NGHIÊN CỨU THÀNH PHẦN VÀ MẬT SỐ TUYẾN TRÙNG GÂY HẠI  TRÊN CÂY HỒ TIÊU TẠI CAM LỘ, QUẢNG TRỊ

Trần Thị Thu Hà; Nguyễn Tăng Tôn

doi:10.26459/jard.v67i4.3176

NGHIÊN CỨU THÀNH PHẦN VÀ MẬT SỐ TUYẾN TRÙNG GÂY HẠI TRÊN CÂY HỒ TIÊU TẠI CAM LỘ, QUẢNG TRỊ

HUE UNIVERSITY JOURNAL OF SCIENCE AGRICULTURE AND RURAL DEVELOPMENT ◽

10.26459/jard.v67i4.3176 ◽

2011 ◽

Vol 67 (4) ◽

Author(s):

Trần Thị Thu Hà ◽

Nguyễn Tăng Tôn

Keyword(s):

Meloidogyne Sp

Cây hồ tiêu hiện nay đang bị bệnh vàng lá gây hại, một trong những nguyên nhân gây bệnh là do tuyến trùng. Tuy nhiên, việc nghiên cứu về thành phần và mật số tuyến trùng gây hại còn hạn chế và biện pháp phòng trừ bệnh còn gặp nhiều khó khăn. Kết quả nghiên cứu ở rễ và đất trồng hồ tiêu tại Cam Lộ, Quảng Trị xác định được 12 giống tuyến trùng. Tuyến trùng Meloidogyne sp. rất phổ biến, tuyến trùng Pratylenchus sp. và Tylenchus sp. phổ biến, còn 9 giống tuyến trùng khác là ít phổ biến. Mật số tuyến trùng ký sinh thực vật và mật số tuyến trùng Meloidogyne sp. trong đất và rễ cao nhất ở tháng 2 bởi đây là thời điểm mùa mưa thích hợp cho tuyến trùng di chuyển, tìm kiếm thức ăn và sinh sản. Sau đó, tháng 10 và tháng 5 mật số tuyến trùng giảm đáng kể. Phương trình hồi quy tương quan giữa số nốt sưng ở rễ và mật số tuyến trùng Meloidogyne sp. trong rễ vào tháng 2 là y = 0,23x + 10,48 với hệ số tương quan R2 = 0,82 và tháng 5 là y = 1,38x + 7,77 với hệ số tương quan R2 = 0,75 và tháng 10 là y=1,3x + 1,50 với hệ số tương quan R2= 0,83.

Download Full-text

Third generation progress in breeding white clover for resistance to root-knot nematode

NZGA: Research and Practice Series ◽

10.33584/rps.6.1995.3360 ◽

1996 ◽

Vol 6 ◽

pp. 163-166

Author(s):

J. Van den Bosch ◽

C.F. Mercer

Keyword(s):

White Clover ◽

Trifolium Repens ◽

Egg Production ◽

Control Method ◽

Dry Weight ◽

Third Generation ◽

Root Knot Nematode ◽

Root Dry Weight ◽

Wide Range ◽

Meloidogyne Sp

Root-knot nematode (Meloidogyne sp.) reduces growth and nutrition of white clover (Trifolium repens L.) in New Zealand, and breeding resistant cultivars (with low galls per gram of root) is the preferred control method. Resistant and susceptible selections were bred from a wide range of white clover lines for three generations. In the third generation there were significant differences between seed lines from the selections for number of galls, root dry weight, visual growth score and galls/gram of root dry weight. Resistant selections had 43% of the susceptible selections' galls per gram, and 50% of the number of galls. Germplasm showing resistance to Meloidogyne spp. in the USA showed partial resistance to the local Meloidogyne sp. Two resistant and two susceptible genotypes were also compared for nematode egg production; resistant genotypes had a mean of 3,460 eggs/plant, compared to 25,030 for susceptible genotypes. Keywords: breeding, Meloidogyne sp., resistance, rootknot nematode, screening, selection, Trifolium repens, white clover

Download Full-text

First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽

10.1094/pdis-09-13-0953-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 702-702 ◽

Cited By ~ 1

Author(s):

B. Gao ◽

R. Y. Wang ◽

S. L. Chen ◽

X. H. Li ◽

J. Ma

Keyword(s):

Sweet Potato ◽

Dna Sequences ◽

Molecular Characteristics ◽

28S Rrna ◽

Storage Roots ◽

Specific Primers ◽

First Report ◽

Meloidogyne Enterolobii ◽

Meloidogyne Spp ◽

Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

Secondary metabolites produced by endophytic bacteria against the Root-Knot Nematode (Meloidogyne sp.)

