scholarly journals Amplifikasi DNA Kandidat Gen Kuda Pacu Sumba

2021 ◽  
Vol 9 (1) ◽  
pp. 13-20
Author(s):  
Cynthia Dewi Gaina ◽  
Frits B. H. Francis
Keyword(s):  
Candidate Genes ◽  
Fragment Size ◽  
Dna Amplification ◽  
Local Alignment ◽  
Main Role ◽  
Reverse Primer ◽  
Polymerase Chain ◽  
Blast Result ◽  
Selection Of ◽  
Forward Primer

The Sumba horse is one of the local horses in Indonesia which is known as racing horse Several candidate genes are known to influence the outward characteristics of the Sumba racehorse, which play main role in the development of the horse's muscles from embryo to adulthood. This research aims to identify candidate genes for the Sumba racehorse in stallion and mares. Blood samples from 5 stallions and 5 mares were collected and analyzed. The method used in this research was by using polymerase chain reaction (PCR), electrophoresis and DNA sequencing. The results of DNA amplification fragments at a temperature of 600c showed a fragment size of 463 bp. A total of 10 samples were sequenced on the PCR machine. The forward primer was 5'-TATTCTTCTTGGGAGGGAGGACTACT-3 'and reverse primer was 5'-GCAAGTAATTAGCACAAAAATTTGAATG-3'. The obtained data was analyzed using the Basic Local Alignment Sealing Tool (BLAST). Result of this study could be used as an initial identification of candidate genes for racing activity in stallion and mares that can complement the selection of racing horses.

scholarly journals IDENTIFIKASI POLIMORFISME GEN GH (GROWTH HORMONE) SAPI BALI DENGAN METODE PCR-RFLP

2006 ◽  
Vol 12 (1) ◽  
pp. 7-11 ◽  
Author(s):  
Sri Rahayu ◽  
Sutiman Bambang Sumitro ◽  
T Susilawati ◽  
Soemarno Soemarno
Keyword(s):  
Growth Hormone ◽  
Restriction Enzyme ◽  
Growth Hormone Gene ◽  
Salting Out ◽  
Pcr Product ◽  
Pcr Rflp ◽  
Reverse Primer ◽  
Total Dna ◽  
Polymerase Chain ◽  
Forward Primer

This study was conducted to identify polymorphism of growth hormone gene of Bali cattle. A PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) procedure was developed for determining polymorphism of growth hormone gene. The DNA was isolated from blood samples by salting out method. Total DNA were amplified with forward primer, 5’-TAGGGGAGGGTGGAAAATGGA-3’ and reverse primer, 5’-GACACCTACTCAGACAATGCG-3’. The PCR product was digested by HaeIII restriction enzyme. Result of the amplification was a specific single band with fragment 450 bp. Restriction with HaeIII restriction enzyme resulted four kinds of haplotype. Haplotype I was not cut by HaeIII restriction enzyme. Haplotype II were cut into two, 225 bp and 150 bp,. Haplotype III were cut into three size, 400 bp, 225 bp and 150 bp. Haplotype IV were cut into five fragments 450 bp, 400 bp, 275 bp, 225 bp and 150 bp.

scholarly journals Primer Design and Analysis for Detection of mecA gene

2021 ◽  
Vol 5 (3) ◽  
pp. 245-253
Author(s):  
Armini Syamsidi ◽  
Nuur Aanisah ◽  
Reyhan Fiqram ◽  
Imanuel Al Jultri
Keyword(s):  
Secondary Structure ◽  
Dna Polymerase ◽  
Base Pair ◽  
Meca Gene ◽  
Chain Reaction ◽  
Base Sequences ◽  
Reverse Primer ◽  
Pcr Method ◽  
Polymerase Chain ◽  
Forward Primer

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method

scholarly journals Sequence analysis of the cytochrome c oxidase subunit 1 gene of Sarcoptes scabiei isolated from goats and rabbits in East Java, Indonesia

2019 ◽  
Vol 12 (7) ◽  
pp. 959-964
Author(s):  
Nunuk Dyah Retno Lastuti ◽  
Ali Rohman ◽  
Didik Handiyatno ◽  
Dony Chrismanto ◽  
Kurnia Desiandura
Keyword(s):  
Cytochrome C ◽  
Cytochrome C Oxidase ◽  
Dna Sequences ◽  
Educational Software ◽  
Sarcoptes Scabiei ◽  
Pcr Products ◽  
Reverse Primer ◽  
Polymerase Chain ◽  
Cox 1 ◽  
Forward Primer

