scholarly journals Development of diagnostic assays for rapid and sensitive detection of Phytophthora infecting major spices and plantation crops

1970 ◽  
Vol 27 (2) ◽  
pp. 119
Author(s):  
R T P Pandian, A I Bhat, C N Biju, S Sasi
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Black Pepper ◽  
Nuclear Ribosomal Dna ◽  
Diagnostic Tools ◽  
Diagnostic Assays ◽  
Horticultural Crops ◽  
Polymerase Chain ◽  
Plantation Crops ◽  
Epidemiological Significance

Phytophthora, the ubiquitous stramenopile phytopathogen is a major threat to several economically important horticultural crops including spices and plantation crops. Trans-seasonal survival of Phytophthora in plant debris and soil continuum has considerable epidemiological significance as the quiescent propagules often serve as primary foci of infection with inherent potential to trigger epiphytotics in the succeeding season favoured by conducive environmental conditions. Hence, early and rapid detection of over summering propagules is highly imperative to manage Phytophthora induced diseases efficiently and economically. Twelve isolates representing different species of Phytophthora (P. capsici, P. tropicalis, P. palmivora. P. citrophthora and P. meadii) representing hosts such as black pepper, cardamom, nutmeg, coconut, arecanut and cocoa were used to develop nucleic acid-based diagnostic tools viz., polymerase chain reaction (PCR), real-time PCR, loop-mediated isothermal amplification (LAMP) and real-time LAMP. Phytophthora genus-specific primers were designed from the conserved region of nuclear ribosomal DNA. Each of the assays was specific and detected different species of Phytophthora and not other pathogens (Rhizoctonia solani, Pythium vexans, Fusarium oxysporum and Colletotrichum gloeosporioides) and plant samples. Sensitivity assays indicated that, real-time PCR detected Phytophthora upto 1.3 fg, followed by LAMP (13 fg) and PCR (13 pg).

scholarly journals Comparing the efficacy of three diagnostic tools (microscopic examination, conventional PCR, and Real-Time PCR) in detecting Theileria equi infection among Egyptian equines

2021 ◽  
Author(s):  
Ahmed M. Soliman ◽  
Moaz M. Amer ◽  
Fareed Uddin Memon
Keyword(s):  
Real Time ◽  
Microscopic Examination ◽  
Real Time Pcr ◽  
Protozoan Parasite ◽  
Diagnostic Tools ◽  
Microscopical Examination ◽  
Conventional Pcr ◽  
Theileria Equi ◽  
Diagnostic Assays ◽  
Blood Smears

Abstract Equine theileriosis represents one of the main and serious health problems affecting equines industry globally, that is caused by tick-borne protozoan parasite called T. equi. This study aimed to assess the sensitivity of three diagnostic tools named: microscopic examination of a blood smear, conventional PCR, and Real-Time PCR (qPCR) to detect T. equi among equine population (n = 116) raised in Giza Governorate, Egypt. Microscopic examination of Giemsa-stained blood smears revealed the infection of 16.4% (19/116) of examined equines by T. equi while conventional PCR and qPCR revealed that 29.3% (34/116) and 43.1% (50/116) of examined equines were infected with T. equi respectively. Our results demonstrated that the qPCR had the highest sensitivity (100%) followed by conventional PCR (68%) while microscopic examination had the lowest sensitivity (38%). Furthermore, the negative predictive value (NPV) of qPCR was the highest (100%) compared to conventional PCR and microscopical examination (80.49% and 68.04% respectively) which revealed that all negative cases detected by qPCR were certainly correct compared to the other two diagnostic assays. Therefore, it is highly recommended to incorporate PCR diagnostic assays (conventional PCR and qPCR) alongside microscopic examination to evaluate the epidemiological status of equine theileriosis.

Diagnosis and Causative Species of Visceral Leishmaniasis in Southwest Saudi Arabia

2021 ◽  
Author(s):  
Aymen Abdelhaleem ◽  
Nabil Dhayhi ◽  
Mohamed Salih Mahfouz ◽  
Ommer Daffalla ◽  
Mansour Mubarki ◽  
...  
Keyword(s):  
Saudi Arabia ◽  
Visceral Leishmaniasis ◽  
Real Time ◽  
Real Time Pcr ◽  
Leishmania Donovani ◽  
Target Genes ◽  
Sample Volume ◽  
Pcr Products ◽  
Polymerase Chain ◽  
Robust Evidence