Biodiversitas Journal of Biological Diversity ◽

10.13057/biodiv/d211130 ◽

2020 ◽

Vol 21 (11) ◽

Author(s):

Vina Maulidia ◽

Loekas Soesanto ◽

Syamsuddin Syamsuddin ◽

Khairan Khairan ◽

Takahiro Hamaguchi ◽

...

Keyword(s):

Secondary Metabolites ◽

Endophytic Bacteria ◽

Psidium Guajava ◽

Plant Tissues ◽

Root Number ◽

Root Knot Nematode ◽

Plant Host ◽

Tomato Plants ◽

Theobroma Cacao L ◽

Meloidogyne Sp

Abstract. Maulidia V, Soesanto L, Syamsuddin, Khairan K, Hamaguchi T, Hasegawa K, Sriwati R. 2020. Secondary metabolites produced by endophytic bacteria against the Root-Knot Nematode (Meloidogyne sp.). Biodiversitas 21: 5270-5275. Endophytic bacteria live and colonize in plant tissues without causing disease to their plant host. Among several processes, these bacteria can produce secondary metabolites that can help in the defense of plant host against pathogens. This study aimed to identify endophytic bacteria as biocontrol agents against Meloidogyne sp. in tomato plants. Six endophytic bacteria candidates from the genus Pseudomonas, Arthrobacter, Bacillus, and Serratia were isolated from Solanum Lycopersicum, Psidium guajava, Pinus merkusii, Dendrocalamus asper, Albizia chinensis, and Theobroma cacao L, respectively. The average mortality of Meloidogyne sp. by endophytic bacteria was 70,27% to 95,46%. From these, B. thuringiensis AK08 produced compounds of the secondary metabolites such as flavonoid, phenol, tannins, terpenoids, steroids, saponins, and alkaloids. The best result of the average incubation period, number of galls in the root, number of nematodes at the root, and the number of nematodes in the soil on tomato plant were shown by B. thuringiensis. The major compounds in GC-MS analysis of B. thuringiensis were cholest-5-en-3-ol (3.beta.)-carbonochloridate (25.35%). Bacillus thuringiensis not only has rules as bio-insecticide but also has nematicidal effect.

Download Full-text

First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽

10.1094/pdis-02-14-0119-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1019-1019 ◽

Cited By ~ 2

Author(s):

Y. F. Wang ◽

S. Xiao ◽

Y. K. Huang ◽

X. Zhou ◽

S. S. Zhang ◽

...

Keyword(s):

Morphological Characteristics ◽

Severe Infection ◽

Original Description ◽

First Record ◽

Vegetable Crops ◽

Species Identity ◽

Fujian Province ◽

First Report ◽

Lateral Lines ◽

Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

Biofumigación y solarización como estrategias de manejo de nematodos en tomate (Solanum lycopersicum)

Revista Alfa ◽

10.33996/revistaalfa.v5i15.131 ◽

2021 ◽

Vol 5 (15) ◽

pp. 489-496

Author(s):

Segundo Curay ◽

Marco Pérez Salinas Pérez Salinas ◽

Carlos Vásquez ◽

José Mangui ◽

Norma Telenchana

Keyword(s):

Solanum Lycopersicum ◽

Meloidogyne Sp

El control de los nematodos fitoparásitos se ha basado principalmente en el uso de productos químicos, los cuales cada vez presentan menor eficiencia, por lo que se requiere buscar estrategias ecológicamente sustentables. Se realizaron dos ensayos para evaluar el efecto de la biofumigacion y solarización sobre las poblaciones de nematodos en el cultivo de tomate (Solanum lycopersicum) bajo condiciones de invernadero. En el primer ensayo se estudió el efecto solo y combinado de la biofumigación con la solarización en el valle Quillan, Cantón Píllaro. En el segundo ensayo se evaluó el efecto del estado fenológico de la mostaza de abisinia en el control de nematodos en suelo en la Parroquia La Matriz del Cantón Píllaro. Se observó menor efecto en el control de Meloidogyne sp. (apenas 25%), mientras que en Xiphinema sp. provocó control total. No se observó efecto de la edad del material vegetal y el tipo de aplicación sobre el número de nematodos, sin embargo, si se observó efecto por el tiempo de acción de los extractos. Basados en los resultados, el uso de brasicáceas en combinación con solarización podría ser una alternativa viable para el manejo de poblaciones de nematodos en cultivos de tomate.

Download Full-text

Development of Diagnostic SCAR Markers for Meloidogyne graminicola, M. oryzae, and M. salasi Associated with Irrigated Rice Fields in Americas

Plant Disease ◽

10.1094/pdis-12-17-2015-re ◽

2019 ◽

Vol 103 (1) ◽

pp. 83-88 ◽

Cited By ~ 2

Author(s):

Vanessa da Silva Mattos ◽

Karine Mulet ◽

Juvenil Enrique Cares ◽

Cesar Bauer Gomes ◽

Diana Fernandez ◽

...

