A 5.3-kb deletion including exon XIII of the protein S alpha gene occurs in two protein S-deficient families [see comments]

Abstract Genomic DNA samples from 12 protein S-deficient families with hereditary thrombophilia were analyzed by Southern hybridization using protein S cDNA probes. Protein S-deficient members of families A and B possessed identical restriction fragment length polymorphisms, which suggest the absence of 5.3 kb from one of their protein S alpha alleles. The abnormal alleles from individuals A7 and B1 were amplified by the polymerase chain reaction using a forward primer in intron K and a reverse primer in exon XIV. The amplified DNA was cloned and sequenced. Sequence comparison with the normal protein S alpha gene showed that most of intron L (roughly 4.7 kb), the entire exon XIII (151 bp), and about a quarter of intron M (407 bp) were missing from both the A7 and B1 clones. Exon XIII contains all three potential N- glycosylation sites in human protein S. This deletion may result in RNA transcripts in which exon XII is spliced to exon XIV. Such an arrangement would generate a stop codon at position 463 and consequently produce a nonglycosylated protein S molecule truncated by 173 amino acids.

Download Full-text

A 5.3-kb deletion including exon XIII of the protein S alpha gene occurs in two protein S-deficient families [see comments]

Blood ◽

10.1182/blood.v77.3.551.bloodjournal773551 ◽

1991 ◽

Vol 77 (3) ◽

pp. 551-559

Author(s):

DK Schmidel ◽

RM Nelson ◽

EH Jr Broxson ◽

PC Comp ◽

RA Marlar ◽

...

Keyword(s):

Southern Hybridization ◽

Stop Codon ◽

Protein S ◽

Rna Transcripts ◽

Glycosylation Sites ◽

Length Polymorphisms ◽

Reverse Primer ◽

Alpha Gene ◽

Polymerase Chain ◽

Forward Primer

Genomic DNA samples from 12 protein S-deficient families with hereditary thrombophilia were analyzed by Southern hybridization using protein S cDNA probes. Protein S-deficient members of families A and B possessed identical restriction fragment length polymorphisms, which suggest the absence of 5.3 kb from one of their protein S alpha alleles. The abnormal alleles from individuals A7 and B1 were amplified by the polymerase chain reaction using a forward primer in intron K and a reverse primer in exon XIV. The amplified DNA was cloned and sequenced. Sequence comparison with the normal protein S alpha gene showed that most of intron L (roughly 4.7 kb), the entire exon XIII (151 bp), and about a quarter of intron M (407 bp) were missing from both the A7 and B1 clones. Exon XIII contains all three potential N- glycosylation sites in human protein S. This deletion may result in RNA transcripts in which exon XII is spliced to exon XIV. Such an arrangement would generate a stop codon at position 463 and consequently produce a nonglycosylated protein S molecule truncated by 173 amino acids.

Download Full-text

IDENTIFIKASI POLIMORFISME GEN GH (GROWTH HORMONE) SAPI BALI DENGAN METODE PCR-RFLP

Journal of Biological Researches ◽

10.23869/bphjbr.12.1.20062 ◽

2006 ◽

Vol 12 (1) ◽

pp. 7-11 ◽

Cited By ~ 1

Author(s):

Sri Rahayu ◽

Sutiman Bambang Sumitro ◽

T Susilawati ◽

Soemarno Soemarno

Keyword(s):

Growth Hormone ◽

Restriction Enzyme ◽

Growth Hormone Gene ◽

Salting Out ◽

Pcr Product ◽

Pcr Rflp ◽

Reverse Primer ◽

Total Dna ◽

Polymerase Chain ◽

Forward Primer

This study was conducted to identify polymorphism of growth hormone gene of Bali cattle. A PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) procedure was developed for determining polymorphism of growth hormone gene. The DNA was isolated from blood samples by salting out method. Total DNA were amplified with forward primer, 5’-TAGGGGAGGGTGGAAAATGGA-3’ and reverse primer, 5’-GACACCTACTCAGACAATGCG-3’. The PCR product was digested by HaeIII restriction enzyme. Result of the amplification was a specific single band with fragment 450 bp. Restriction with HaeIII restriction enzyme resulted four kinds of haplotype. Haplotype I was not cut by HaeIII restriction enzyme. Haplotype II were cut into two, 225 bp and 150 bp,. Haplotype III were cut into three size, 400 bp, 225 bp and 150 bp. Haplotype IV were cut into five fragments 450 bp, 400 bp, 275 bp, 225 bp and 150 bp.

