scholarly journals Farklı Nitrifikasyon İnhibitörlerinin Domateste Bakteriyel Kanser ve Solgunluk (Clavibacter Michiganensis Subsp. Michiganensis) Hastalığına Etkisi

2021 ◽  
Vol 9 (1) ◽  
pp. 124-129
Author(s):  
Aysu Tuğçe Gül ◽  
Sümer Horuz
Keyword(s):  
Ammonium Sulphate ◽  
Integrated Control ◽  
Hypersensitive Reaction ◽  
Growth And Yield ◽  
Economic Losses ◽  
Nitrification Inhibitors ◽  
Disease Development ◽  
Bacterial Canker ◽  
Molecular Tests ◽  
Clavibacter Michiganensis Subsp

Tomato bacterial canker and wilt is a destructive disease causing economic losses and affecting plant growth and yield. Due to the lack of disease resistant cultivars and non- effective chemicals, management of the disease is quite tricky. The aims of this study were (1) to identify Cmm strains isolated in different years using both classical and molecular tests, (2) to test the efficacy of ammonium sulphate fertilizers with nitrogenous inhibitors on Cmm disease development. Eight strains were identified as Cmm according to hypersensitive reaction on Mirabilis jalapa plant leaves, pathogenicity on tomato seeedlings and production of 614 bp on agarose gel electrophoresis. Non-nitrogenous classical ammonium sulphate as compare treatment, Dicyandiamide (DCD) and 3.5-Dimethylpyrazol glyceborate (DMPB) nitrification inhibitors included ammonium sulphate fertilizers were tested in pot experiments. Fertilizers were applied three times with one week intervals at the 100, 250 and 500 ppm doses as irrigation water and the efficacy of treatments compared with control plants. In two times repeated study, disease development inhibited from 42 to 78% and from 44 to 82% in the first and second trials, respectively. In both treatments, 500 ppm dose of all applied fertilizers was highly decreased the lesion development in plants. This study reported the effect of nitrification inhibitors on tomato bacterial canker and wilt for the first time. In conclusion, it would be beneficial to add inhibitor fertilizers to integrated control programs against tomato bacterial canker and wilt disease.

scholarly journals Severe Outbreak of Bacterial Canker Caused by Clavibacter michiganensis subsp. michiganensis on Tomato in Central Italy

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 221-221 ◽  
Author(s):  
J. R. Lamichhane ◽  
G. M. Balestra ◽  
L. Varvaro
Keyword(s):  
16S Rdna ◽  
Central Italy ◽  
Negative Control ◽  
Economic Losses ◽  
Bacterial Suspension ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Tomato Seedlings ◽  
Clavibacter Michiganensis Subsp ◽  
Tomato Field

From May to July 2010, severe outbreaks of bacterial canker of tomato (Solanum lycopersicum L.) were observed in 16 fields in the Province of Viterbo, central Italy. Cultivars affected were Uno Rosso, Peto 1296, UG 812, UG 822, and Podium. Disease incidence ranged from 70 to 100% and was highest for Uno Rosso followed by UG 812, UG 822, Peto 1296, and Podium. Leaf symptoms initially appeared as interveinal, pale green, water-soaked areas that quickly turned yellow-brown to necrotic, resembling sunburn. Infected parts of the plants began to wilt and then die. Light yellow-to-brown streaks or cankers appeared on stems and the cankers darkened. As the disease progressed, affected stems split lengthwise and a pale yellow-to-reddish brown discoloration of the vascular tissue was observed. The pith of infected stems turned brown, granular to mealy, and filled with cavities. Dividing the stem into two pieces lengthwise revealed yellowing of vascular tissues in the fruits that otherwise was asymptomatic. Eventually, vascular wilting and premature death of entire plants were observed. Once a month, infected samples were randomly collected three times from each field from five plants. A gram-positive, nonmotile, nonspore forming, aerobic, curved, rod-shaped bacterium was consistently isolated onto nutrient broth yeast extract agar medium from symptomatic plant tissues. Strains tested positive for gelatin liquefaction, H2S production from peptone, utilization of citrate and negative for starch hydrolysis. Forty-five isolates were used to inoculate four-o'clock (Mirabilis jalapa L.) plants by injecting a bacterial suspension of the appropriate isolate in sterilized distilled water (108 CFU/ml) into leaves (1). Known strains of Clavibacter michiganensis subsp. michiganensis (DPP22) and Pseudomonas fluorescens (DPP09N) were used as positive and negative control treatments, respectively. Four leaves per plant and three plants were inoculated for each bacterial strain and control treatment. All 45 tomato field isolates and the known strain of C. michiganensis subsp. michiganensis produced a hypersensitive reaction within 48 h. Pathogenicity tests were performed on 3-week-old, potted tomato seedlings (cv. Ciliegino) by placing a drop of the appropriate bacterial suspension (108 CFU/ml) on wounds created by excising the leaf petiole. The inoculated plants were maintained at 26 ± 1°C in a greenhouse. The two control isolates were similarly inoculated onto tomato seedlings. After 15 days, all inoculated plants developed symptoms, whereas negative control plants remained asymptomatic. Bacteria reisolated from inoculated leaf lesions had the same characteristics as the original bacteria. A 1,400-bp region of the 16S rDNA was amplified from 15 of the 45 strains with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession Nos. HQ144228 to HQ144242; strains CmmVT1 to CmmVT15). A BlastN search of the sequences in GenBank revealed the tomato strains had 99 to 100% identity with the 16S rDNA sequences of C. michiganensis subsp. michiganensis strains (GenBank Accession Nos. EU 685335, AM711867, and AM410696). In Italy, this pathogen was first reported in 1914 in Vasto and later in a few other regions. However, to our knowledge, this is the first observation of widespread outbreaks in >300 ha of tomato fields with severe economic losses. Reference: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990.