Keyword(s):

Oryza Sativa L ◽

Random Amplified Polymorphic Dna ◽

Rice Fields ◽

Correct Identification ◽

Scar Markers ◽

Irrigated Rice ◽

Meloidogyne Graminicola ◽

The World ◽

Meloidogyne Spp ◽

Meloidogyne Sp

Root-knot nematodes (RKN) cause important production losses of rice (Oryza sativa L.) in the world. Together with Meloidogyne graminicola Golden and Birchfield 1965, M. oryzae Maas, Sanders and Dede, 1978 and M. salasi López, 1984 have been causing damages in irrigated rice fields in Central and South America. In addition, six other RKN species may occur in rice fields in other regions of the world. Correct identification of Meloidogyne spp. is difficult but essential for the management of rice RKNs. The objective of this study was to develop some species-specific molecular markers for the diagnosis of South American RKN rice-related species. Isozyme phenotypes indicated the occurrence of some RKN species in the Brazilian samples, namely M. graminicola, M. oryzae, M. javanica, and two cryptic species designated as Meloidogyne sp. 2 and Meloidogyne sp. 3. Random amplified polymorphic DNA (RAPD) analysis of 16 isolates revealed interspecific genetic polymorphism between Meloidogyne spp., but isolates belonging to the same species (i.e., sharing the same esterase phenotype) always clustered together, whatever the species considered. Specific SCAR markers of 230, 120, and 160 bp were developed for M. graminicola, M. oryzae, and M. salasi, respectively. These SCAR markers may be potential molecular tools for application in routine diagnostic procedures subject to their validation with other rice RKN field populations in the world.

Download Full-text

Reacción de genotipos de lulo (Solanum quitoense Lam.) a Meloidogyne spp. en condiciones de campo

Ciencia y Tecnología Agropecuaria ◽

10.21930/rcta.vol18_num2_art:629 ◽

2017 ◽

Vol 18 (2) ◽

pp. 295

Author(s):

Claudia Salazar González

Keyword(s):

Meloidogyne Spp ◽

Meloidogyne Sp

En Colombia, los nematodos del nudo radical Meloidogyne spp. son considerados como uno de los principales inconvenientes en la producción de lulo, por los daños que ocasionan en las raíces y la pérdida de producción asociada. El objetivo de este estudio fue evaluar en condiciones de campo la reacción de 16 genotipos de lulo (Solanum quitoense Lam., Solanaceae), variedad Castilla y la especie S. hirtum Vahl (seleccionados previamente en un experimento en invernadero y categorizados como resistentes y mode-radamente resistentes) al ataque de Meloidogyne sp. Además, se incluyeron dos testigos: uno químico (nematicida) y uno absoluto (que correspondió al genotipo con mayor susceptibilidad en invernadero). El ensayo se estableció en un lote naturalmente infestado por el nematodo, en un diseño de bloques completos al azar con tres repeticiones y nueve plantas por cada unidad experimental. Las variables de respuesta fueron incidencia, severidad y rendimiento. La incidencia fue superior al 80 % en todos los casos, pero la severidad varió debido a su condición genética. BR03 y BR01 fueron los genotipos con índices de severidad más bajos, con valores de 1,0 y 0,8 respectivamente. El análisis de varianza de rendimiento mostró diferencias significativas y evidenció que los genotipos SQBR01 y SQLF04 alcanzaron los valores más altos con 4,77 y 4,74 t/ha en tres pases de cosecha.

Download Full-text

Attachment of endospores of Pasteuria penetrans to males and juveniles of Meloidogyne spp.

Nematology ◽

10.1163/156854199508252 ◽

1999 ◽

Vol 1 (3) ◽

pp. 267-271 ◽

Cited By ~ 3

Author(s):

Regina M.D.G. Carneiro ◽

Onivaldo Randig ◽

Leandro G. Freitas ◽

Don W. Dickson

Keyword(s):

