illumina 16S amplicon sequencing was used to characterize this microbial community by comparing contents of seven specimens of this Plakinidae with five other sponge species: one Homoscleromopha of the Oscarellidae family and four Demospongiae. A total of 256 458 sequences of the hypervariable V5-V6 region of the 16S rRNA gene were clustered into 2,829 OTUs at 97% similarity, with Proteobacteria, Poribacteria and Chloroflexi being the most abundant phyla. The Plakina kanaky specific community appeared to be mainly composed by five OTUs representing about 10% of the total microbiome. Among these, the filamentous bacterium Candidatus Entotheonella, which was among the dominant morphotypes previously observed in the mesohyl and the larvae of P. kanaky, was detected in all studied specimens. However, other original and dominant morphotypes could not be assigned to a known prokaryotic taxon. This cave dwelling sponge species harbors a distinctive microbiome composition of potential taxonomic and metabolic novelties that may be linked to its ecological success in such extreme environments.

The effects of captivity on the microbiome of the endangered Comal Springs riffle beetle (Heterelmis comalensis)

2021 ◽  
Vol 368 (17) ◽  
Author(s):  
Zachary Mays ◽  
Amelia Hunter ◽  
Lindsay Glass Campbell ◽  
Camila Carlos-Shanley
Keyword(s):  
16S Rrna ◽  
Gut Microbiome ◽  
Amplicon Sequencing ◽  
Conservation Education ◽  
Rrna Gene ◽  
Sequence Variants ◽  
Microbiome Composition ◽  
Intrinsic Factors ◽  
Captive Populations ◽  
The 16S Rrna Gene

Abstract The gut microbiome is affected by host intrinsic factors, diet and environment, and strongly linked to host's health. Although fluctuations of microbiome composition are normal, some are due to changes in host environmental conditions. When species are moved into captive environments for conservation, education or rehabilitation, these new conditions can influence a change in gut microbiome composition. Here, we compared the microbiomes of wild and captive Comal Springs riffle beetles (Heterelmis comalensis) by using amplicon sequencing of the 16S rRNA gene. We found that the microbiome of captive beetles was more diverse than wild beetle microbiomes. We identified 24 amplicon sequence variants (ASVs) with relative abundances significantly different between the wild and captive beetles. Many of the ASVs overrepresented in captive beetle microbiomes belong to taxa linked to nitrogen-rich environments. This is one of the first studies comparing the effects of captivity on the microbiome of an endangered insect species. Our findings provide valuable information for future applications in the management of captive populations of H. comalensis.

scholarly journals Genetic characterization of the microbiota of artisan fresh cheese from the Papaloapan region

2021 ◽  
Vol 6 (2) ◽  
pp. 61-85
Author(s):  
Miguel A. García-Muñoz ◽  
◽  
Nancy Cruz-Velazco ◽  
América Chávez-Martínez ◽  
Cirilo Nolasco-Hipólito ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gel Electrophoresis ◽  
Pathogenic Bacteria ◽  
Denaturing Gradient Gel Electrophoresis ◽  
Starter Cultures ◽  
Rrna Gene ◽  
Gradient Gel Electrophoresis ◽  
Fresh Cheese ◽  
The 16S Rrna Gene

The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) method was used for bacteria identification. For all the samples, the presence of aerobic mesophiles, Streptococcus mesophiles and thermophiles, Lactobacillus mesophiles, Leuconostoc, total coliforms, Staphylococcus aureus, molds, and yeasts were identified. The complexity and variety of microorganisms in the summer and winter seasons samples were not significantly different. In conclusion, all samples of fresh artisan cheeses were under high microbial loads. Lactic Acid Bacteria (LAB) were in a typical load, as established by the quality and safety standards in the food industry. Conversely, pathogenic bacteria exceeded this limit. The microorganisms present in the fresh artisanal cheeses of the Papaloapan region were identified with precision, regarding the count and their diversity. A recommendation for the cheese manufacturers is to prepare starter cultures by selecting the appropriate microorganisms to produce the desirable characteristics such as aroma and flavor and reduce the risk of microbial infections by using pasteurized milk.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals A comparison of wild and captive Comal Springs riffle beetle (Heterelmis comalensis) microbiomes