Download Full-text

Primer Design and Analysis for Detection of mecA gene

Journal Of Tropical Pharmacy And Chemistry ◽

10.25026/jtpc.v5i3.297 ◽

2021 ◽

Vol 5 (3) ◽

pp. 245-253

Author(s):

Armini Syamsidi ◽

Nuur Aanisah ◽

Reyhan Fiqram ◽

Imanuel Al Jultri

Keyword(s):

Secondary Structure ◽

Dna Polymerase ◽

Base Pair ◽

Meca Gene ◽

Chain Reaction ◽

Base Sequences ◽

Reverse Primer ◽

Pcr Method ◽

Polymerase Chain ◽

Forward Primer

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method

Download Full-text

Sequence analysis of the cytochrome c oxidase subunit 1 gene of Sarcoptes scabiei isolated from goats and rabbits in East Java, Indonesia

Veterinary World ◽

10.14202/vetworld.2019.959-964 ◽

2019 ◽

Vol 12 (7) ◽

pp. 959-964

Author(s):

Nunuk Dyah Retno Lastuti ◽

Ali Rohman ◽

Didik Handiyatno ◽

Dony Chrismanto ◽

Kurnia Desiandura

Keyword(s):

Cytochrome C ◽

Cytochrome C Oxidase ◽

Dna Sequences ◽

Educational Software ◽

Sarcoptes Scabiei ◽

Pcr Products ◽

Reverse Primer ◽

Polymerase Chain ◽

Cox 1 ◽

Forward Primer

Aim: This study aimed to sequence the Cytochrome c oxidase (COX-1) gene sequence from mitochondrial DNA of Sarcoptes scabiei isolated from Lamongan goats and Mojokerto rabbits, align it with DNA isolated from Zi'gong rabbit (GenBank accession No. EU256389.1), and produce a phylogenetic analysis of S. scabiei COX-1 gene. Materials and Methods: S. scabiei mites were obtained from goats and rabbits, and DNA was extracted using QIAamp DNA Mini Kit. The forward and reverse primer sequences were designed based on the DNA sequence of an S. scabiei COX-1 gene isolated from the Zi'gong rabbit (5'-TCTTAGGGGCTGGATTTAGTATG-3' and 5'-AGTTCCTCTACCAGTTCCAC-3', respectively). To confirm sequencing output, the sequence resulting from the reverse primer was inverted and aligned to the sequence from the forward primer using Clone Manager Professional Version 9 for Windows (Scientific & Educational Software; http://www.scied.com). This alignment was subsequently used to build a phylogenetic tree, using the Neighbor- Joining method, in the MEGA6 program (https://www.megasoftware.net/). Results: Polymerase chain reaction (PCR) products from S. scabiei isolates from Lamongan goats and Mojokerto rabbits produced bands of around 290 bp with 2% agarose gel electrophoresis. Comparing the DNA sequences of the S. scabiei COX-1 gene with those isolated from Lamongan goats and Mojokerto rabbits showed 99% homology. Conclusion: PCR products of the S. scabiei COX-1 gene isolated from Lamongan goats and Mojokerto rabbits were around 290 bp long. The sequences had more than 99% homology. The sequences of the COX-1 gene of S. scabiei from Lamongan goats and Mojokerto rabbits were relatively close to the sequence of the gene in S. scabiei obtained from various hosts according to National Center for Biotechnology Information data.

Download Full-text

Disentangling primer interactions improves SARS-CoV-2 genome sequencing by the ARTIC Network’s multiplex PCR

10.1101/2020.03.10.985150 ◽

2020 ◽

Cited By ~ 12

Author(s):

Kentaro Itokawa ◽

Tsuyoshi Sekizuka ◽

Masanori Hashino ◽

Rina Tanaka ◽

Makoto Kuroda

Keyword(s):

