scholarly journals The P2Y1 Receptor in the Colonic Submucosa of Rats and Its Correlation with Opioid-Induced Constipation

2021 ◽  
Author(s):  
Yuqiong Zhao ◽  
Xiaojie Ren ◽  
Fan Li ◽  
Binghan Jia ◽  
Dengke Wang ◽  
...  
Keyword(s):  
Protein Expression ◽  
Western Blot ◽  
Pcr Analysis ◽  
Mrna Levels ◽  
Submucosal Plexus ◽  
Rt Pcr ◽  
Selective Agonist ◽  
Fecal Water ◽  
Μ Opioid Receptor ◽  
Relative Mrna Expression

Abstract Aims: To explore the expression changes of P2Y1 in the distal colonic submucosa of opioid induced constipation (OIC) rats and its correlation with the occurrence of OIC. Methods: OIC model was generated by intraperitoneal injection of loperamide hydrochloride, a selective agonist of the μ-opioid receptor (MOR). Seven days later, the model was assessing by detecting the fecal traits and calculating the fecal water cotent. The distribution of MOR-containing neurons and P2Y1-containing neurons in colonic submucosal plexus of rat were demonstrated by immunofluorescence histochemistry. Western Blot was used to evaluate the expression changes of MOR, P2Y1 and ATP synthase subunit beta (ATPB) in colonic submucosa, while the RT-PCR analysis was performed to determine the relative mRNA expression of MOR, P2Y1 and ATPB. Results: After seven days, the feces of OIC rats had an appearance of like sausage-shaped pieces, and the fecal water content, stool weight of OIC rats were decreased. Immunofluorescence histochemistry showed the co-expression of MOR and ATPB, P2Y1 and calbindin (CB) in the nerve cells of distal colonic submucosal plexus. RT-PCR showed that MOR mRNA levels were significantly increased in the distal colonic submucosa of OIC rats, while the mRNA levels of P2Y1 were decreased. Western blot results showed that MOR protein expression was increased, and the P2Y1 protein expression was significantly decreased in the distal colonic submucosa of OIC rats.Conclusion: P2Y1 is associated with the occurrence of OIC in rats, and the expression of MOR and P2Y1 and OIC are correlated with each other.

scholarly journals Phenotypical and Functional Characteristics of Human Regulatory T Cells during Ex Vivo Maturation from CD4+ T Lymphocytes

2021 ◽  
Vol 11 (13) ◽  
pp. 5776
Author(s):  
Varvara G. Blinova ◽  
Natalia S. Novachly ◽  
Sofya N. Gippius ◽  
Abdullah Hilal ◽  
Yulia A. Gladilina ◽  
...  
Keyword(s):  
T Cells ◽  
Regulatory T Cells ◽  
Ex Vivo ◽  
Pcr Analysis ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Inflammatory Reactions ◽  
Effector Cells ◽  
Cycle Regulation ◽  
Further Development

Regulatory T cells (Tregs) participate in the negative regulation of inflammatory reactions by suppressing effector cells. In a number of autoimmune disorders, the suppressive function and/or the number of Tregs is compromised. The lack of active functioning Tregs can be restored with adoptive transfer of expanded ex vivo autologous Tregs. In our study, we traced the differentiation and maturation of Tregs CD4+CD25+FoxP3+CD127low over 7 days of cultivation from initial CD4+ T cells under ex vivo conditions. The resulting ex vivo expanded cell population (eTregs) demonstrated the immune profile of Tregs with an increased capacity to suppress the proliferation of target effector cells. The expression of the FoxP3 gene was upregulated within the time of expansion and was associated with gradual demethylation in the promotor region of the T cell-specific demethylation region. Real-time RT-PCR analysis revealed changes in the expression profile of genes involved in cell cycle regulation. In addition to FOXP3, the cells displayed elevated mRNA levels of Ikaros zinc finger transcription factors and the main telomerase catalytic subunit hTERT. Alternative splicing of FoxP3, hTERT and IKZF family members was demonstrated to be involved in eTreg maturation. Our data indicate that expanded ex vivo eTregs develop a Treg-specific phenotype and functional suppressive activity. We suggest that eTregs are not just expanded but transformed cells with enhanced capacities of immune suppression. Our findings may influence further development of cell immunosuppressive therapy based on regulatory T cells.

scholarly journals Cytokine-Mediated Downregulation of Coxsackievirus-Adenovirus Receptor in Endothelial Cells

