scholarly journals A molecular marker set combining a retrotransposon insertion and SSR polymorphisms is useful for assessing diversity in Vitis

OENO One ◽  
2021 ◽  
Vol 55 (2) ◽  
pp. 403-414
Author(s):  
Frederique Pelsy ◽  
Lucie Bevilacqua ◽  
Sophie Blanc ◽  
Didier Merdinoglu
Keyword(s):  
Molecular Markers ◽  
Molecular Marker ◽  
Phylogenetic Relationships ◽  
Genetic Material ◽  
Dna Polymorphisms ◽  
Heterozygous State ◽  
Empty Site ◽  
Microsatellite Sequence ◽  
Vitis Species ◽  
Ssr Polymorphism

Molecular markers, based on DNA polymorphisms, are useful tools for identifying individuals, establishing phylogenetic relationships, managing collections of genetic material or assisting breeding. In the present study, we developed a marker set to differentiate Vitis species, grapevine varieties or clones belonging to the same variety. This novel marker set combines, in four PCR amplifications, the presence/absence of a remarkable retrotransposon, Tvv1-Δ3460, inserted at its single locus and the SSR polymorphism present within its two LTRs. By studying a collection of Vitaceaeaccessions, we showed the prevalence of two allelic forms of Tvv1-Δ3460 - one of which was partially truncated - in Vitis species. Out of the twenty-five studied Vitis species, the insertion of a Tvv1-Δ3460 element was detected in twenty, including Vitis vinifera. The homozygous vs heterozygous state of the element insertion was determined by amplifying the empty site. Additionally, each Tvv1-Δ3460 LTRs included a microsatellite sequence useful for designing markers based on LTR length. The LTR-SSR markers distinguished most of the fifty-two cultivars and revealed polymorphism within five of the seven varieties studied.

Analysis of molecular marker expression reveals neuronal homology in distantly related arthropods

Development ◽  
1999 ◽  
Vol 126 (11) ◽  
pp. 2327-2334 ◽  
Author(s):  
M. Duman-Scheel ◽  
N.H. Patel
Keyword(s):  
Stem Cells ◽  
Transcription Factors ◽  
Molecular Markers ◽  
Molecular Marker ◽  
Neural Stem Cells ◽  
Phylogenetic Relationships ◽  
Brine Shrimp ◽  
Arthropod Species ◽  
Morphological Studies ◽  
Embryonic Cns

Morphological studies suggest that insects and crustaceans of the Class Malacostraca (such as crayfish) share a set of homologous neurons. However, expression of molecular markers in these neurons has not been investigated, and the homology of insect and malacostracan neuroblasts, the neural stem cells that produce these neurons, has been questioned. Furthermore, it is not known whether crustaceans of the Class Branchiopoda (such as brine shrimp) or arthropods of the Order Collembola (springtails) possess neurons that are homologous to those of other arthropods. Assaying expression of molecular markers in the developing nervous systems of various arthropods could resolve some of these issues. Here, we examine expression of Even-skipped and Engrailed, two transcription factors that serve as insect embryonic CNS markers, across a number of arthropod species. This molecular analysis allows us to verify the homology of previously identified malacostracan neurons and to identify additional homologous neurons in malacostracans, collembolans and branchiopods. Engrailed expression in the neural stem cells of a number of crustaceans was also found to be conserved. We conclude that despite their distant phylogenetic relationships and divergent mechanisms of neurogenesis, insects, malacostracans, branchiopods and collembolans share many common CNS components.

Polymorphism of the СоІІ gene of honey bees in the western regions of Ukraine

2020 ◽  
Vol 12 (2) ◽  
pp. 174-179
Author(s):  
Oleksandr Cherevatov ◽  
Nadiia Roshka
Keyword(s):  
Molecular Markers ◽  
Apis Mellifera ◽  
Cytochrome Oxidase ◽  
Honey Bees ◽  
Molecular Taxonomy ◽  
Genetic Material ◽  
Gene Encoding ◽  
Geographical Regions ◽  
Coii Gene ◽  
Mitochondrial Cytochrome Oxidase

Due to active human intervention in natural genetic and population processes, survival and distribution areas of honey bees have been negatively affected. Preservation of the gene pool of aboriginal bees that are well adapted to local environmental conditions is an urgent problem that cannot be solved without the use of molecular methods to monitor the genetic composition of local populations. This type of research requires the use of state-of-the-art approaches based on application of molecular markers. In the molecular taxonomy of insects, mitochondrial cytochrome oxidase genes are widely used to identify closely related forms. The peculiarity of mtDNA is that it is maternally inherited, and the mitochondrial molecular markers are not separated by recombination. The СоІІ gene encoding the second subunit of cytochrome oxidase is widely used to descriminate the subspecies of honey bee. Therefore, to assess the distribution of different subspecies / breeds of Apis mellifera in Ukraine, the 5′-region of the СоІІ gene was sequenced and compared for bees from different geographical regions. In the CoII gene, base substitutions were found, which makes it possible to distinguish between honey bees of the Carpathian and Ukrainian steppe breeds, which are widespread in Ukraine. It has been revealed that the distribution of these breeds does not always correspond to the official zoning. The widespread practice in Ukraine of transporting the genetic material of Apis mellifera from different regions leads to uncontrolled hybridization and poses a threat to the preservation of aboriginal breeds of honey bees.