Aim: This study aimed to sequence the Cytochrome c oxidase (COX-1) gene sequence from mitochondrial DNA of Sarcoptes scabiei isolated from Lamongan goats and Mojokerto rabbits, align it with DNA isolated from Zi'gong rabbit (GenBank accession No. EU256389.1), and produce a phylogenetic analysis of S. scabiei COX-1 gene. Materials and Methods: S. scabiei mites were obtained from goats and rabbits, and DNA was extracted using QIAamp DNA Mini Kit. The forward and reverse primer sequences were designed based on the DNA sequence of an S. scabiei COX-1 gene isolated from the Zi'gong rabbit (5'-TCTTAGGGGCTGGATTTAGTATG-3' and 5'-AGTTCCTCTACCAGTTCCAC-3', respectively). To confirm sequencing output, the sequence resulting from the reverse primer was inverted and aligned to the sequence from the forward primer using Clone Manager Professional Version 9 for Windows (Scientific & Educational Software; http://www.scied.com). This alignment was subsequently used to build a phylogenetic tree, using the Neighbor- Joining method, in the MEGA6 program (https://www.megasoftware.net/). Results: Polymerase chain reaction (PCR) products from S. scabiei isolates from Lamongan goats and Mojokerto rabbits produced bands of around 290 bp with 2% agarose gel electrophoresis. Comparing the DNA sequences of the S. scabiei COX-1 gene with those isolated from Lamongan goats and Mojokerto rabbits showed 99% homology. Conclusion: PCR products of the S. scabiei COX-1 gene isolated from Lamongan goats and Mojokerto rabbits were around 290 bp long. The sequences had more than 99% homology. The sequences of the COX-1 gene of S. scabiei from Lamongan goats and Mojokerto rabbits were relatively close to the sequence of the gene in S. scabiei obtained from various hosts according to National Center for Biotechnology Information data.

scholarly journals A 5.3-kb deletion including exon XIII of the protein S alpha gene occurs in two protein S-deficient families [see comments]

Blood ◽  
1991 ◽  
Vol 77 (3) ◽  
pp. 551-559 ◽  
Author(s):  
DK Schmidel ◽  
RM Nelson ◽  
EH Jr Broxson ◽  
PC Comp ◽  
RA Marlar ◽  
...  
Keyword(s):  
Southern Hybridization ◽  
Stop Codon ◽  
Protein S ◽  
Rna Transcripts ◽  
Glycosylation Sites ◽  
Length Polymorphisms ◽  
Reverse Primer ◽  
Alpha Gene ◽  
Polymerase Chain ◽  
Forward Primer

Abstract Genomic DNA samples from 12 protein S-deficient families with hereditary thrombophilia were analyzed by Southern hybridization using protein S cDNA probes. Protein S-deficient members of families A and B possessed identical restriction fragment length polymorphisms, which suggest the absence of 5.3 kb from one of their protein S alpha alleles. The abnormal alleles from individuals A7 and B1 were amplified by the polymerase chain reaction using a forward primer in intron K and a reverse primer in exon XIV. The amplified DNA was cloned and sequenced. Sequence comparison with the normal protein S alpha gene showed that most of intron L (roughly 4.7 kb), the entire exon XIII (151 bp), and about a quarter of intron M (407 bp) were missing from both the A7 and B1 clones. Exon XIII contains all three potential N- glycosylation sites in human protein S. This deletion may result in RNA transcripts in which exon XII is spliced to exon XIV. Such an arrangement would generate a stop codon at position 463 and consequently produce a nonglycosylated protein S molecule truncated by 173 amino acids.

scholarly journals A 5.3-kb deletion including exon XIII of the protein S alpha gene occurs in two protein S-deficient families [see comments]

Blood ◽  
1991 ◽  
Vol 77 (3) ◽  
pp. 551-559
Author(s):  
DK Schmidel ◽  
RM Nelson ◽  
EH Jr Broxson ◽  
PC Comp ◽  
RA Marlar ◽  
...  
Keyword(s):  
Southern Hybridization ◽  
Stop Codon ◽  
Protein S ◽  
Rna Transcripts ◽  
Glycosylation Sites ◽  
Length Polymorphisms ◽  
Reverse Primer ◽  
Alpha Gene ◽  
Polymerase Chain ◽  
Forward Primer

Genomic DNA samples from 12 protein S-deficient families with hereditary thrombophilia were analyzed by Southern hybridization using protein S cDNA probes. Protein S-deficient members of families A and B possessed identical restriction fragment length polymorphisms, which suggest the absence of 5.3 kb from one of their protein S alpha alleles. The abnormal alleles from individuals A7 and B1 were amplified by the polymerase chain reaction using a forward primer in intron K and a reverse primer in exon XIV. The amplified DNA was cloned and sequenced. Sequence comparison with the normal protein S alpha gene showed that most of intron L (roughly 4.7 kb), the entire exon XIII (151 bp), and about a quarter of intron M (407 bp) were missing from both the A7 and B1 clones. Exon XIII contains all three potential N- glycosylation sites in human protein S. This deletion may result in RNA transcripts in which exon XII is spliced to exon XIV. Such an arrangement would generate a stop codon at position 463 and consequently produce a nonglycosylated protein S molecule truncated by 173 amino acids.