2021 ◽  
Author(s):  
Zachary Mays ◽  
Camila Carlos-Shanley ◽  
Lindsay Glass Campbell ◽  
Amelia Hunter
Keyword(s):  
16S Rrna ◽  
Gut Microbiome ◽  
Amplicon Sequencing ◽  
Conservation Education ◽  
Rrna Gene ◽  
Sequence Variants ◽  
Microbiome Composition ◽  
Intrinsic Factors ◽  
Captive Populations ◽  
The 16S Rrna Gene

The gut microbiome is affected by host intrinsic factors, diet, environment, and strongly linked to host's health. Although fluctuations of microbiome composition are normal, some are due to changes in host environmental conditions. When species are moved into captive environments for conservation, education, or rehabilitation, these new conditions can influence a change in gut microbiome composition. Here, we compared the microbiomes of wild and captive Comal Springs riffle beetles (Heterelmis comalensis) by using amplicon sequencing of the 16S rRNA gene. We found that the microbiome of captive beetles was more diverse than wild beetle microbiomes. We identified 24 Amplicon Sequence Variants (ASVs) with relative abundances significantly different between the wild and captive beetles. Many of the ASVs overrepresented in captive beetle microbiomes belong to taxa linked to nitrogen-rich environments. This is one of the first studies comparing the effects of captivity on the microbiome of an endangered insect species. Our findings provide valuable information for future applications in the management of captive populations of H. comalensis.

scholarly journals Dynamics and Heterogeneity of Microbial Communities in Urban Water Environments

2020 ◽  
Author(s):  
Yanqing Lian ◽  
Lisha Zhen ◽  
Xi Chen ◽  
Yang Li ◽  
Xiaona Li
Keyword(s):  
Microbial Communities ◽  
Urban Areas ◽  
Pathogenic Bacteria ◽  
Temporal Dynamics ◽  
Statistical Analyses ◽  
Polluted Water ◽  
Outer Side ◽  
Rrna Gene ◽  
The City ◽  
The 16S Rrna Gene

Abstract Water samples for the 16S rRNA gene and water quality analyses were collected from around 155 kilometers of river segments surrounding the urban areas in Xi’an of China. Multiple statistical analyses showed the temporal dynamics of microbial communities and heterogeneity in their spatial distributions. The dynamic shifts of microbial communities in the Chan, Ba, and Feng Rivers from the Spring to the Summer seasons were apparent, but little in the Zao River. The heterogeneity of microbial distributions was more due to the influence of hydrologic conditions and various sources of inflows in the rivers. The LEfSe analysis showed the Chan and Zao Rivers, both were more impacted by the sewage effluents, were more differentially abundant with bacteria related to polluted water, but the Ba and Feng Rivers, both on the outer side of the city, were more abundant with microbial communities in soil and freshwater environments in August. Multiple statistical analyses indicated that environmental variables had a significant impact on microbial communities. The GIS-based spatial analysis not only showed heterogeneity of microbial community distributions along the rivers, more importantly, could help identify locations where pathogenic bacteria presented.

scholarly journals Bioactive Diterpenoids Impact the Composition of the Root-Associated Microbiome in Maize (Zea mays)

2020 ◽  
Author(s):  
Katherine M. Murphy ◽  
Joseph Ewards ◽  
Katherine B. Louie ◽  
Benjamin P. Bowen ◽  
Venkatesan Sundaresan ◽  
...  
Keyword(s):  
Zea Mays ◽  
Molecular Mechanisms ◽  
Bacterial Community Composition ◽  
16S Rrna Gene Sequencing ◽  
Chemical Defenses ◽  
Rrna Gene ◽  
Wild Type ◽  
Microbiome Composition ◽  
Rhizosphere Microbiome ◽  
Maize Varieties

