scholarly journals Surveillance of non-indigenous invertebrate species through DNA metabarcoding in recreational marinas in the North and Center of Portugal

2021 ◽  
Vol 4 ◽  
Author(s):  
Ana Lavrador ◽  
Fábio Amaral ◽  
Pedro E. Vieira ◽  
Filipe Costa ◽  
Sofia Duarte
Keyword(s):  
Molecular Markers ◽  
Early Detection ◽  
Molecular Marker ◽  
Sampling Method ◽  
Current Flow ◽  
Indigenous Species ◽  
Oxidase Gene ◽  
The North ◽  
Dna Metabarcoding ◽  
Hard Substrates

DNA metabarcoding has been widely used in biodiversity assessments as a complement to traditional morphology-based techniques. This technique is useful for the early detection and surveillance of non-indigenous species (NIS) in aquatic ecosystems. When introduced to new locations, NIS can establish, and become invasive, which may cause severe alterations to native ecosystems and biodiversity. As most introductions in coastal ecosystems occur by transport in ships (through ballast waters discharges and biofouling), ports and marinas are priority hubs for the early detection of NIS. The aim of this study was to survey marine invertebrate NIS in four marinas in the north and center of Portugal using (e)DNA metabarcoding and different sampling methodologies. We sampled four marinas in three locations in Portugal spanning a distance of ca. 150 km: one in Viana do Castelo (VC), one in Porto (L), inside the port of Leixões, and two in Aveiro (Av1: Costa Nova and Av2: Oudinot). Viana do Castelo, Porto, and Oudinot marinas are more sheltered, located near the coast, with a lower current flow, while Costa Nova marina is located inside a channel, more exposed to the passage of ships and to a higher current flow. Samples were taken of the organisms colonizing the marinas’ hard substrates (e.g., pontoons, buoys, ropes), as well as from water, for environmental DNA (eDNA) analysis, and zooplankton, collected using a 55-µm mesh net. We used two molecular markers: the mitochondrial cytochrome c oxidase gene (COI) and the small subunit ribosomal RNA gene (18S) to produce amplicon libraries for each sample, which were high throughput sequenced in an Illumina MiSeq platform. mBRAVE and SILVAngs were then used to process the sequence data and to generate species-level assignments for COI and 18S data, respectively. A total of 23 NIS was detected in this study: 13 using each molecular marker. Only 3 NIS were detected using both markers. The highest number of NIS was detected in the Av1 marina with COI (11), whereas in the other marinas this number ranged from 5-9 NIS depending on the molecular marker. Six NIS were common to all the marinas, amongst which Amphibalanus amphitrite and Amphibalanus eburneus, two invasive barnacle species and Eriocheir sinensis, the Chinese mitten crab, a very well-known species with invasive behavior that causes severe ecological and economic damages. Fifty percent of NIS belonged to the phyla Arthropoda: Crustacea and Chordata: Ascidiacea. The sampling method that registered the highest number of NIS (9) was the eDNA from water in Av1, using COI. Overall, 18S detected approximately 1,6 times higher numbers of OTUs (237-267), phyla (16-21) and species (179-210) than COI, and only 5-6% of species were detected using both markers. Regarding the type of sampling method, the zooplankton samples retrieved the highest number of phyla (20 in VC; COI: 12 and 18S: 20) and more species (40 to 155; COI: 90 and 18S: 155), namely from Mollusca and Annelida. Between the three methods, there were only 21 (COI) to 28% (18S) of shared species. Crustacea dominated most samples collected from hard substrates. As for marinas, VC had the highest number of recovered OTUs (267), phyla (21) and species (210), when analyzed with the 18S marker, and the lowest number of OTUs (94) and species (86) was recovered in Av1 with COI. Coincidently, this was also the marina with the highest number of NIS probably due to its more exposed location. These results show the efficiency of NIS detection using (e)DNA metabarcoding but reveal the need to employ different molecular markers and sampling methodologies to guarantee a more comprehensive surveillance and detection of NIS in these environments.

scholarly journals Bulked Segregant Analysis Identifies Molecular Markers Linked to Melampsora medusae Resistance in Populus deltoides

2000 ◽  
Vol 90 (9) ◽  
pp. 1039-1042 ◽  
Author(s):  
G. M. Tabor ◽  
T. L. Kubisiak ◽  
N. B. Klopfenstein ◽  
R. B. Hall ◽  
H. S. McNabb McNabb
Keyword(s):  
Molecular Markers ◽  
Leaf Rust ◽  
Populus Deltoides ◽  
Bulked Segregant Analysis ◽  
Random Amplified Polymorphic Dna ◽  
Genetic Distances ◽  
Resistance Locus ◽  
The North ◽  
Melampsora Medusae ◽  
Central United States