2004 ◽  
Vol 78 (15) ◽  
pp. 8047-8058 ◽  
Author(s):  
Theresa Vincent ◽  
Ralf F. Pettersson ◽  
Ronald G. Crystal ◽  
Philip L. Leopold
Keyword(s):  
Endothelial Cells ◽  
Epithelial Cells ◽  
Protein Expression ◽  
Western Blot ◽  
Inflammatory Cytokines ◽  
Cell Physiology ◽  
Mrna Levels ◽  
Cytokine Treatment ◽  
Adenovirus Receptor ◽  
The Impact

ABSTRACT Endothelial cells have the ability to change their complement of cell surface proteins in response to inflammatory cytokines. We hypothesized that the expression of the coxsackievirus-adenovirus receptor (CAR), a viral receptor and putative cell-cell adhesion molecule, may be altered during the response of endothelial cells to inflammation. To test this hypothesis, we evaluated CAR protein and mRNA levels in human umbilical vein endothelial cells after they were exposed to tumor necrosis factor alpha, gamma interferon, or a combination of the two cytokines. Flow cytometric and Western blot analyses indicated that cytokine treatment led to a synergistic decrease in CAR protein expression. A Western blot analysis showed that CAR levels decreased to 16% ± 4% or 1% ± 4% of the CAR protein levels in untreated cells with either 24 or 48 h of cytokine treatment, respectively. Quantitative reverse transcription-PCR demonstrated that the combination treatment caused CAR mRNA levels to decrease to 21% ± 12% or 5% ± 3% of the levels in untreated cells after a 24- or 48-h cytokine treatment, respectively. Reduced CAR expression led to a decrease in adenovirus (Ad) binding of 80% ± 3% (compared with untreated endothelial cells), with a subsequent decrease in Ad-mediated gene transfer that was dependent on the dose and duration of cytokine treatment but not on the dose of Ad. A similar decrease in CAR protein level and susceptibility to Ad infection was observed in human microvascular endothelial cells, while CAR expression on normal human bronchial epithelial cells or A549 lung epithelial cells was less affected by cytokine treatments. Taken together, the data demonstrate that inflammatory cytokines decrease CAR mRNA and protein expression with a concomitant decrease in Ad binding, reflecting the impact of cell physiology on the function of CAR and the potential effect of inflammation on the ability of Ad to transfer genes to endothelial cells.

scholarly journals Investigation into imbalance of Th1/Th2 cells in cirrhotic, hypersplenic rats

2019 ◽  
Vol 48 (3) ◽  
pp. 030006051988944 ◽  
Author(s):  
Yunfu Lv ◽  
Yejuan Li ◽  
Ning Liu ◽  
Yonghong Dong ◽  
Jie Deng
Keyword(s):  
Western Blot ◽  
Blot Analysis ◽  
Western Blot Analysis ◽  
Chemokine Receptors ◽  
Immunohistochemical Staining ◽  
Th2 Cells ◽  
Intragastric Administration ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Chemokine Receptor Ccr3

Objectives To evaluate the Th1/Th2 cell profile in spleens of cirrhotic and hypersplenic rats by investigating the expression of Th1-associated chemokine receptors CXCR3, CCR5 and Th2-associated chemokine receptor CCR3. Methods Experimental liver cirrhosis and hypersplenism were induced in rats by the intragastric administration of carbon tetrachloride (CCl4; 40% solution [0.3 ml/100g, twice/week for 8 weeks]) and confirmed by pathology and hemogram. Presence of the three chemokine receptors was investigated by real-time polymerase chain reaction (RT-PCR), immunohistochemical staining, and western blot analysis. Results By comparison with control animals (n=10), RT-PCR demonstrated that CXCR3 and CCR5-mRNA levels were significantly elevated in the hypersplenic rats (n=26) and CCR3-mRNA levels were lower. Immunohistochemical staining showed that by comparison with controls, the mean density of the Th1-associated CXCR3 and CCR5 receptors was significantly increased but there was no difference between groups in Th2-associated CCR3 receptors. Western blot analysis showed that by comparison with controls, hypersplenic rats had higher levels of CXCR3 and CCR5 protein but lower levels of CCR3 protein. Conclusions The abnormal expression of Th1-associated chemokine receptors in spleens of rats with cirrhosis and hypersplenism induced by CCL4 suggests that a functional imbalance between Th1/Th2 cells may play a role in the pathogenesis of hypersplenism.