scholarly journals Disentangling primer interactions improves SARS-CoV-2 genome sequencing by the ARTIC Network’s multiplex PCR

2020 ◽  
Author(s):  
Kentaro Itokawa ◽  
Tsuyoshi Sekizuka ◽  
Masanori Hashino ◽  
Rina Tanaka ◽  
Makoto Kuroda
Keyword(s):  
Whole Genome Amplification ◽  
Clinical Samples ◽  
Chain Reaction ◽  
Viral Loads ◽  
Amplification Bias ◽  
Reverse Primer ◽  
Polymerase Chain ◽  
Novel Coronavirus ◽  
Low Coverage ◽  
Forward Primer

AbstractSince December 2019, the coronavirus disease 2019 (COVID-19) caused by a novel coronavirus SARS-CoV-2 has rapidly spread to almost every nation in the world. Soon after the pandemic was recognized by epidemiologists, a group of biologists comprising the ARTIC Network, has devised a multiplexed polymerase chain reaction (PCR) protocol and primer set for targeted whole-genome amplification of SARS-CoV-2. The ARTIC primer set amplifies 98 amplicons, which are separated only in two PCRs, across a nearly entire viral genome. The original primer set and protocol showed a fairly small amplification bias when clinical samples with relatively high viral loads were used. However, when sample’s viral load was low, several amplicons, especially amplicons 18 and 76, exhibited low coverage or complete dropout. We have determined that these dropouts were due to a dimer formation between the forward primer for amplicon 18, 18_LEFT, and the reverse primer for amplicon 76, 76_RIGHT. Replacement of 76_RIGHT with an alternatively designed primer was sufficient to produce a drastic improvement in coverage of both amplicons. Based on this result, we replaced 12 primers in total in the ARTIC primer set that were predicted to be involved in 14 primer interactions. The resulting primer set, version N1 (NIID-1), exhibits improved overall coverage compared to the ARTIC Network’s original (V1) and modified (V3) primer set.

scholarly journals RT-PCR Detection of Seedborne Cowpea aphid-borne mosaic virus in Peanut

Plant Disease ◽  
2001 ◽  
Vol 85 (11) ◽  
pp. 1181-1182 ◽  
Author(s):  
A. G. Gillaspie ◽  
G. Pio-Ribeiro ◽  
G. P. Andrade ◽  
H. R. Pappu
Keyword(s):  
Mosaic Virus ◽  
Sequence Data ◽  
Enzyme Linked Immunosorbent Assay ◽  
Infected Leaf ◽  
Rt Pcr ◽  
Coat Protein Region ◽  
Cowpea Aphid ◽  
Reverse Primer ◽  
Polymerase Chain ◽  
Forward Primer

The Brazilian strain of Cowpea aphid-borne mosaic virus (CABMV) is a severe pathogen in peanut and a significant problem when distributing germ plasm to other countries. The virus is seedborne at approximately 0.15% in peanut, depending upon the cultivar, and its detection in seed lots would strengthen quarantine programs. Utilizing 3′ sequence data (GenBank Accession #AF241233), primers were designed from the coat protein region and evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Use of the forward primer 5′-CGCTCAAACCCATTGTAGAA-3′ and reverse primer 5′-TATTGCTTCCCTTGCTCTTTC-3′ yielded a 221-bp product. Extracts of thick seed slices and a sample size of 12 to 25 seed showed no significant advantage of RT-PCR over enzyme-linked immunosorbent assay (ELISA) in tests of large seed lots. However, RT-PCR detected more virus in seed than in the number of infected seedlings normally arising in germination tests. Also, RT-PCR was extremely sensitive and detected 1 infected leaf among 99 healthy leaves. In contrast, ELISA detected only one infected leaf among nine healthy leaves.

scholarly journals Distinct Roles of Vav Family Members in Adaptive and Innate Immune Models of Arthritis

Biomedicines ◽  
2021 ◽  
Vol 9 (6) ◽  
pp. 695
Author(s):  
Javier Conde ◽  
Isabel Fernández-Pisonero ◽  
Myriam Cuadrado ◽  
Antonio Abad ◽  
Javier Robles-Valero ◽  
...  
Keyword(s):  
Rheumatoid Arthritis ◽  
T Cells ◽  
Family Members ◽  
Experimental Models ◽  
Innate Immune ◽  
Main Role ◽  
Zymosan A ◽  
Proliferation And Differentiation ◽  
Signal Transduction Proteins ◽  
Selection Of