scholarly journals Development of the first georeferenced map of Rhipicephalus (Boophilus) spp. in Mexico from 1970 to date and prediction of its spatial distribution

2018 ◽  
Vol 13 (1) ◽  
Author(s):  
Yazmin Alcala-Canto ◽  
Juan Antonio Figueroa-Castillo ◽  
Froylán Ibarra-Velarde ◽  
Yolanda Vera-Montenegro ◽  
María Eugenia Cervantes-Valencia ◽  
...  
Keyword(s):  
Spatial Distribution ◽  
Environmental Variables ◽  
Control Strategies ◽  
Integrated Control ◽  
Area Under The Curve ◽  
Entropy Method ◽  
Distribution Model ◽  
Economic Losses ◽  
Precipitation Seasonality ◽  
Epidemiological Risk

The tick genus Ripicephalus (Boophilus), particularly R. microplus, is one of the most important ectoparasites that affects livestock health and considered an epidemiological risk because it causes significant economic losses due, mainly, to restrictions in the export of infested animals to several countries. Its spatial distribution has been tied to environmental factors, mainly warm temperatures and high relative humidity. In this work, we integrated a dataset consisting of 5843 records of Rhipicephalus spp., in Mexico covering close to 50 years to know which environmental variables mostly influence this ticks’ distribution. Occurrences were georeferenced using the software DIVA-GIS and the potential current distribution was modelled using the maximum entropy method (Maxent). The algorithm generated a map of high predictive capability (Area under the curve = 0.942), providing the various contribution and permutation importance of the tested variables. Precipitation seasonality, particularly in March, and isothermality were found to be the most significant climate variables in determining the probability of spatial distribution of Rhipicephalus spp. in Mexico (15.7%, 36.0% and 11.1%, respectively). Our findings demonstrate that Rhipicephalus has colonized Mexico widely, including areas characterized by different types of climate. We conclude that the Maxent distribution model using Rhipicephalus records and a set of environmental variables can predict the extent of the tick range in this country, information that should support the development of integrated control strategies.

scholarly journals Integrated Control of Rhizoctonia Crown and Root Rot of Sugar Beet with Fungicides and Antagonistic Bacteria

Plant Disease ◽  
2001 ◽  
Vol 85 (7) ◽  
pp. 718-722 ◽  
Author(s):  
Sebastian Kiewnick ◽  
Barry J. Jacobsen ◽  
Andrea Braun-Kiewnick ◽  
Joyce L. A. Eckhoff ◽  
Jerry W. Bergman
Keyword(s):  
Sugar Beet ◽  
Root Rot ◽  
Integrated Control ◽  
The United States ◽  
Field Trials ◽  
Sugar Yield ◽  
Economic Losses ◽  
Yield Increase ◽  
Leaf Stage ◽  
Crown And Root Rot

Rhizoctonia crown and root rot, caused by the fungus Rhizoctonia solani AG 2-2, is one of the most damaging sugar beet diseases worldwide and causes significant economic losses in more than 25% of the sugar beet production area in the United States. We report on field trials in the years 1996 to 1999 testing both experimental fungicides and antagonistic Bacillus sp. for their potential to reduce disease severity and increase sugar yield in trials inoculated with R. solani AG 2-2. Fungicides were applied as in-furrow sprays at planting or as band sprays directed at the crown at the four-leaf stage, or four- plus eight-leaf stage, while bacteria were applied at the four-leaf stage only. The fungicides azoxystrobin and tebuconazole reduced crown and root rot disease by 50 to 90% over 3 years when used at rates of 76 to 304 g a.i./ha and 250 g a.i./ha, respectively. The disease index at harvest was reduced and the root and sugar yield increased with azoxystrobin compared with tebuconazole. The combination of azoxystrobin applied at 76 g a.i./ha and the Bacillus isolate MSU-127 resulted in best disease reduction and greatest root and sucrose yield increase.