Identification of a gene cluster for cell-surface genes of the SRS superfamily inNeospora caninumand characterization of the novelSRS9gene

Parasitology ◽  
2011 ◽  
Vol 138 (14) ◽  
pp. 1832-1842 ◽  
Author(s):  
V. RISCO-CASTILLO ◽  
V. MARUGÁN-HERNÁNDEZ ◽  
A. FERNÁNDEZ-GARCÍA ◽  
A. AGUADO-MARTÍNEZ ◽  
E. JIMÉNEZ-RUIZ ◽  
...  
Keyword(s):  
Western Blot ◽  
Gene Cluster ◽  
Neospora Caninum ◽  
Pcr Analysis ◽  
Rt Pcr ◽  
Specific Expression ◽  
Initial Characterization ◽  
Hydrophilic Region

SUMMARYHere we present the detection of a gene cluster forNeospora caninumsurface genes, similar to theToxoplasma gondiiSRS9 locus, and the cloning and characterization of the NcSRS9gene. PCR genome walking, using NcBSR4gene as a framework, allows the identification, upstream NcBSR4, of 2 sequences homologous to theSRS5and the Ubiquinol-cytochrome C reductase genes and, downstream NcBSR4, of an ORF of 1191 bp coding for a 396-amino acid polypeptide with 59% similarity to the TgSRS9 antigen. A putative 39-residue signal peptide was found at the NH2-terminus followed by a hydrophilic region, and a potential site for a glycosylphosphatidylinositol anchor at the COOH-terminus. A recombinant NcSRS9 protein was produced and was recognized on a Western blot by a low proportion of sera from a panel of naturally infected cows and calves. In addition, Western blot analysis using polyclonal anti-rNcSRS9 revealed stage-specific expression of NcSRS9 in bradyzoites but not in tachyzoites, and immunohistochemistry on brain from a congenitally infected calf showed NcSRS9 recognition in bradyzoites contained in tissue cysts. However, bradyzoite-specific expression of NcSRS9 could not be proven by immunofluorescence on bradyzoites obtainedin vitroand RT-PCR analysis showed no significant variations of NcSRS9transcripts duringin vitrotachyzoite-bradyzoite switch, probably due to incomplete maturity ofin vitrobradyzoites. Initial characterization of NcSRS9 in this study may lead to further studies for a better understanding ofN. caninumpersistence.

scholarly journals Preventive Effects of Evodiamine on Dexamethasone-Induced Osteoporosis in Zebrafish

2019 ◽  
Vol 2019 ◽  
pp. 1-6 ◽  
Author(s):  
Heng Yin ◽  
Jianwei Wang ◽  
Mao Wu ◽  
Yong Ma ◽  
Shanfu Wang ◽  
...  
Keyword(s):  
Western Blot ◽  
Mapk Pathway ◽  
Bone Mineralization ◽  
Tartrate Resistant Acid Phosphatase ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Alizarin Red ◽  
Calcium Phosphorus ◽  
Commercial Kits ◽  
Preventive Effects

The aim of this study was to investigate the effect of evodiamine (EV) on dexamethasone-induced osteoporosis in zebrafish. Zebrafish larvae were exposed to different concentrations of dexamethasone to obtain the osteoporosis in zebrafish. Calcium, phosphorus, and alizarin red staining determination were performed to evaluate the effects of EV on bone mineralization. Alkaline phosphatase (ALP), hydroxyproline (HP), and tartrate resistant acid phosphatase (TRAP) were also measured by commercial kits. The expression of MMP3-OPN-MAPK pathway in zebrafish was measured by Western blot. RT-PCR was used to determine mRNA levels of MMP3, OPN, and MAPK. EV could significantly increase the content of calcium and phosphorus. The results of alizarin red staining showed that EV could significantly increase the calcium sink of horse fish, increasing the area of bone formation. EV could increase the content of hydroxyproline in zebrafish. EV also increased ALP and TRAP in zebrafish. Western blot and RT-PCR results showed that EV restored the MMP3-OPN-MAPK pathway in zebrafish. In conclusion, we found that EV can alleviate dexamethasone-induced osteoporosis in zebrafish. The mechanism is related to activating MMP3-OPN-MAPK pathway and then activating bone remodeling.

scholarly journals Comparison of CXC Chemokines ENA-78 and Interleukin-8 Expression in Helicobacter pylori-Associated Gastritis