In the north central United States, leaf rust caused by Melampsora medusae is a major disease problem on Populus deltoides. In this study we identified molecular markers linked to a M. medusae resistance locus (Lrd1) that was segregating 1:1 within an intraspecific P. deltoides family (C9425DD). Previous field results were confirmed in the controlled environment of a growth chamber through an excised whole-leaf inoculation method. Using bulked segregant analysis we identified two random amplified polymorphic DNA (RAPD) markers (OPG10340 and OPZ191800) that are linked to Lrd1. Based on segregation in a total of 116 progeny, the genetic distances between OPG10340 and OPZ191800 and the resistance locus were estimated as 2.6 and 7.4 Haldane centimorgans (cM), respectively. Multipoint linkage analyses strongly suggest the most likely order for these loci is Lrd1, OPG10340, and OPZ191800. These markers may prove to be instrumental in the eventual cloning of Lrd1, as well as for marker-assisted selection of leaf-rust resistant genotypes.

scholarly journals The Influence of Accountability, Work Experience and Professionalism on The Quality of The Quality of The Work of Auditors

2020 ◽  
Vol 4 (3) ◽  
pp. 449-459
Author(s):  
Sihol Marito Simorangkir ◽  
Jonathan Dubery Bukit ◽  
Keumala Hayati
Keyword(s):  
Work Experience ◽  
Sampling Method ◽  
Financial Statements ◽  
The North ◽  
Sample Technique ◽  
Saturated Sample ◽  
High Level ◽  
North Sumatra ◽  
Regression Tests

The study was conducted aimed at examining the effect of accountability, work experience, and professionalism on the quality of auditor performance. auditors are required to have a high level of accountability because the auditor will present financial statements that must be accountable by himself. In addition to having a high accountability the auditor should also have good work experience so that the auditor can convey a logical and logical understanding of the errors contained in the financial statements. And auditors also require high professionalism so that auditors can carry out professional and good tasks. The object of research is the auditor who is working at the North Sumatra BPKP Office. The data is 70 respondents. The sampling method is the saturated sample technique. Analyze the data using validity, reliability and linear regression tests. And the results of the study prove that accountability has an influence on the quality of the work of the auditor, while work experience and professionalism do not have an influence on the quality of the work of the audiores.

scholarly journals Further spreading of the non-indigenous bryozoan Celleporaria brunnea in the Mediterranean Sea: port to port morphological variations

2015 ◽  
Author(s):  
Jasmine Ferrario ◽  
Agnese Marchini ◽  
Martina Marić ◽  
Dan Minchin ◽  
Anna Occhipinti-Ambrogi
Keyword(s):  
Mediterranean Sea ◽  
Western Mediterranean ◽  
Indigenous Species ◽  
Large Variability ◽  
Morphometric Characters ◽  
Morphological Variations ◽  
The North ◽  
Western Mediterranean Sea ◽  
The Pacific ◽  
The Mediterranean

The Pacific cheilostome bryozoan Celleporaria brunnea (Hincks, 1884), a non-indigenous species already known for the Mediterranean Sea, was recorded in 2013-2014 from nine Italian port localities (Genoa, Santa Margherita Ligure, La Spezia, Leghorn, Viareggio, Olbia, Porto Rotondo, Porto Torres and Castelsardo) in the North-western Mediterranean Sea; in 2014 it was also found for the first time in the Adriatic Sea, in the marina “Kornati”, Biograd na Moru (Croatia). In Italy, specimens of C. brunnea were found in 44 out of 105 samples (48% from harbour sites ad 52% from marinas). These data confirm and update the distribution of C. brunnea in the Mediterranean Sea, and provide evidence that recreational boating is a vector responsible for the successful spread of this species. Previous literature data have shown the existence of differences in orifice and interzooidal avicularia length and width among different localities of the invaded range of C. brunnea. Therefore, measurements of orifice and avicularia were assessed for respectively 30 zooids and 8 to 30 interzooidal avicularia for both Italian and Croatian localities, and compared with literature data, in order to verify the existence of differences in the populations of C. brunnea that could reflect the geographic pattern of its invasion range. Our data show high variability of orifice measures among and within localities: zooids with broader than long orifice coexisted with others displaying longer than broad orifice, or similar values for both length and width. The morphological variation of C. brunnea in these localities, and above all the large variability of samples within single localities or even within colonies poses questions on the reliability of such morphometric characters for inter and intraspecific evaluations.

