Description of the larva of a firefly species, Pygoluciola dunguna Nada (Coleoptera: Lampyridae)

Zootaxa ◽  
2021 ◽  
Vol 4920 (4) ◽  
pp. 528-542
Author(s):  
B. NADA ◽  
L. A. BALLANTYNE ◽  
WAN F. A. JUSOH
Keyword(s):  
Dna Barcoding ◽  
Peninsular Malaysia ◽  
The Body ◽  
Aquatic Predators ◽  
Defensive Mechanism

Pygoluciola dunguna Nada, 2018 was described from Peninsular Malaysia, using males and reliably associated females. This paper details description of the larva which has been conclusively identified as Pygoluciola dunguna based on DNA barcoding technique and uses morphology, brief habitat and behavioural data. A total of 70 larval specimens were measured and their main features described. The larvae exhibit a riparian or semi-aquatic behaviour, observed crawling on the sandy edge of shallow streams. The stake-like projections along the length of the body suggest a form of defensive mechanism from falling prey to aquatic predators. 

scholarly journals Identification of larval fish in mangrove areas of Peninsular Malaysia using morphology and DNA barcoding methods

2017 ◽  
Vol 33 (5) ◽  
pp. 998-1006 ◽  
Author(s):  
I. A. Azmir ◽  
Y. Esa ◽  
S. M. N. Amin ◽  
I. S. Md Yasin ◽  
F. Z. Md Yusof
Keyword(s):  
Dna Barcoding ◽  
Larval Fish ◽  
Peninsular Malaysia

scholarly journals The need for accessibility to chloride to solubilize insoluble salts may underlie some cases of hypertension

2021 ◽  
Author(s):  
Lipeng Liao ◽  
Tao Gan ◽  
Yuhan Lin ◽  
Chanyuk Lam David ◽  
Jess Lan Ouyang ◽  
...  
Keyword(s):  
Blood Pressure ◽  
Risk Factor ◽  
Calcium Oxalate ◽  
The Body ◽  
Increase Blood Pressure ◽  
Calcium Salts ◽  
Widespread Distribution ◽  
Defensive Mechanism

Hypertension is the greatest risk factor for stroke. It is the most common comorbidity of COVID-19, and may be partly caused by the widespread distribution of insoluble and stiff calcium salts such as calcium oxalate. As an intrinsic defensive mechanism, tissues in hypertensive individuals increase blood pressure to pump NaCl to inaccessible parts of the body, and chloride, as a strong anion can solubilize insoluble and rigid salts which are stressful to cells.

Do House Wrens (Troglodytes aedon) add spider egg cases to their nests for heterospecific cleaning?

2019 ◽  
Vol 97 (1) ◽  
pp. 50-56
Author(s):  
C.L. Gable ◽  
T.J. Underwood ◽  
G.P. Setliff
Keyword(s):  
Dna Barcoding ◽  
Body Condition ◽  
Significant Relationship ◽  
The Body ◽  
Troglodytes Aedon ◽  
House Wren ◽  
Late Season ◽  
House Wrens ◽  
Significant Difference

House Wrens (Troglodytes aedon Vieillot, 1809) regularly add spider egg cases (Arachnida: Araneae) to their nests, which may be an example of heterospecific cleaning. This behavior involves one animal employing another to remove parasites from their nests. In House Wren nests, juvenile spiders hatching from egg cases may facilitate the reduction of mites that feed on nestlings. We tested this ectoparasite reduction hypothesis by monitoring House Wren nests for spider egg cases and by collecting completed nests to compare the number of spider egg cases and Dermanyssus hirundinis (Hermann, 1804) mites. No significant relationship was found between the number of spider egg cases and number of D. hirundinis mites in nests. We also found no significant relationship between the number of D. hirundinis mites in nests and the body condition of nestlings. Finally, no significant difference was found between the number of D. hirundinis mites in early versus late season nests, but significantly more spider egg cases were added to late season nests. Of a subsample of spider egg cases dissected, we found that 28% contained spider eggs or embryos. We also identified three species of juvenile spiders from House Wren nests using DNA barcoding. Overall, we found no evidence that spider egg cases reduce the number of D. hirundinis mites or engender better quality offspring in House Wren nests.