2001 ◽  
Vol 69 (1) ◽  
pp. 81-88 ◽  
Author(s):  
Gabriele Rieder ◽  
Wolfgang Einsiedl ◽  
Rudolf A. Hatz ◽  
Manfred Stolte ◽  
Georg A. Enders ◽  
...  
Keyword(s):  
Helicobacter Pylori ◽  
Protein Expression ◽  
Outer Membrane Proteins ◽  
Water Soluble ◽  
Interleukin 8 ◽  
Gastric Epithelium ◽  
Mrna Levels ◽  
Rt Pcr ◽  
H Pylori

ABSTRACT Colonization of the gastric mucosa with Helicobacter pylori is associated with a dense infiltration of granulocytes into the lamina propria in the active phase of gastritis. In this study, we investigated the involvement of epithelial cell-derived neutrophil-activating protein 78 (ENA-78) in development of H. pylori-associated gastritis. Antral biopsies from 27 patients with H. pylori-associated gastritis and 25 from H. pylori-negative individuals were first analyzed for ENA-78 and interleukin-8 (IL-8) mRNA by semiquantitative reverse transcription (RT)-PCR. In H. pylori-positive patients, significantly elevated levels were found for both chemokines (P < 0.05). Only IL-8 mRNA levels differed significantly (P< 0.05) in H. pylori-infected individuals who had serum antibodies for cytotoxin-associated protein CagA versus H. pylori-infected CagA-negative persons. Quantification of ENA-78 transcript levels by competitive RT-PCR yielded a significant 45-fold upregulation for ENA-78 transcripts in biopsies of H. pylori-positive versus H. pylori-negative patients (P < 0.05). In contrast to earlier findings with IL-8, the degree of ENA-78 mRNA upregulation was independent of the grade of activity of gastritis. Immunofluorescence studies on tissues of antral biopsies localized ENA-78 protein expression mainly to the gastric epithelium of H. pylori-positive patients, while control tissues were negative. Upregulation of ENA-78 and IL-8 mRNA and protein expression was also observed in an in vitro system using a gastric adenocarcinoma cell line. Only viable H. pyloriyielded a strong ENA-78 and IL-8 induction, while H. pyloriouter membrane proteins or water-soluble proteins had no significant effect. These data provide evidence for the importance of both IL-8 and ENA-78 in the development and perpetuation of H. pylori-associated gastritis.

scholarly journals Epigallocatechingallate Inhibits Migration of Human Uveal Melanoma Cells via Downregulation of Matrix Metalloproteinase-2 Activity and ERK1/2 Pathway

2014 ◽  
Vol 2014 ◽  
pp. 1-9 ◽  
Author(s):  
Chi-Wu Chang ◽  
Yi-Hsien Hsieh ◽  
Wei-En Yang ◽  
Shun-Fa Yang ◽  
Yueqin Chen ◽  
...  
Keyword(s):  
Western Blot ◽  
Uveal Melanoma ◽  
Gelatin Zymography ◽  
Melanoma Cells ◽  
Matrix Metalloproteinase 2 ◽  
Pcr Analysis ◽  
Signal Pathways ◽  
Mrna Levels ◽  
Dependent Manner ◽  
Uveal Melanoma Cell

The effects of epigallocatechingallate (EGCG) on the migration and expression of MMP-2 of uveal melanoma cells have not been reported. We studied this effect and relevant signaling pathways in a human uveal melanoma cell line (M17). MTT study found that EGCG did not affect the cell viability of M17 cells up to 100 µM. Wound-healing assay showed that EGCG significantly reduced the migration of melanoma cells in a dose-dependent manner from 20 to 100 µM. Gelatin zymography showed that secreted MMP-2 activity was dose-dependently inhibited by EGCG, whereas the MMP-2 expression at protein and mRNA levels was not affected as determined by western blot and RT-PCR analysis. EGCG significantly increased the expressions of MMP-2 endogenous inhibitors (TIMP-2 and RECK) in M17 cells. Western blot analysis of MAPK signal pathways showed that EGCG significantly decreased phosphorylated ERK1/2 levels, but not p38 and JNK levels, in melanoma cells. ERK1/2 inhibitors also reduced the migration and activity of MMP-2 in M17 cells. The present study suggested EGCG at nontoxic levels could inhibit migration of melanoma cells via downregulation of activities of secreted MMP-2 through the inhibition of the ERK1/2 phosphorylation. Therefore, EGCG may be a promising agent to be explored for the prevention of metastasis of uveal melanoma.