scholarly journals Scientific collaboration for early detection of invaders results in a significant update on estimated range: lessons from Stenothoe georgiana Bynum & Fox 1977

2020 ◽  
Author(s):  
GEMMA MARTÍNEZ-LAIZ ◽  
MACARENA ROS ◽  
JOSÉ MANUEL GUERRA-GARCÍA ◽  
AGNESE MARCHINI ◽  
VICTORIA FERNÁNDEZ-GONZÁLEZ ◽  
...  
Keyword(s):  
Early Detection ◽  
First Record ◽  
Western Mediterranean ◽  
Mediterranean Coast ◽  
Amphipod Species ◽  
Indigenous Species ◽  
Scientific Cooperation ◽  
Vectors Of Introduction ◽  
Non Indigenous Species ◽  
Effective Spread

Detection of new non-indigenous species is often delayed when taxonomically challenging taxa are involved, such as small-sized marine organisms. The present study highlights the relevance of scientific cooperation in the early detection of the invader amphipod Stenothoe georgiana. Originally described from North Carolina (USA), the species was recently found in Chile and the Western Mediterranean. Here, we provide the first record of the species in Macaronesia, Atlantic coasts of continental Europe, North Africa and Australia, and extend its known distribution along the Mediterranean coast. Just like other small crustaceans, shipping (including recreational boating) and aquaculture are probably the main vectors of introduction and secondary spread for this amphipod species. This case of S. georgiana sheds light on the importance of promoting taxonomical knowledge, and building multidisciplinary expertise networks that ensure an effective spread of alien species information. We also encourage the implementation of standardized monitoring methodologies to facilitate early detection of small mobile invaders. 

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

Jurnal BIOMA ◽  
2017 ◽  
Vol 13 (1) ◽  
pp. 33-36
Author(s):  
Rini Puspitaningrum ◽  
Ria Amelia ◽  
Adisyahputra Adisyahputra
Keyword(s):  
Molecular Markers ◽  
Glycine Max ◽  
Molecular Marker ◽  
Pcr Amplification ◽  
Housekeeping Gene ◽  
Descriptive Study ◽  
Gene Fragment ◽  
Lectin Gene ◽  
Glycine Max L

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.

scholarly journals Connectivity of larval stages of sedentary marine communities between hard substrates and offshore structures in the North Sea

2018 ◽  
Vol 8 (1) ◽  
Author(s):  
Johan van der Molen ◽  
Luz María García-García ◽  
Paul Whomersley ◽  
Alexander Callaway ◽  
Paulette E. Posen ◽  
...  
Keyword(s):  
North Sea ◽  
Offshore Structures ◽  
Marine Communities ◽  
Larval Stages ◽  
The North ◽  
The North Sea ◽  
Hard Substrates

Seawater warming at the northern reach for southern species: Gulf of Genoa, NW Mediterranean

2017 ◽  
Vol 98 (1) ◽  
pp. 1-12 ◽  
Author(s):  
Carlo Nike Bianchi ◽  
Francesco Caroli ◽  
Paolo Guidetti ◽  
Carla Morri
Keyword(s):  
Mediterranean Sea ◽  
Native Species ◽  
Indigenous Species ◽  
Ligurian Sea ◽  
The North ◽  
Nw Mediterranean ◽  
The Mediterranean ◽  
Non Indigenous Species ◽  
Southern Species ◽  
North Western

Global warming is facilitating the poleward range expansion of plant and animal species. In the Mediterranean Sea, the concurrent temperature increase and abundance of (sub)tropical non-indigenous species (NIS) is leading to the so-called ‘tropicalization’ of the Mediterranean Sea, which is dramatically evident in the south-eastern sectors of the basin. At the same time, the colder north-western sectors of the basin have been said to undergo a process of ‘meridionalization’, that is the establishment of warm-water native species (WWN) previously restricted to the southern sectors. The Gulf of Genoa (Ligurian Sea) is the north-western reach for southern species of whatever origin in the Mediterranean. Recent (up to 2015) observations of NIS and WWN by diving have been collated to update previous similar inventories. In addition, the relative occurrences of both groups of southern species have been monitored by snorkelling between 2009 and 2015 in shallow rocky reefs at Genoa, and compared with the trend in air and sea surface temperatures. A total of 20 southern species (11 NIS and 9 WWN) was found. Two WWN (the zebra seabream Diplodus cervinus and the parrotfish Sparisoma cretense) and three NIS (the SW Atlantic sponge Paraleucilla magna, the Red Sea polychaete Branchiomma luctuosum, and the amphi-American and amphi-Atlantic crab Percnon gibbesi) are new records for the Ligurian Sea, whereas juveniles of the Indo-Pacific bluespotted cornetfish Fistularia commersonii have been found for the first time. While temperature has kept on increasing for the whole period, with 2014 and 2015 being the warmest years since at least 1950, the number of WWN increased linearly, that of NIS increased exponentially, contradicting the idea of meridionalization and supporting that of tropicalization even in the northern sectors of the Mediterranean basin.