Assessment of Genetic Diversity of Rheum species (Endangered Medicinal Herb of Indian Himalayan Region) using Molecular Markers

2021 ◽  
Vol 16 (11) ◽  
pp. 147-154
Author(s):  
Anjali Uniyal ◽  
Akhilesh Kumar ◽  
Sweta Upadhyay ◽  
Vijay Kumar ◽  
Sanjay Gupta
Keyword(s):  
Genetic Diversity ◽  
Molecular Markers ◽  
Fragment Length Polymorphism ◽  
Dna Polymorphisms ◽  
Inter Simple Sequence Repeats ◽  
Pharmaceutical Industries ◽  
Endangered Medicinal Herb ◽  
Identification And Characterization ◽  
Simple Sequence

The Rheum species are important medicinal plants that are facing extinction due to their unplanned development and overexploitation by pharmaceutical industries. DNA polymorphisms are not prone to environmental modifications, thus they are widely used for the identification and characterization of plants. The use of different molecular markers has enabled the researchers for the valuation of genetic variability and diversity in its natural zone of distribution. The conventional approach may take several years to yield this information. For the estimation of molecular and genetic variations in geographical zone of distribution, various molecular markers technique are available like RAPD (Randomly Amplified Polymorphic DNA), RFLP (Restriction fragment length polymorphism), ISSR (Inter-Simple Sequence Repeats), SSR and AFLP. The uses of different molecular markers for the study of genetic diversity have been discussed in the review.

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

Jurnal BIOMA ◽  
2017 ◽  
Vol 13 (1) ◽  
pp. 33-36
Author(s):  
Rini Puspitaningrum ◽  
Ria Amelia ◽  
Adisyahputra Adisyahputra
Keyword(s):  
Molecular Markers ◽  
Glycine Max ◽  
Molecular Marker ◽  
Pcr Amplification ◽  
Housekeeping Gene ◽  
Descriptive Study ◽  
Gene Fragment ◽  
Lectin Gene ◽  
Glycine Max L

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.

scholarly journals Identification of stem rust resistance genes in wheat cultivars in China using molecular markers

PeerJ ◽  
2018 ◽  
Vol 6 ◽  
pp. e4882 ◽  
Author(s):  
Xiaofeng Xu ◽  
Depeng Yuan ◽  
Dandan Li ◽  
Yue Gao ◽  
Ziyuan Wang ◽  
...  
Keyword(s):  
Molecular Markers ◽  
Resistance Genes ◽  
Stem Rust ◽  
Rust Resistance ◽  
Genetic Material ◽  
Stem Rust Resistance ◽  
Wheat Cultivars ◽  
Wheat Stem Rust ◽  
Stem Rust Resistance Genes ◽  
Rust Resistance Genes

Wheat stem rust caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn. (Pgt), is a major disease that has been effectively controlled using resistance genes. The appearance and spread of Pgt races such as Ug99, TKTTF, and TTTTF, which are virulent to most stem rust-resistant genes currently deployed in wheat breeding programs, renewed the interest in breeding cultivars resistant to wheat stem rust. It is therefore important to investigate the levels of resistance or vulnerability of wheat cultivars to Pgt races. Resistance to Pgt races 21C3CTHQM, 34MKGQM, and 34C3RTGQM was evaluated in 136 Chinese wheat cultivars at the seedling stage. A total of 124 cultivars (91.2%) were resistant to the three races. Resistance genes Sr2, Sr24, Sr25, Sr26, Sr31, and Sr38 were analyzed using molecular markers closely linked to them, and 63 of the 136 wheat cultivars carried at least one of these genes: 21, 25, and 28 wheat cultivars likely carried Sr2, Sr31, and Sr38, respectively. Cultivars “Kehan 3” and “Jimai 22” likely carried Sr25. None of the cultivars carried Sr24 or Sr26. These cultivars with known stem rust resistance genes provide valuable genetic material for breeding resistant wheat cultivars.

Monophyly of Verbascum (Scrophularieae : Scrophulariaceae): evidence from nuclear and plastid phylogenetic analyses

2014 ◽  
Vol 62 (8) ◽  
pp. 638 ◽  
Author(s):  
Farrokh Ghahremaninejad ◽  
Mehrshid Riahi ◽  
Melina Babaei ◽  
Faride Attar ◽  
Lütfi Behçet ◽  
...  
Keyword(s):  
Molecular Markers ◽  
Dna Sequences ◽  
Phylogenetic Relationships ◽  
Phylogenetic Analyses ◽  
Morphological Characters ◽  
Molecular Data ◽  
Nrdna Its ◽  
Starting Point ◽  
High Species Diversity ◽  
Phylogenetic Estimation