Methanolic Extract of Cynara Cardunculus L. Inhibits Cell Proliferation and Bcr/Abl Expression in K562 Cell Line

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 4247-4247
Author(s):  
Antonio Russo ◽  
Filomena Conforti ◽  
Maria Cristina Caroleo ◽  
Roberta Ionà ◽  
Giancarlo Statti ◽  
...  
Keyword(s):  
Cell Growth ◽  
Western Blot ◽  
Cell Line ◽  
Blot Analysis ◽  
Proliferative Activity ◽  
Methanolic Extract ◽  
Mrna Levels ◽  
Cynara Cardunculus ◽  
Rt Pcr ◽  
K562 Cell Line

Abstract Introduction: Chronic myeloid leukaemia (CML) is a myeloid neoplasm defined by the Bcr/Abl oncoprotein that is considered essential for leukaemogenesis and accumulation of neoplastic cells. Evidence exists showing that extracts of antichoke Cynara cardunculus L. (CCE) are able to inhibit cancer cell growth in vitro (1). In the present study we have investigated the antiproliferative effect of methanolic extract of CEE on K562 Bcr-Abl positive leukemia cell line. In addition we evaluated whether the extract of CEE also affects the mRNA levels of Bcr-Abl and p210 expression in this cell line. Materials and Methods: Preparation of methanolic extract of CEE. The aerial parts of CEE were air dried until dryness at room temperature, cut into small pieces and then extracted with methanol through maceration (48 h for 3 times). The resultant total extracts were dried under reduced pressure and their weight was determined. Cell culture. The K562 cells were grown in RPMI 1640 with L-glutamine supplemented with 10% (v/v) heat-inactivated FBS, 1% penicillin/streptomycin in humidified atmosphere of 5% CO2 at 37°C. In all experiments growing cells at optimal concentration were placed in 24 or 96 well plate and then treated with vehicle or 5–100–200 μg/ml methanolic extract of CEE. 48h after the treatment cultures were tested for proliferative activity, mRNA level of Bcr-Abl by RT-PCR and p210 protein expression by western blotting analysis. Proliferative activity. Proliferative activity was determined using the MTT technique according to the method described by Tubaro et al. (1996). The assay was performed in triplicate and absorbance values at 550 nm were measured using a microplate reader. RT-PCR Analysis. The total cellular mRNA was isolated from treated and control cells using an silica coloumns. Using equal amounts of the RNA from each sample, the cDNA was synthesized by Superscript VILO™ cDNA kit. PCR was performed using Platinum® Taq DNA polymerase and specific primers for t(9;22) p210 transcripts (b3a2): GAAGTGTTTCAGAAGCTTTCC (sense) and GTTTGGGCT-TCACACCATTCC (antisense). 35 amplification cycles were performed at 94°C for 30s, 55°C for 30s and 72°C for 1min. Gel electrophoresis and ethidium bromide staining was used to visualize the PCR products. Western Blot Analysis. Cell pellets from control and treated cultures were lysed using lysis buffer with protease and phosphatase inhibitors. The proteins were then quantified and equal amounts (30 ug) were separated by SDS-PAGE and electro-blotted to nitrocellulose. After blocking procedure the blots were incubated with specific primary antibody against p210 protein and then challenged with specific horseradish peroxidase-conjugated secondary antibody. The reactive protein was visualized using an enhanced chemiluminescence detection system. Results: The results have shown that treatment of K562 cell line with methanolic extract of CEE reduced cell viability in a dose-dependent fashion (IC50=41.7 μg/ml) as demonstrated by MTT assay. PCR and Western blot analysis revealed that the cell growth inhibition was associated to a dramatic decrease of mRNA levels of Bcr-Abl and to a significant reduction of p210 protein expression suggesting that the antiproliferative effect of methanolic extract of CEE likely due to the inhibition at transcriptional level of Bcr-Abl oncoprotein. Further studies are needed to better elucidate this mechanisms and to identify the compound of crude extract which is responsible of cancer growth suppression.