Whole Genome Amplification ◽

Clinical Samples ◽

Chain Reaction ◽

Viral Loads ◽

Amplification Bias ◽

Reverse Primer ◽

Polymerase Chain ◽

Novel Coronavirus ◽

Low Coverage ◽

Forward Primer

AbstractSince December 2019, the coronavirus disease 2019 (COVID-19) caused by a novel coronavirus SARS-CoV-2 has rapidly spread to almost every nation in the world. Soon after the pandemic was recognized by epidemiologists, a group of biologists comprising the ARTIC Network, has devised a multiplexed polymerase chain reaction (PCR) protocol and primer set for targeted whole-genome amplification of SARS-CoV-2. The ARTIC primer set amplifies 98 amplicons, which are separated only in two PCRs, across a nearly entire viral genome. The original primer set and protocol showed a fairly small amplification bias when clinical samples with relatively high viral loads were used. However, when sample’s viral load was low, several amplicons, especially amplicons 18 and 76, exhibited low coverage or complete dropout. We have determined that these dropouts were due to a dimer formation between the forward primer for amplicon 18, 18_LEFT, and the reverse primer for amplicon 76, 76_RIGHT. Replacement of 76_RIGHT with an alternatively designed primer was sufficient to produce a drastic improvement in coverage of both amplicons. Based on this result, we replaced 12 primers in total in the ARTIC primer set that were predicted to be involved in 14 primer interactions. The resulting primer set, version N1 (NIID-1), exhibits improved overall coverage compared to the ARTIC Network’s original (V1) and modified (V3) primer set.

Download Full-text

Amplifikasi DNA Kandidat Gen Kuda Pacu Sumba

JURNAL KAJIAN VETERINER ◽

10.35508/jkv.v9i1.3901 ◽

2021 ◽

Vol 9 (1) ◽

pp. 13-20

Author(s):

Cynthia Dewi Gaina ◽

Frits B. H. Francis

Keyword(s):

Candidate Genes ◽

Fragment Size ◽

Dna Amplification ◽

Local Alignment ◽

Main Role ◽

Reverse Primer ◽

Polymerase Chain ◽

Blast Result ◽

Selection Of ◽

Forward Primer

The Sumba horse is one of the local horses in Indonesia which is known as racing horse Several candidate genes are known to influence the outward characteristics of the Sumba racehorse, which play main role in the development of the horse's muscles from embryo to adulthood. This research aims to identify candidate genes for the Sumba racehorse in stallion and mares. Blood samples from 5 stallions and 5 mares were collected and analyzed. The method used in this research was by using polymerase chain reaction (PCR), electrophoresis and DNA sequencing. The results of DNA amplification fragments at a temperature of 600c showed a fragment size of 463 bp. A total of 10 samples were sequenced on the PCR machine. The forward primer was 5'-TATTCTTCTTGGGAGGGAGGACTACT-3 'and reverse primer was 5'-GCAAGTAATTAGCACAAAAATTTGAATG-3'. The obtained data was analyzed using the Basic Local Alignment Sealing Tool (BLAST). Result of this study could be used as an initial identification of candidate genes for racing activity in stallion and mares that can complement the selection of racing horses.

Download Full-text

RT-PCR Detection of Seedborne Cowpea aphid-borne mosaic virus in Peanut

Plant Disease ◽

10.1094/pdis.2001.85.11.1181 ◽

2001 ◽

Vol 85 (11) ◽

pp. 1181-1182 ◽

Cited By ~ 13

Author(s):

A. G. Gillaspie ◽

G. Pio-Ribeiro ◽

G. P. Andrade ◽

H. R. Pappu

Keyword(s):

Mosaic Virus ◽

Sequence Data ◽

Enzyme Linked Immunosorbent Assay ◽

Infected Leaf ◽

Rt Pcr ◽

Coat Protein Region ◽

Cowpea Aphid ◽

Reverse Primer ◽

Polymerase Chain ◽

Forward Primer

The Brazilian strain of Cowpea aphid-borne mosaic virus (CABMV) is a severe pathogen in peanut and a significant problem when distributing germ plasm to other countries. The virus is seedborne at approximately 0.15% in peanut, depending upon the cultivar, and its detection in seed lots would strengthen quarantine programs. Utilizing 3′ sequence data (GenBank Accession #AF241233), primers were designed from the coat protein region and evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Use of the forward primer 5′-CGCTCAAACCCATTGTAGAA-3′ and reverse primer 5′-TATTGCTTCCCTTGCTCTTTC-3′ yielded a 221-bp product. Extracts of thick seed slices and a sample size of 12 to 25 seed showed no significant advantage of RT-PCR over enzyme-linked immunosorbent assay (ELISA) in tests of large seed lots. However, RT-PCR detected more virus in seed than in the number of infected seedlings normally arising in germination tests. Also, RT-PCR was extremely sensitive and detected 1 infected leaf among 99 healthy leaves. In contrast, ELISA detected only one infected leaf among nine healthy leaves.