Abstract Background : Plants deploy both primary and species-specific, specialized metabolites to communicate with other organisms and adapt to environmental challenges. This includes interactions with soil-dwelling microbial communities, where plants may exchange sugars for important nutrients and protection against environmental perturbations, directly benefitting plant fitness. However, the molecular mechanisms underlying these plant-microbe interactions often remain elusive. Results : In this study, we report that maize ( Zea mays ) specialized diterpenoid metabolites with known antifungal bioactivities also influence rhizosphere bacterial communities. Metabolite profiling showed that dolabralexins, antibiotic diterpenoids that are highly abundant in roots of some maize varieties, can be exuded from the roots. Comparative 16S rRNA gene sequencing determined the bacterial community composition of the maize mutant Zman2 ( anther ear 2 ), which is deficient in dolabralexins and closely related bioactive kauralexin diterpenoids. Under well-watered conditions, the Zman2 rhizosphere microbiome differed significantly from the wild-type sibling with the most significant changes observed for Alphaproteobacteria of the order Sphingomonadales. By contrast, there was no difference in the microbiome composition between the mutant and wild-type was observed under drought stress. Metabolomics analyses support that these differences are attributed to the diterpenoid deficiency of the Zman2 mutant, rather than other metabolome alterations. Conclusions : Together, these findings support physiological functions of maize diterpenoids beyond known chemical defenses, including the assembly of the rhizosphere microbiome.

scholarly journals Epizootic ulcerative syndrome causes cutaneous dysbacteriosis in hybrid snakehead (Channa maculata♀ × Channa argus♂)

PeerJ ◽  
2019 ◽  
Vol 7 ◽  
pp. e6674 ◽  
Author(s):  
Zhifei Li ◽  
Guangjun Wang ◽  
Kai Zhang ◽  
Wangbao Gong ◽  
Ermeng Yu ◽  
...  
Keyword(s):  
Pathogenic Bacteria ◽  
Illumina Miseq ◽  
Infected Fish ◽  
Rrna Gene ◽  
Illumina Miseq Sequencing ◽  
Miseq Sequencing ◽  
Host Health ◽  
Channa Argus ◽  
Epizootic Ulcerative Syndrome ◽  
The 16S Rrna Gene

Cutaneous microbiota play an important role in protecting fish against pathogens. Aphanomyces infection causes epizootic ulcerative syndrome (EUS) in fish, and by perturbing the integrity of the cutaneous microbiota, increases the potential for infection by pathogenic bacteria. However, whether the composition of the cutaneous microbiota is altered in fish with EUS, and if so, which species are changed and how this might influence infected fish, is still largely unclear. Considering the importance of cutaneous microbiota in maintaining host health, we hypothesized that Aphanomyces infection significantly enhances the presence of certain bacterial pathogens in the cutaneous microbiota and causes cutaneous dysbacteriosis. To test this hypothesis, we compared the cutaneous microbiota compositions of hybrid snakehead (Channa maculata♀ × Channa argus♂) with and without Aphanomyces infection using Illumina Miseq sequencing of the 16S rRNA gene. Our results showed that the cutaneous microbiota of hybrid snakehead were significantly altered subsequent to EUS infection and that the numbers of potentially pathogenic bacteria classified into the genera Anaerosinus, Anaerovorax, Dorea, and Clostridium were significantly enhanced in the cutaneous microbiota of hybrid snakehead with EUS, whereas bacteria classified into the genera Arthrobacter, Dysgonomonas, Anoxybacillus, Bacillus, Solibacillus, Carnobacterium, Lactococcus, Streptococcus, Achromobacter, Polynucleobacter, Vogesella, and Pseudomonas were significantly reduced. These results imply that treatment for EUS should not only take into consideration the control of Aphanomyces reproduction but should also focus on regulating the cutaneous microbiota of infected fish.

Sign in / Sign up

Export Citation Format

Share Document