Verbascum is one of the main genera of Scrophulariaceae, but delimitation and phylogenetic relationships of this genus are unclear and have not yet been studied using DNA sequences. Here, using four selected molecular markers (nrDNA ITS and the plastid spacers trnS/G, psbA-trnH and trnY/T), we present a phylogeny of Verbascum and test previous infrageneric taxonomic hypotheses as well as its monophyly with respect to Scrophularia. We additionally discuss morphological variation and the utility of morphological characters as predictors of phylogenetic relationships. Our results show that while molecular data unambiguously support the circumscription of Verbascum inferred from morphology, they prove to be of limited utility in resolving infrageneric relationships, suggesting that Verbascum ‘s high species diversity is due to rapid and recent radiation. Our work provides phylogenetic estimation of the genus Verbascum using molecular data and can serve as a starting point for future investigations of Verbascum and relatives.

Phylogeny and classification of the New World suboscines (Aves, Passeriformes)

Zootaxa ◽  
2013 ◽  
Vol 3613 (1) ◽  
pp. 1-35 ◽  
Author(s):  
JAN I. OHLSON ◽  
MARTIN IRESTEDT ◽  
PER G. P. ERICSON ◽  
JON FJELDSÅ
Keyword(s):  
Molecular Markers ◽  
Phylogenetic Relationships ◽  
New World ◽  
Remarkable Difference ◽  
Phylogenetic Hypothesis ◽  
New Family ◽  
Climatic Optimum

Here we present a phylogenetic hypothesis for the New World suboscine radiation, based on a dataset comprising of 219 terminal taxa and five nuclear molecular markers (ca. 6300 bp). We also estimate ages of the main clades in this radiation. This study corroborates many of the recent insights into the phylogenetic relationships of New World suboscines. It further clarifies a number of cases for which previous studies have been inconclusive, such as the relationships of Conopophagidae, Melanopareiidae and Tityridae. We find a remarkable difference in age of the initial divergence events in Furnariida and Tyrannida. The deepest branches in Furnariida are of Eocene age, whereas the extant lineages of Tyrannida have their origin in the Oligocene. Approximately half of the New World suboscine species are harboured in 5 large clades that started to diversify around the Mid Miocene Climatic Optimum (16–12 Mya). Based on our phylogenetic results we propose a revised classification of the New World suboscines. We also erect new family or subfamily level taxa for four small and isolated clades: Berlepschiinae, Pipritidae, Tachurididae and Muscigrallinae.

Phylogeny of Dorippoidea (Crustacea : Decapoda : Brachyura) inferred from three mitochondrial genes

2009 ◽  
Vol 23 (3) ◽  
pp. 223 ◽  
Author(s):  
Y. W. Sin ◽  
Joelle C. Y. Lai ◽  
Peter K. L. Ng ◽  
K. H. Chu
Keyword(s):  
Molecular Markers ◽  
Cytochrome C ◽  
16S Rrna ◽  
Cytochrome C Oxidase ◽  
Phylogenetic Relationships ◽  
Phylogenetic Trees ◽  
Mitochondrial Genes ◽  
12S Rrna ◽  
Generic Relationships ◽  
I Gene

The phylogenetic relationships between 10 of 13 genera of crabs from the superfamily Dorippoidea were investigated using mitochondrial 16S rRNA, 12S rRNA and cytochrome c oxidase subunit I gene sequences. The resultant phylogenetic trees based on the three molecular markers support the division of Dorippidae and Ethusidae as monophyletic families within the Dorippoidea. The inferred inter-generic relationships within Dorippidae concur with groupings based on the overall morphology of the carapace and structures of the male first pleopods.

scholarly journals Application Techniques of Molecular Marker and Achievement of Marker Assisted Selection (MAS) in Three Major Crops Rice, Wheat and Maize

2021 ◽  
Vol 8 (1) ◽  
pp. 82-93
Author(s):  
Muhammad Gul Arabzai ◽  
Hameed Gul
Keyword(s):  
Molecular Markers ◽  
Molecular Marker ◽  
Abiotic Stresses ◽  
Marker Assisted Selection ◽  
Agronomic Traits ◽  
Linkage Drag ◽  
Conventional Breeding ◽  
Phenotype Data ◽  
Application Techniques ◽  
New Varieties

With the discovery of new genetic technology, the researcher focuses on using DNA molecular markers to improve new varieties worldwide. Such as resistance to biotic and abiotic stresses and enhancing quality and quantity at different plant breeding fields. Conventional breeding selection is based on phenotype data selection, time-consuming, and has a high chance of linkage drag. Thus, DNA molecular marker method usage is faster, easy, and not expensive than conventional breeding programs. This review focused on applying molecular markers such as genetic diversity analysis, the genotype of identification and fingerprinting, gene tagging and mapping, QTL analysis, and marker-assisted selection. In another part of this review, we focused on MAS's achievements related to improving agronomic traits, quality traits, and biotic/abiotic stresses for three major cereal crops like Wheat, Rice, and Maize.

Sign in / Sign up

Export Citation Format

Share Document