Download Full-text

POLYMORPHISMS OF ENDOTHELIAL DYSFUNCTION GENES NOS3 AND CYBA IN YAKUT POPULATION

Bulletin Biomedicine and sociology ◽

10.26787/nydha-2618-8783-2020-5-4-20-25 ◽

2020 ◽

pp. 20-25

Author(s):

Soloveva Yu.A. ◽

Borisova N.V.

Keyword(s):

Endothelial Dysfunction ◽

Coronary Syndrome ◽

Pathological Conditions ◽

Nos3 Gene ◽

Yakut Population ◽

Length Polymorphisms ◽

Pcr Rflp ◽

Polymerase Chain ◽

The Republic ◽

Cyba Gene

Polymorphisms of different genes can predispose people to various diseases. They can influence the body's physiological response to exogenous risk factors. Polymorphisms of the endothelial dysfunction genes NOS3 and CYBA contribute to the development of socially significant diseases, such as acute coronary syndrome, stroke, as well as diseases accompanied by fibrotic changes (cirrhosis of the liver, pulmonary fibrosis, etc.). Therefore, the study of these genes in the Yakut population seems relevant. The present study involved 124 healthy volunteers, their ethnicity is Yakuts (including Yakuts in the third generation, living in the Republic of Sakha (Yakutia)). Genetic analysis of polymorphisms was performed by the method of polymerase chain reaction of restriction fragment length polymorphisms (PCR-RFLP). The study found that healthy Yakuts have GG homozygote of rs1799983 of the NOS3 gene in 83.87%, GT - 15.32%, TT - 0.81%. The frequency of the G allele was 91.53%, the T allele - 8.47%. The study found that healthy Yakuts have CC homozygote of rs4673 of the CYBA gene in 75.0%, CT - 21.77%, TT - 3.23%. The frequency of C allele was 91.44%, T - 8.56%. These results are consistent with the literature data. Thus, the research of the polymorphism rs1799983 of the NOS3 gene and rs4673 of the CYBA gene in various ethnic groups could have encouraging prospects in the personalized medicine for predicting pathological conditions associated with endothelial dysfunction: liver fibrosis, cardiovascular diseases, obstetric and gynecological pathologies, dysfunctions of various organs and systems.

Download Full-text

Abundant Mitochondrial Genome Diversity, Population Differentiation and Convergent Evolution in Pines

Genetics ◽

10.1093/genetics/150.4.1605 ◽

1998 ◽

Vol 150 (4) ◽

pp. 1605-1614

Author(s):

Junyuan Wu ◽

Konstantin V Krutovskii ◽

Steven H Strauss

Keyword(s):

Mitochondrial Dna ◽

Population Differentiation ◽

Mitochondrial Gene ◽

Dna Polymorphisms ◽

Neighbor Joining ◽

Closely Related Species ◽

Breeding Programs ◽

Length Polymorphisms ◽

Polymerase Chain ◽

Mitochondrial Genome Diversity

Abstract We examined mitochondrial DNA polymorphisms via the analysis of restriction fragment length polymorphisms in three closely related species of pines from western North America: knobcone (Pinus attenuata Lemm.), Monterey (P. radiata D. Don), and bishop (P. muricata D. Don). A total of 343 trees derived from 13 populations were analyzed using 13 homologous mitochondrial gene probes amplified from three species by polymerase chain reaction. Twenty-eight distinct mitochondrial DNA haplotypes were detected and no common haplotypes were found among the species. All three species showed limited variability within populations, but strong differentiation among populations. Based on haplotype frequencies, genetic diversity within populations (HS) averaged 0.22, and population differentiation (GST and θ) exceeded 0.78. Analysis of molecular variance also revealed that >90% of the variation resided among populations. For the purposes of genetic conservation and breeding programs, species and populations could be readily distinguished by unique haplotypes, often using the combination of only a few probes. Neighbor-joining phenograms, however, strongly disagreed with those based on allozymes, chloroplast DNA, and morphological traits. Thus, despite its diagnostic haplotypes, the genome appears to evolve via the rearrangement of multiple, convergent subgenomic domains.

Download Full-text