Use of molecular methods in identification of species, age and sex of insects useful in forensic entomology

2014 ◽  
Vol 286 ◽  
pp. 66-69
Author(s):  
Joanna Stojak ◽  
Keyword(s):  
Dna Barcoding ◽  
Species Identification ◽  
Environmental Conditions ◽  
Forensic Entomology ◽  
Sex Identification ◽  
The Body ◽  
Molecular Methods ◽  
Insect Larvae ◽  
Identification Of Species ◽  
Age And Sex

Forensic entomology uses insects to determine the time, cause and place of death. To this end, two entomological methods are used. The development-based method uses the patterns of insect larvae development under the specific thermal and environmental conditions. The succession-based method analyzes the sequence of insect succession on the body in various environmental conditions. The proper insect species identification is essential in both methods. In this article, the molecular methods of species, age and sex identification are presented such as DNA barcoding or DNA-HRM-PCR.

Genetic Diversity of Pediculus humanus capitis (Phthiraptera: Pediculidae) in Peninsular Malaysia and Molecular Detection of Its Potential Associated Pathogens

2019 ◽  
Vol 57 (3) ◽  
pp. 915-926
Author(s):  
Aida Syafinaz Mokhtar ◽  
Yee Ling Lau ◽  
John-James Wilson ◽  
Noraishah Mydin Abdul-Aziz
Keyword(s):  
Genetic Diversity ◽  
Dna Barcoding ◽  
Pathogenic Bacteria ◽  
Peninsular Malaysia ◽  
Molecular Evidence ◽  
Head Lice ◽  
Pediculus Humanus Capitis ◽  
Accurate Identification ◽  
Pediculosis Capitis ◽  
Pediculus Humanus

Abstract Pediculosis capitis caused by Pediculus humanus capitis (De Geer) is endemic all over the world, and children are mostly affected, particularly those living in overcrowded institutions. Several studies have shown that P. h. capitis carried human pathogenic bacteria, suggesting the potential role of head lice in the transmission of pathogens to humans. In this study, we determined the genetic diversity of head lice collected from welfare homes sheltering underprivileged children by using DNA barcoding and demonstrated the presence of Acinetobacter spp., Serratia marcescens, and Staphylococcus aureus in head lice, which have never been investigated before in Malaysia. Cox1 DNA barcoding identified the head lice, P. h. capitis collected from welfare homes across two geographical areas of Peninsular Malaysia as belonging to clades A, B, and D. Acinetobacter bacteria: Acinetobacter guillouiae, Acinetobacter junii, Acinetobacter baumannii, and Acinetobacter nosocomialis were detected in head lice belonging to clades A and also D. In addition, DNA from S. marcescens and S. aureus were also detected in both clades A and D. To our knowledge, this is the first report on the genetic diversity of head lice in Malaysia through DNA barcoding, as well as the first to provide molecular evidence on the type of bacteria occurring in head lice in Malaysia. It is anticipated that the DNA barcoding technique used in this study will be able to provide rapid and accurate identification of arthropods, in particular, medically important ectoparasites.

scholarly journals The efficiency of universal mitochondrial DNA barcodes for species discrimination of Pomacea canaliculata and Pomacea maculata

PeerJ ◽  
2020 ◽  
Vol 8 ◽  
pp. e8755
Author(s):  
Adrian Kannan ◽  
Suganiya Rama Rao ◽  
Shyamala Ratnayeke ◽  
Yoon-Yen Yow
Keyword(s):  
16S Rdna ◽  
Dna Barcoding ◽  
Peninsular Malaysia ◽  
Coi Gene ◽  
Diagnostic Tools ◽  
Species Discrimination ◽  
Pomacea Canaliculata ◽  
Agricultural Wetlands ◽  
Barcoding Gap ◽  
Species Specific