Attempts at Biological Control of Clavibacter michiganensis subsp. michiganensis On Rockwool-Grown Greenhouse Tomatoes

2008 ◽  
Vol 69 (1) ◽  
pp. 125-134 ◽  
Author(s):  
Czesław Ślusarski
Keyword(s):  
Biological Control ◽  
Biocontrol Agent ◽  
Root Zone ◽  
First Year ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Tomato Plants ◽  
Clavibacter Michiganensis Subsp ◽  
Greenhouse Tomatoes ◽  
Bacterial Canker Of Tomato

Attempts at Biological Control ofClavibacter michiganensissubsp.michiganensisOn Rockwool-Grown Greenhouse TomatoesTwo greenhouse experiments were conducted in which tomato plants artificially inoculated withClavibacter michiganensissubsp.michiganensis(Cmm) were grown in an open rockwool system as spring and autumn crops. Two isolates of the rhizosphere bacteria,Pseudomonas fluorescensstrain PSR21,Pseudomonas reactansstrain GGS14, a commercial biocontrol agent Aqua Bac Plus (Bacillusspp.) and a proprietary disinfectant containing QAC+Chx, applied at weekly intervals, were evaluated for their efficiency in the suppression of the bacterial canker of tomato. All treatments tested revealed to be ineffective in controlling the disease. The introduction ofCmmbacteria into the fresh rockwool in the first year of its usage resulted in a 100% death of tomato plants, whereas following an artificial inoculation of two- and three-year-old rockwool slabs withCmmbacteria dead plants amounted to 70 and 58%, respectively. This indicates that in the re-used rockwool a natural microbial suppressiveness to bacterial canker of tomato might be developed in the root zone.

scholarly journals Mites affecting hen egg production: some considerations for Brazilian farms

2013 ◽  
Vol 43 (7) ◽  
pp. 1230-1237 ◽  
Author(s):  
Leandro do Carmo Rezende ◽  
Lucas Maciel Cunha ◽  
Cristina Mara Teixeira ◽  
Paulo Roberto de Oliveira ◽  
Nelson Rodrigo da Silva Martins
Keyword(s):  
Egg Production ◽  
Integrated Control ◽  
Mite Species ◽  
Economic Losses ◽  
Poultry Industry ◽  
Control Programs ◽  
Cultural Aspects ◽  
Mite Control ◽  
Mite Infestations ◽  
And Control

The poultry industry is characterized for its constant search for productivity and profitability, which are based on flock health status. Brazilian Commercial laying hens (Gallus gallus domesticus) have been impacted significantly by mite infestations. This review aims to compile the literature on the occurrence, economic losses, biology, epidemiology and control of mite species considered important for the Brazilian laying poultry industry. The national experience was compared with practices of other countries and a scarcity of studies on this subject in Brazil was evident. The poultry industry has prioritized the use of pesticides to control infestations with little regard for the adverse effects. In this context, the integrated control programs using several strategies simultaneously constitute the best alternative to mite control. Integrated control programs involve measures of chemical, physical and biological nature, as well as attention to cultural aspects. However, studies should be performed aiming at the development of new control methods, evaluating the adequacy of practices developed in other countries to the national reality.

scholarly journals First Record of Clavibacter michiganensis subsp. michiganensis Causing Canker of Tomato Plants in Syria

Plant Disease ◽  
2008 ◽  
Vol 92 (4) ◽  
pp. 649-649 ◽  
Author(s):  
R. Ftayeh ◽  
A. von Tiedemann ◽  
B. Koopmann ◽  
K. Rudolph ◽  
M. Abu-Ghorrah
Keyword(s):  
First Record ◽  
Bacterial Suspension ◽  
Bacterial Canker ◽  
Clavibacter Michiganensis ◽  
Fresh Market ◽  
Gram Positive ◽  
Tomato Plants ◽  
Clavibacter Michiganensis Subsp ◽  
Whole Plants ◽  
Bacterial Canker Of Tomato