Visceral leishmaniasis (VL) is the most severe clinical form of the disease and has been reported in the Jazan region of southwest Saudi Arabia. This study aimed to diagnose VL by real-time polymerase chain reaction (PCR) and the direct agglutination test (DAT) and to identify the causative Leishmania species. A total of 80 participants, including 30 suspected VL patients, 30 healthy endemic control individuals, and 20 malaria disease controls, were enrolled in this study. Blood samples were collected and tested for Leishmania DNA by real-time PCR and for antibody by the DAT. Sequencing of some amplified PCR products was used to identify the causative Leishmania species. The diagnosis of VL was successfully achieved by both real-time PCR and by DAT with 100% sensitivity. Leishmania donovani and Leishmania infantum species were detected by sequencing both by the kDNA and ITS1 target genes, followed a BLASTn search. The detection of VL antibody by the DAT followed by the confirmatory detection of Leishmania DNA in patient blood by PCR could promote the adoption of the much less invasive and more sensitive methods for the routine diagnosis of VL. Further study with high sample volume to evaluate the PCR and the DAT are needed, to generate more robust evidence. Based on the sequencing results, emerging studies on VL should focus on the causative Leishmania species, reservoirs, and vectors that are important in the study area.

scholarly journals DETEKSI CLOSTRIDIUM DIFFICILE TOKSIGENIK MENGGUNAKAN UJI CEPAT TOKSIN DAN REAL TIME POLYMERASE CHAIN REACTION (Toxigenic Clostridium Difficile Detection Using Toxin Rapid Test and Real Time Polymerase Chain Reaction)

2018 ◽  
Vol 22 (1) ◽  
pp. 22
Author(s):  
Ika Yasma Yanti ◽  
Dalima Ari Wahono Astrawinata
Keyword(s):  
Polymerase Chain Reaction ◽  
Clostridium Difficile ◽  
Antibiotic Therapy ◽  
Real Time ◽  
Real Time Pcr ◽  
Rapid Test ◽  
Chain Reaction ◽  
Chi Square ◽  
Polymerase Chain ◽  
Clostridium Difficile Associated Diarrhea

Toxigenic Clostridium difficile infection, causing a Pseudo Membrane Colitis (PMC) and Clostridium Difficile Associated Diarrhea(CDAD) has increased sharply. The largest risk factor is the use of antibiotics. The purpose of this study was to know how to determinethe prevalence and characteristics of subjects with Toxigenic Clostridium difficile and to assess the ability of the toxin rapid test comparedto real-time PCR. Ninety adult subjects with antibiotic therapy more than two (2) weeks were enrolled in this study. The results of toxinrapid test and real-time PCR were presented in a 2x2 table, statistical test used was Chi square. The prevalence of Toxigenic Clostridiumdifficile based on the toxin rapid test and by real-time PCR was 27.3% and 37.5%, respectively. There were significant differences betweenstool consistency and number of antibiotics used with the detection of Toxigenic Clostridium difficile. There was a relationship betweenthe duration of antibiotic therapy with the detection of Toxigenic Clostridium difficile using real-time PCR (p=0.010, RR=2.116). Thesensitivity, specificity, PPV, NPV, PLR and NLR rapid test against real-time PCR were 69.7%; 98.2%; 95.8%; 84.4%; 39.2 and 0.31,respectively. This study concluded that the prevalence of Clostridium difficile in RSCM was higher compared to that in Malaysia, Thailandand India; the subjects with antibiotic therapy for more than four (4) weeks had a double risk to have Toxigenic Clostridium difficilethan subjects with antibiotic therapy for less than that time (4 weeks). Thus, in this study, toxin rapid test could be used as a tool todetect Toxigenic Clostridium difficile.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Quantitative Real-Time Polymerase Chain Reaction Detection of BK Virus Using Labeled Primers

2010 ◽  
Vol 134 (3) ◽  
pp. 444-448 ◽  
Author(s):  
Zhengming Gu ◽  
Jianmin Pan ◽  
Matthew J. Bankowski ◽  
Randall T. Hayden
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Quantitative Polymerase Chain Reaction ◽  
Bk Virus ◽  
Clinical Samples ◽  
Quantitative Detection ◽  
Chain Reaction ◽  
Pcr Method ◽  
Polymerase Chain

Abstract Context.—BK virus infections among immunocompromised patients are associated with disease of the kidney or urinary bladder. High viral loads, determined by quantitative polymerase chain reaction (PCR), have been correlated with clinical disease. Objective.—To develop and evaluate a novel method for real-time PCR detection and quantification of BK virus using labeled primers. Design.—Patient specimens (n = 54) included 17 plasma, 12 whole blood, and 25 urine samples. DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science, Indianapolis, Indiana); sample eluate was PCR-amplified using the labeled primer PCR method. Results were compared with those of a user-developed quantitative real-time PCR method (fluorescence resonance energy transfer probe hybridization). Results.—Labeled primer PCR detected less than 10 copies per reaction and showed quantitative linearity from 101 to 107 copies per reaction. Analytical specificity of labeled primer PCR was 100%. With clinical samples, labeled primer PCR demonstrated a trend toward improved sensitivity compared with the reference method. Quantitative assay comparison showed an R2 value of 0.96 between the 2 assays. Conclusions.—Real-time PCR using labeled primers is highly sensitive and specific for the quantitative detection of BK virus from a variety of clinical specimens. These data demonstrate the applicability of labeled primer PCR for quantitative viral detection and offer a simplified method that removes the need for separate oligonucleotide probes.