Invasive apple snails, Pomacea canaliculata and P. maculata, have a widespread distribution globally and are regarded as devastating pests of agricultural wetlands. The two species are morphologically similar, which hinders species identification via morphological approaches and species-specific management efforts. Advances in molecular genetics may contribute effective diagnostic tools to potentially resolve morphological ambiguity. DNA barcoding has revolutionized the field of taxonomy by providing an alternative, simple approach for species discrimination, where short sections of DNA, the cytochrome c oxidase subunit I (COI) gene in particular, are used as ‘barcodes’ to delineate species boundaries. In our study, we aimed to assess the effectiveness of two mitochondrial markers, the COI and 16S ribosomal deoxyribonucleic acid (16S rDNA) markers for DNA barcoding of P. canaliculata and P. maculata. The COI and 16S rDNA sequences of 40 Pomacea specimens collected from six localities in Peninsular Malaysia were analyzed to assess their barcoding performance using phylogenetic methods and distance-based assessments. The results confirmed both markers were suitable for barcoding P. canaliculata and P. maculata. The phylogenies of the COI and 16S rDNA markers demonstrated species-specific monophyly and were largely congruent with the exception of one individual. The COI marker exhibited a larger barcoding gap (6.06–6.58%) than the 16S rDNA marker (1.54%); however, the magnitude of barcoding gap generated within the barcoding region of the 16S rDNA marker (12-fold) was bigger than the COI counterpart (approximately 9-fold). Both markers were generally successful in identifying P. canaliculata and P. maculata in the similarity-based DNA identifications. The COI + 16S rDNA concatenated dataset successfully recovered monophylies of P. canaliculata and P. maculata but concatenation did not improve individual datasets in distance-based analyses. Overall, although both markers were successful for the identification of apple snails, the COI molecular marker is a better barcoding marker and could be utilized in various population genetic studies of P. canaliculata and P. maculata.

scholarly journals Identifikasi Molekuler Kapang Asosiasi Spons menggunakan Metode DNA Barcoding

2021 ◽  
Vol 10 (1) ◽  
pp. 48-54
Author(s):  
Stefanie Jessica Henny Larasati ◽  
Agus Sabdono ◽  
Mada Triandala Sibero
Keyword(s):  
Dna Barcoding ◽  
Trichoderma Reesei ◽  
Molecular Identification ◽  
Fusarium Solani ◽  
Dna Amplification ◽  
The Body ◽  
Universal Primers ◽  
Fruiting Body Formation ◽  
Marine Biotechnology ◽  
Filter Feeders

Spons merupakan organisme yang memiliki pori-pori dan termasuk kedalam filum Porifera. Hewan ini merupakan filter feeders dimana spons menyaring makanannya masuk kedalam rongga tubuhnya, sehingga spons dapan memakan partikel organik algae, dan mikroba, termasuk kapang. Kapang merupakan mikroorganisme eukariotik dari kingdom fungi, multiseluler, menghasilkan miselium tanpa pembentukan badan buah. Kapang dapat berfungsi sebagai penjaga keseimbangan ekosistem di perairan. Tujuan dari penelitian ini adalah mengidentifikasi dua isolat kapang yang telah diisolasi dari inang spons di ekosistem mangrove dengan menggunakan DNA barcoding. Metode dalam penelitian ini yaitu peremajaan isolat, karakterisasi morfologi yaitu warna koloni, tekstur, reverse, exudates, sclerotia, bentuk konidia, konidiofor, spora, dan septa. Identifikasi molekuler dari ekstraksi DNA, amplifikasi, elektroforesis, visualisasi DNA, sekuens dan BLAST. Optimasi suhu annealing dilakukan pada amplifikasi DNA. Berdasarkan identifikasi molekuler dengan menggunakan primer universal ITS1 5' TCCGTAGGTGAACCTGCGG 3' dan ITS4 5' TCCTCCGCTTATTGATATGC 3' dan persamaan homologi, isolat MKMS 2.1 merupakan Trichoderma reesei (100%) dan PKMS 2.2 merupakan spesies Fusarium solani (99,81%). A sponge is an organism that has pores and belongs to the Porifera phylum. These animals are filter feeders where the sponge filters its food into the body cavity, so the sponge can eat organic algae particles, and microbes, including fungi. Mold is a eukaryotic microorganism from Fungi kingdom, multicellular, that forms mycelium without fruiting body formation. Mold has an important role in balancing the environmental quality in an ecosystem. The purpose of this study was to identify two molds that had been isolated from sponge in the mangrove ecosystem using DNA barcoding. The study was conducted in April-October 2019 in Laboratory of Tropical Marine Biotechnology using the experimental laboratory method. The methods in this research were isolation refreshment, morphological characterization which were consisted of colony color, texture, reverse, exudates, sclerotia, conidia, conidiophores, spores, and septa. Molecular identification consisted of DNA extraction, amplification, electrophoresis, DNA visualization, sequences and BLAST. Annealing temperature optimization is carried out on DNA amplification. Based on molecular identification using universal primers ITS1 5 'TCCGTAGGTGAACCTGCGG 3' and ITS4 5 'TCCTCCGCTTATTGATATGC 3' and homological equations, MKMS 2.1 isolates were identified as Trichoderma reesei (100%) and PKMS 2.2 were identified as Fusarium solani (99.81%).