scholarly journals Pengaruh Pemahaman Peraturan Perpajakan Terhadap Kepatuhan WPOP Dengan Preferensi Resiko Sebagai Variabel Pemoderasi

2019 ◽  
pp. 109
Author(s):  
Putu Devi Ayu Utari ◽  
Putu Ery Setiawan
Keyword(s):  
Regression Analysis ◽  
Sampling Method ◽  
Tax Compliance ◽  
Risk Preference ◽  
The North ◽  
Analysis Technique ◽  
Minimum Number ◽  
Questionnaire Method ◽  
Relationship Of ◽  
The Relationship

Badung Utara, Badung Utara, Badung Utara. To find out whether the preference must be able to moderate the relationship between understanding of tax regulations on individual taxpayer regulations in the North Badung region. The minimum number of samples used in the study were 100 (one hundred) individual taxpayers at North Badung KPP Pratama. This study uses the accidential sampling method. The method of data collection uses the questionnaire method. The data analysis technique used is Moderated Regression Analysis (MRA). The results obtained related to understanding tax regulations, positive and significant to taxpayer obligations, as well as risk preferences can moderate the relationship of understanding tax regulations with taxpayer assistance. Keywords: Understanding of Taxes, Tax Compliance, Risk Preference.

scholarly journals Stalked crinoids (Echinodermata) collected by the R/V Polarstern and Meteor in the south Atlantic and in Antarctica

Zootaxa ◽  
2012 ◽  
Vol 3425 (1) ◽  
pp. 1 ◽  
Author(s):  
MARC ELÉAUME ◽  
JENS-MICHAEL BOHN ◽  
MICHEL ROUX ◽  
NADIA AMÉZIANE
Keyword(s):  
North Atlantic ◽  
Deep Sea ◽  
South Atlantic ◽  
The South ◽  
The West ◽  
Walvis Ridge ◽  
The North ◽  
West Antarctic ◽  
Stalked Crinoids ◽  
Hard Substrates

During the last decades, R/V Meteor and R/V Polarstern deep-sea investigations in the south Atlantic and neighbouringSouthern Ocean collected new samples of stalked crinoids belonging to the families Bathycrinidae, Phrynocrinidae andHyocrinidae which are herein described. The species found are Bathycrinus australis A.H. Clark, 1907b (the most abun-dant), Dumetocrinus aff. antarcticus (Bather, 1908), Hyocrinus bethellianus Thomson, 1876, Feracrinus heinzelleri newspecies, and Porphyrocrinus cf. incrassatus (Gislén, 1933). As only stalk fragments of bathycrinids were frequently col-lected, a distinction between the two Atlantic species B. australis and B. aldrichianus is proposed using characters of co-lumnal articulations. A few specimens attributed to Porphyrocrinus cf. incrassatus, Hyocrinus bethellianus and Hyocrinussp. collected by the N/O Jean Charcot on the Walvis Ridge are also described, plus a new specimen of Porphyrocrinusincrassatus collected in the central mid-Atlantic. Biogeography and close affinities between species in the genera Bathy-crinus and Porphyrocrinus suggest an Antarctic origin of some stalked crinoids among the north Atlantic deep-sea fauna.The presence of B. australis in both the Angola and Cape basins suggests that the Walvis Ridge is not a bio-geographicalbarrier for this relatively eurybathic species, which can attach to hard substrates as well as anchor in sediment. The genusDumetocrinus seems to be an example of colonization of the west Antarctic platform from deeper environment where its ancestor lived.

scholarly journals Limits of Diagnosis and Molecular Markers for Early Detection of Ulcerative Colitis-Associated Colorectal Neoplasia

Digestion ◽  
2008 ◽  
Vol 77 (1) ◽  
pp. 2-12 ◽  
Author(s):  
Shigehiko Fujii ◽  
Daisuke Katsumata ◽  
Takahiro Fujimori
Keyword(s):  
Ulcerative Colitis ◽  
Molecular Markers ◽  
Early Detection ◽  
Colorectal Neoplasia
Sign in / Sign up

Export Citation Format

Share Document