Erythroid-Expression of HMGA2 Increases Fetal Hemoglobin in Human Adult Erythroblasts

Blood ◽  
2015 ◽  
Vol 126 (23) ◽  
pp. 2161-2161
Author(s):  
Jaira F. de Vasconcellos ◽  
Y. Terry Lee ◽  
Colleen Byrnes ◽  
Laxminath Tumburu ◽  
Antoinette Rabel ◽  
...  
Keyword(s):  
Protein Expression ◽  
Fetal Hemoglobin ◽  
Cell Counting ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Globin Mrna ◽  
Expression Levels ◽  
Gamma Globin ◽  
Empty Vector ◽  
Gene And Protein Expression

Abstract HMGA2 is a member of the high-mobility group A family and plays a role in the regulation of gene transcription and chromatin structure. HMGA2 is a validated target of the let-7 family of miRNAs. Let-7 miRNAs are highly regulated in erythroid cells during the fetal-to-adult developmental transition (1). Recent studies demonstrated that the LIN28 -let-7 axis mediated up-regulation of fetal hemoglobin (HbF) expression to >30% of the total globin levels in cultured erythroblasts from adult humans (2) and the amelioration of hypoxia-related sickling of cultured mature erythrocytes from pediatric patients with sickle cell disease (3). Interestingly, increased expression of endogenous HbF in a patient receiving gene therapy was also associated with truncated HMGA2 protein expression after lentiviral integration and disruption of let-7 targeting at the HMGA2 gene locus (4). Therefore, we hypothesized that HMGA2 may be involved in fetal hemoglobin regulation as a downstream target of the let-7 miRNAs. To study the effects of HMGA2 upon erythropoiesis and globin expression, lentiviral constructs were designed for let-7 resistant expression of HMGA2 driven by the erythroid-specific gene promoter region of the human SPTA1 gene (HMGA2 -SPTA1-OE), with a matched empty vector control. Transductions were performed in CD34+ cells from four adult healthy volunteers cultivated ex vivo in erythropoietin-supplemented serum-free media for 21 days. Overexpression of HMGA2 was confirmedby Q-RT-PCR (control: below detection limits; HMGA2 -SPTA1-OE: 2.51E+04 ± 3.44E+04 copies/ng) and Western blot analyses at culture day 14. Cell counting revealed no significant changes between HMGA2 -SPTA1-OE and control (empty vector) transductions at culture day 14. Terminal maturation with loss of CD71 from the erythroblast cell surface and enucleation assessed by thiazole orange staining were analyzed in the control and HMGA2 -SPTA1 -OE samples at the end of the culture period. Globin genes expression levels were evaluated for HMGA2 -SPTA1-OE by Q-RT-PCR. HMGA2 -SPTA1-OE caused a significant increase in gamma-globin mRNA expression levels compared to controls (control: 5.02E+05 ± 8.62E+04 copies/ng; HMGA2 -SPTA1-OE: 1.45E+06 ± 7.31E+05 copies/ng; p=0.037). Consistent with the increase in gamma-globin mRNA levels, HPLC analyses at culture day 21 demonstrated modest but significant increases in HbF levels in HMGA2 -SPTA1-OE compared to controls (HbF control: 5.41 ± 2.15%; HMGA2 -SPTA1-OE: 16.53 ± 4.43%; p=0.006). Possible effect(s) and downstream mechanism(s) triggered by HMGA2 -SPTA1-OE were investigated. Q-RT-PCR analyses demonstrated no significant changes in the let-7 family of miRNAs in HMGA2 -SPTA1-OE compared to controls. Expression patterns of several transcription factors such as BCL11A, KLF1, SOX6 and GATA1 were investigated by Q-RT-PCR and no significant changes were detected in HMGA2 -SPTA1-OE compared to controls. While BCL11A mRNA levels were decreased by HMGA2 -SPTA1 -OE, the differences did not reach statistical significance (control: 4.26E+02 ± 8.18E+01 copies/ng; HMGA2 -SPTA1 -OE: 2.84E+02 ± 1.48E+02 copies/ng; p=0.104). However, nuclear BCL11A protein levels assessed by Western analysis were suppressed in HMGA2 -SPTA1 -OE. In summary, these results demonstrate that HMGA2, a validated target of let-7 miRNAs, causes moderately increased gamma-globin gene and protein expression in human erythroblasts, and reduces levels of BCL11A protein. These data thus support the notion that suppression of let-7 miRNAs increases fetal hemoglobin, in part, by the targeting of erythroblast HMGA2 mRNA. (1) Noh SJ et al. J Transl Med. 7:98 (2009). (2) Lee YT et al. Blood. 122:1034-41 (2013). (3) Vasconcellos JF et al. PLoS One. 9:e106924 (2014). (4) Cavazzana-Calvo M et al. Nature. 467:318-22 (2010). Disclosures No relevant conflicts of interest to declare.

Sign in / Sign up

Export Citation Format

Share Document