Genetic evidence suggests that three members of the VAV family (VAV1, VAV2 and VAV3) of signal transduction proteins could play important roles in rheumatoid arthritis. However, it is not known currently whether the inhibition of these proteins protects against this disease and, if so, the number of family members that must be eliminated to get a therapeutic impact. To address this issue, we have used a collection of single and compound Vav family knockout mice in experimental models for antigen-dependent (methylated bovine serum albumin injections) and neutrophil-dependent (Zymosan A injections) rheumatoid arthritis in mice. We show here that the specific elimination of Vav1 is sufficient to block the development of antigen-induced arthritis. This protection is likely associated with the roles of this Vav family member in the development and selection of immature T cells within the thymus as well as in the subsequent proliferation and differentiation of effector T cells. By contrast, we have found that depletion of Vav2 reduces the number of neutrophils present in the joints of Zymosan A-treated mice. Despite this, the elimination of Vav2 does not protect against the joint degeneration triggered by this experimental model. These findings indicate that Vav1 is the most important pharmacological target within this family, although its main role is limited to the protection against antigen-induced rheumatoid arthritis. They also indicate that the three Vav family proteins do not play redundant roles in these pathobiological processes.

scholarly journals Hospital-Based Donor Recruitment and Predonation Serologic Testing for COVID-19 Convalescent Plasma

2021 ◽  
Author(s):  
Joanna Balcerek ◽  
Evelin Trejo ◽  
Kendall Levine ◽  
Paul Couey ◽  
Zoe V Kornberg ◽  
...  
Keyword(s):  
Blood Donation ◽  
High Titer ◽  
Igg Antibodies ◽  
Serologic Testing ◽  
Wide Range ◽  
The Us ◽  
Polymerase Chain ◽  
Igg Level ◽  
Donor Recruitment ◽  
Selection Of

Abstract Objectives Serologic testing for antibodies to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in potential donors of coronavirus disease 2019 (COVID-19) convalescent plasma (CCP) may not be performed until after blood donation. A hospital-based recruitment program for CCP may be an efficient way to identify potential donors prospectively Methods Patients who recovered from known or suspected COVID-19 were identified and recruited through medical record searches and public appeals in March and April 2020. Participants were screened with a modified donor history questionnaire and, if eligible, were asked for consent and tested for SARS-CoV-2 antibodies (IgG and IgM). Participants positive for SARS-CoV-2 IgG were referred for CCP collection. Results Of 179 patients screened, 128 completed serologic testing and 89 were referred for CCP donation. IgG antibodies to SARS-CoV-2 were detected in 23 of 51 participants with suspected COVID-19 and 66 of 77 participants with self-reported COVID-19 confirmed by polymerase chain reaction (PCR). The anti–SARS-CoV-2 IgG level met the US Food and Drug Administration criteria for “high-titer” CCP in 39% of participants confirmed by PCR, as measured by the Ortho VITROS IgG assay. A wide range of SARS-CoV-2 IgG levels were observed. Conclusions A hospital-based CCP donor recruitment program can prospectively identify potential CCP donors. Variability in SARS-CoV-2 IgG levels has implications for the selection of CCP units for transfusion.

scholarly journals Easy and Efficient DNA Extraction from Woody Plants for the Detection of Phytoplasmas by Polymerase Chain Reaction

Plant Disease ◽  
1999 ◽  
Vol 83 (5) ◽  
pp. 482-485 ◽  
Author(s):  
Margaret J. Green ◽  
Dan A. Thompson ◽  
Donald J. MacKenzie
Keyword(s):  
Polymerase Chain Reaction ◽  
Plant Material ◽  
Woody Plant ◽  
Leaf Roll ◽  
Chain Reaction ◽  
Efficient Procedure ◽  
Identical Manner ◽  
Total Dna ◽  
Polymerase Chain ◽  
Selection Of

A simple and efficient procedure for the extraction of high-quality DNA from phytoplasma-infected woody and herbaceous plants for polymerase chain reaction (PCR) detection is described. This procedure does not require phenol, chloroform, or alcohol for the precipitation of nucleic acids. Herbaceous and woody plant material are extracted in an identical manner with no additional purification or enrichment steps required. The method utilizes commercially available microspin-column matrices, and the extraction of total DNA can be achieved in less than 1 h. The method has been used to successfully purify phytoplasma DNA from whole leaves, leaf petioles and midribs, roots, and dormant wood from a diverse selection of plant material. The phytoplasmas detected by PCR include pear decline, western X-disease, peach yellow leaf roll, peach rosette, apple proliferation, Australian grapevine yellows, and Vaccinium witches'-broom.

Sign in / Sign up

Export Citation Format

Share Document