Between March and mid April of 2007, several extensive surveys for Clavibacter michiganensis subsp. michiganensis were carried out among greenhouses in the coastal strip provinces of the Mediterranean Sea in north-west Syria (Latakia and Tartous), where a large proportion of Syrian fresh-market tomatoes are produced. This bacterium causes bacterial canker of tomato and is considered an A2 quarantine pathogen by the European Plant Protection Organization (EPPO). It is currently present in all major tomato-production areas in the EPPO region (4), but has not been previously reported in Syria. The survey revealed typical canker symptoms in 7% of 150 inspected greenhouses that contained cvs. Dima, Huda, and Astona. These symptoms included stunting, dark brown-to-black lesions on the leaf margins, wilting and defoliation of whole plants, and vascular discoloration. The disease incidence in such greenhouses was estimated at 15% at the time of the survey. Diseased plants were surface sterilized and homogenized in sterile water. Serial dilutions were plated on nutrient glucose agar. Suspected colonies were further purified by repeated restreaking on new agar plates. All 10 of the suspected strains obtained from different locations were identified as C. michiganensis subsp. michiganensis on the basis of the following observations: bacterial cells of all strains had a coryneform shape, were nonmotile, gram positive according to Gram's reaction test with 3% KOH (2), oxidase-negative, and caused hypersensitive reactions on leaves of Mirabilis jalaba (1) within 24 h. PCR assays were conducted with the C. michiganensis subsp. michiganensis-specific primer set PSA-4/R (3) and template DNA prepared from in-vitro-grown bacteria with the MasterPure Gram Positive DNA Purification Kit (Epicentre Biotechnologies, Madison, WI). The expected 270-bp amplicon was observed for both reference strains as well as the Syrian strains. Pathogenicity of the strains was confirmed by artificial inoculation of 6-week-old tomato plants (Lycopersicon esculentum Mill. cv. Lyconorma). Inoculation was performed by stabbing the stem with a sterile needle through a drop (~35 μl) of bacterial suspension (~108 CFU/ml in 0.01 M MgSO4) placed in the axil of the second or third true leaf. Three tomato seedlings were inoculated with each strain. Control plants were inoculated with sterile 0.01 M MgSO4. Symptoms including lateral wilt of leaflets, stem lesions, and wilting of whole plants were observed within 10 to 15 days after inoculation, except for the negative control. To fulfill Koch's postulates, reisolation and reidentification of the pathogen was conducted as previously described. To our knowledge, this is the first record of the occurrence of bacterial canker of tomato in Syria. References: (1) R. D. Gitaitis. Plant Dis. 74:58, 1990. (2) T. J. Gregersen. Appl. Microbiol. Biotechnol. 5:123, 1978. (3) K. H. Pastrik and F. A. Rainey. J. Phytopathol. 147:687, 1999. (4) I. M. Smith and L. M. F. Charles, eds. Map 253 in: Distribution Maps of Quarantine Pests for Europe. EPPO/CABI, 1998.

scholarly journals Rotavirus C: prevalence in suckling piglets and development of virus-like particles to assess the influence of maternal immunity on the disease development

2019 ◽  
Vol 50 (1) ◽  
Author(s):  
Juliet Chepngeno ◽  
Annika Diaz ◽  
Francine C. Paim ◽  
Linda J. Saif ◽  
Anastasia N. Vlasova
Keyword(s):  
Cell Culture ◽  
Diarrheal Disease ◽  
Economic Losses ◽  
Disease Development ◽  
Fecal Samples ◽  
Virus Like Particles ◽  
Maternal Immunity ◽  
The Us ◽  
Suckling Piglets ◽  
Major Impediment

Abstract Rotavirus C (RVC) has been detected increasingly in humans and swine in different countries, including the US. It is associated with significant economic losses due to diarrheal disease in nursing piglets. In this study we aimed: (1) to determine the prevalence of RVC in healthy and diarrheic suckling piglets on US farms; and (2) to evaluate if maternal antibody (Ab) levels were associated with protection of newborn suckling piglets against RVC. There was a significantly higher prevalence (p = 0.0002) of litters with diarrhea born to gilts compared with those born to multiparous sows. Of 113 nursing piglet fecal samples tested, 76.1% were RVC RNA positive. Fecal RVC RNA was detected in significantly (p = 0.0419) higher quantities and more frequently in piglets with diarrhea compared with healthy ones (82.5 vs. 69.9%). With the exception of the historic strain Cowden (G1 genotype), field RVC strains do not replicate in cell culture, which is a major impediment for studying RVC pathogenesis and immunity. To circumvent this, we generated RVC virus-like particles (VLPs) for Cowden (G1), RV0104 (G3) and RV0143 (G6) and used them as antigens in ELISA to detect swine RVC Abs in serum and milk from the sows. Using RVC-VLP Ab ELISA we demonstrated that sows with diarrheic litters had significantly lower RVC IgA and IgG Ab titers in milk compared to those with healthy litters. Thus, our data suggest that insufficient lactogenic protection provided by gilts plays a key role in the development of and the increased prevalence of clinical RVC disease.

Sign in / Sign up

Export Citation Format

Share Document