scholarly journals New identification of the moray eel Gymnothorax minor (Temminck & Schlegel, 1846) in China (Anguilliformes, Muraenidae)

ZooKeys ◽  
2018 ◽  
Vol 752 ◽  
pp. 149-161 ◽  
Author(s):  
Yuan Li ◽  
Liyan Zhang ◽  
Linlin Zhao ◽  
Ji Feng ◽  
Karhoe Loh ◽  
...  
Keyword(s):  
South China Sea ◽  
Dna Barcoding ◽  
South China ◽  
The South China Sea ◽  
The Body ◽  
Coi Gene ◽  
Valid Species ◽  
Distribution Area ◽  
The South ◽  
China Sea

A new identification of Gymnothoraxminor (Temminck & Schlegel, 1846) is documented based on morphological characteristics and DNA barcoding. Sixty-one individuals of G.minor were collected from the East China Sea and the South China Sea. This species was previously reported as Gymnothoraxreticularis Bloch, 1795 in China because of the similarity in external shape and color. Gymnothoraxminor can be easily distinguished from G.reticularis by its color pattern of 18–20 irregular dark brown vertical bars and the body having scattered small brown spots. Additionally, the teeth are uniserial on both jaws, and the vertebrae number 137–139. By combining congener sequences of the cytochrome oxidase I (COI) gene from GenBank, two groups were detected among all the COI sequences of the currently named G.minor, which further indicated that two valid species were present based on genetic distance. A divergence also occurred on the number of vertebrae between the northern and southern populations. The phylogenetic and morphological analysis strongly supports that the northern and southern populations of G.minor are two different species. Furthermore, the distribution area of the northern G.minor has expanded southward to 5°15'N in the South China Sea. More specimens of G.minor and G.reticularis are crucial in order to define their geographical distribution boundaries and provide the correct DNA barcoding.

Ossicular homologies, systematics, and phylogenetic implications of certain North American Carboniferous asteroids (Echinodermata)

2003 ◽  
Vol 77 (3) ◽  
pp. 476-489 ◽  
Author(s):  
Daniel B. Blake ◽  
Dan R. Elliott
Keyword(s):  
Body Wall ◽  
New Genus ◽  
Prey Type ◽  
The Body ◽  
Late Paleozoic ◽  
Crown Group ◽  
Phylogenetic Implications ◽  
Phylogenetic Resolution ◽  
Defensive Mechanism

Emphereaster missouriensis new genus and species, Ambigaster, new genus, and Delicaster, new genus are assigned to the Carboniferous asteroid family Neopalaeasteridae Schuchert. The neopalaeasterids are similar to but separable from the Carboniferous Monasteridae, Calliasterellidae, and Fandasteridae, n. fam., in ambulacral and other characters. The several families indicate that late Paleozoic asteroids were diverse although poorly documented.Similarities between late Paleozoic stem-group and post-Paleozoic crown-group asteroids allow argumentation on ossicular homologies. In species with only a single row of arm marginals, an earlier suggestion that certain disk ossicles are superomarginals is rejected. Enlarged proximal adambulacrals fill space on the actinal surface whereas actinal ossicles, generally lacking in Paleozoic asteroids, provide the space-filling service in crown-group asteroids.The body wall beyond the ambulacral column and accessory ossicles traditionally have been stressed in the classification of asteroids of all ages. Because of body wall homoplasies, many older taxonomic concepts do not identify monophyletic late Paleozoic clades, nor do they indicate the derivation of the crown group. Ambulacral characters in contrast are conservative through long periods of geologic time, improving phylogenetic resolution as more taxonomic data become available. Now-available ambulacral skeletal data for certain Carboniferous genera suggest membership in lineages basal to the post-Paleozoic crown group.Emphereaster missouriensis and most neopalaeasterids are stoutly constructed suggesting a defensive mechanism against durophagous chondrichthyan fish that co-occur with the holotype of Emphereaster. Abundant sponge spicules within the disk of the holotype suggest it fed on sponges, a prey type widely exploited by living asteroids.

Sign in / Sign up

Export Citation Format

Share Document