Rapid, specific and quantitative polymerase chain reaction (PCR) detection of pathogenic protozoa Entamoeba histolytica for drinking water supply

2011 ◽  
Vol 11 (4) ◽  
pp. 418-425 ◽  
Author(s):  
S. W. Lam ◽  
H. B. Zhang ◽  
L. Yu ◽  
C. H. Woo ◽  
K. N. Tiew ◽  
...  
Keyword(s):  
Real Time ◽  
Water Samples ◽  
Real Time Pcr ◽  
Genomic Dna ◽  
Tap Water ◽  
Pcr Detection ◽  
Raw Water ◽  
Conventional Pcr ◽  
Polymerase Chain ◽  
Species Specific

In this study, a quantitative species-specific polymerase chain reaction (PCR) method to rapidly detect E. histolytica in water is developed. First, the specificity of E. histolytica PCR detection was verified by using species-specific primers of 16S-like rRNA genes to clearly differentiate it from the closely related amoebae species E. dispar and E. moshkovskii. The sensitivity of this method was subsequently determined using purified E. histolytica genomic DNA and culture cells as PCR reaction templates. Results indicated that conventional PCR visualized on 1% agarose gel was able to detect as low as 0.02 pg genomic DNA and 5 cells, while real-time PCR could detect 0.01 pg genomic DNA and 2 cells of E. histolytica. The protocols for E. histolytica PCR detection in real water samples were then optimized by spiking E. histolytica cells into tap water and reservoir raw water samples. A two-round centrifugation treatment to concentrate amoeba cells directly as a PCR template was the most effective way to detect E. histolytica in spiked tap water samples, while DNA extraction after concentrating amoeba cells was required for spiked reservoir raw water samples. The detection limit of 50 E. histolytica cells in 100 ml tap water was achieved in 2 h from sample collection to real-time PCR data readout. With these established protocols, 78 tap water samples, 11 reservoir raw water samples and 4 feed water samples from Singapore water supply systems were analyzed by both conventional PCR and real-time PCR methods. No E. histolytica cell was detected in tested samples.

scholarly journals Development of Conventional Multiplex PCR: A Rapid Technique for Simultaneous Detection of Soil-Transmitted Helminths

Pathogens ◽  
2019 ◽  
Vol 8 (3) ◽  
pp. 152 ◽  
Author(s):  
Vivornpun Sanprasert ◽  
Ruthairat Kerdkaew ◽  
Siriporn Srirungruang ◽  
Sarit Charuchaibovorn ◽  
Kobpat Phadungsaksawasdi ◽  
...  
Keyword(s):  
Multiplex Pcr ◽  
Real Time ◽  
Real Time Pcr ◽  
Intestinal Parasites ◽  
Simultaneous Detection ◽  
Diagnostic Tools ◽  
Multiple Infections ◽  
Parasitic Infections ◽  
Soil Transmitted Helminths ◽  
Stool Samples

Soil-transmitted helminths (STHs) are the most common intestinal parasites infecting humans worldwide. STH infections are a major cause of morbidity and disability. Accurate diagnostic tools are pivotal for assessing the exact prevalence of parasitic infections. Microscopic examination and culture techniques have been used to observe the presence of eggs or larvae of parasites in stool samples, but they are time-consuming and have low sensitivity. Therefore, accurate, simple, and inexpensive diagnostic techniques are still required for simultaneous detection of STH infections. Although molecular-based techniques, such as real-time PCR and multiplex real-time PCR, have been developed, they are not suitable for routine diagnosis due to the requirement for expensive reagents and instruments. In this study, we established a conventional multiplex PCR for simultaneous rapid detection of Ascaris lumbricoides, Necator americanus, and Strongyloides stercoralis in stool samples. Our results show that the multiplex PCR could detect the DNA of STHs at a very low target gene concentrations (lower than 1 pg) with no cross-amplification. Multiplex PCR had five times higher sensitivity than the formalin–ethyl acetate concentration technique (FECT) in the detection of multiple infections, and two times higher for detection of S. stercoralis. However, multiplex PCR was comparable to FECT in the detection of A. lumbricoides and N. americanus. In conclusion, this method could be used as an alternative method for the detection of STHs, especially for S. stercoralis.

Sign in / Sign up

Export Citation Format

Share Document