Rio Grande ◽

In Vitro Assays ◽

Similar Degree ◽

Pasteuria Penetrans ◽

Race 1 ◽

Meloidogyne Spp ◽

Race 2 ◽

Pratylenchus Scribneri ◽

Meloidogyne Sp

Abstract The attachment of endospores to Meloidogyne spp. males and second stage juveniles (J2) was evaluated in two different in vitro assays of seven isolates of Pasteuria penetrans from Florida, USA. In the first assay, endospores of all seven isolates adhered to J2 but not males of M. arenaria race 1. In the second assay, two isolates differed in the specificity of spore attachment to J2 of six Meloidogyne spp. Isolate B4, from Pratylenchus scribneri, showed a similar degree of attachment to J2 of M. arenaria race 2, M. javanica (two populations) and to M. incognita race 3, but did not attach to males of seven species. Isolate P100, from Meloidogyne sp., had high rates of attachment to M. javanica from Rio Grande do Sul State and to M. paranaensis, but lower rates to M. arenaria and M. javanica from Parana State. These data indicate that attachment ability depends not only on the Meloidogyne species but also on the particular population of a species. The high rate of attachment to male but not J2 M. hapla indicates that endospore attachment may also depend upon nematode stage, species, race and population and on Pasteuria isolate. Germinated endospores attached to male M. hapla were examined by scanning electron microscopy but few had successfully penetrated the cuticle. Adhesion des endospores de Pasteuria penetrans aux males et juveniles de Meloidogyne spp. - L'adhesion des spores de Pasteuria penetrans aux males et juveniles de deuxieme stade (J2) de Meloidogyne spp. a ete evaluee lors de deux differents tests in vitro comprenant sept isolats de P. penetrans provenant de Floride, USA. Lors du premier test les endospores des sept isolats ont adhere aux J2 mais non aux males de M. arenaria race 1. Lors du second test deux isolats se sont distingues quant a la specificite de l'adhesion de leurs spores aux J2 de six des especes de Meloidogyne. L'isolat B4, provenant de Pratylenchus scribneri, montre un taux d'adhesion similaire vis-a-vis des J2 de M. arenaria race 2, M. javanica (deux populations) et M. incognita race 3, mais n'adhere aux males d'aucune des sept especes. L'isolat P 100, provenant de Meloidogyne sp., Montre un taux d'adhesion eleve vis-a-vis tant de M. javanica provenant de l'Etat de Rio Grande del Sul que de M. paranensis mais ce taux est faible vis-a-vis de M. arenaria et M. javanica originaires de l'Etat du Parana. Ces donnees indiquent que la faculte d'adhesion depend non seulement de l'espece de Meloidogyne en cause mais egalement de la population particuliere de cette espece. Le taux eleve d'adhesion vis-a-vis des males, mais non des J2, de M. hapla indique que cette adhesion peut dependre du stade de developpement du nematode, de son espece, race ou population ainsi que de l'isolat lui-meme de P. penetrans. Les endospores fixees aux males de M. hapla, et ayant germe, ont ete examinees en microscopie electronique a balayage: peu d'entre elles avaient reussi a traverser la cuticule.

Download Full-text

Pathogenicity of Meloidogyne spp. (Tylenchida: Meloidogynidae) isolates from Central America and Brazil on four genotypes of Coffea arabica

Nematology ◽

10.1163/1568541041217898 ◽

2004 ◽

Vol 6 (2) ◽

pp. 205-213 ◽

Cited By ~ 5

Author(s):

Adan Hernandez ◽

Mireille Fargette ◽

Jean-Louis Sarah

Keyword(s):

El Salvador ◽

Central America ◽

Coffea Arabica ◽

Management Strategies ◽

High Rate ◽

Coffee Plantations ◽

Wide Range ◽

Meloidogyne Spp ◽

Meloidogyne Sp ◽

Low Rate

Abstract Fifteen isolates of Meloidogyne spp. collected from coffee plantations in every country in Central America, with one isolate from Brazil, were inoculated on two common cultivars (Catuai and Sarchimor) and two wild genotypes from Ethiopia (ET15 and ET28) of coffee (Coffea arabica) under controlled conditions. These isolates displayed a wide range of pathogenicity on the different varieties. Meloidogyne sp. 2 isolate esterase 'VS1S1' from Guatemala, was unable to multiply on any cultivar. All other isolates multiplied on cv. Catuai. The Meloidogyne incognita isolate from Brazil did not multiply on cv. Sarchimor or genotype ET28. Four Meloidogyne sp. 1 (esterase 'F1') isolates from Guatemala multiplied at relatively low rates on cv. Sarchimor, but did not multiply on genotypes ET15 and ET28. Meloidogyne arenaria and Meloidogyne sp. 3 (displaying the new esterase phenotype 'M1F1a'), both from El Salvador, multiplied at a high rate on cv. Sarchimor; M. arenaria multiplied at a low rate on genotype ET15, but did not multiply on genotype ET28. Meloidogyne sp. 3 multiplied at a low rate on genotype ET28. Meloidogyne sp. 4 from El Salvador (esterase 'Sa4') multiplied at a high rate on genotype ET15. The M. arabicida isolate from Costa Rica did not multiply at all on genotype ET15. All isolates of Meloidogyne exigua multiplied on cv. Sarchimor as well as on both Ethiopian genotypes. This new information highlights the great parasitic diversity of root-knot nematodes parasitising coffee in Central America, a diversity which must be taken into account when developing integrated pest management strategies and breeding for resistance to nematodes.

Download Full-text