Relationships among amino acid sequences of animal, microbial and plant peroxidases

1992 ◽  
Vol 84-84 (5-6) ◽  
pp. 643-655 ◽  
Author(s):  
H. Tyson
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequences ◽  
Plant Peroxidases

An Anionic, Stem-Specific Flax Peroxidase cDNA With C-Terminal Motifs Also Found in a Blue Copper-Type Pea Protein Correlated With Lignin Deposition

1996 ◽  
Vol 23 (6) ◽  
pp. 773 ◽  
Author(s):  
F Omann ◽  
H Tyson
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Catalytic Domain ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Specific Expression ◽  
Blue Copper ◽  
Linum Usitatissimum L ◽  
Plant Peroxidases ◽  
Lignin Deposition

A flax (Linum usitatissimum L.) peroxidase cDNA (FLXPER1) was isolated from a �gt10 library made from RNA derived from shoot tissue of the cultivar Stormont Cirrus, by screening with probes encoding amino termini of flax peroxidases. The probes were obtained by PCR amplification of the library with the �gt10 reverse primer 5'CTTATGAGTATTTCTTCCAGGGTA3' flanking the Eco RI cloning site, and a mixed oligonucleotide derived from the catalytic domain (HFHDCFV) found in all plant peroxidases. FLXPER1 is the second flax peroxidase to be so isolated and described, following the previously documented FLXPER2 (Omann et al. 1994, Genome 37, 137-147). These two cDNAs are the completely sequenced members of a family currently encompassing FLXPER1 to FLXPER4, all isolated from the same �gt10 library. FLXPER3 and 4 will be separately described and related to FLXPER1, 2. The FLXPER1 deduced amino acid sequence reveals a signal peptide of 27 amino acids, and an anionic mature protein with seven potential N-linked glycosylation sites in its 332 amino acids (38.25 kDa; pI 4.38). The FLXPER1 C terminus is similar to plant peroxidases with a putative C-terminal vacuolar targeting signal, but also contains amino acid motifs with striking homologies to the membrane anchoring motifs of a pea blue copper type protein correlated with lignin deposition. Northern blot analysis demonstrated its stem specific expression. Southern blots suggested one to five copies of FLXPER1 in the flax genome, compared with one to two for FLXPER2. FLXPER1 resembles cucumber, poplar and tobacco amino acid sequences; its asymmetry in codon usage coincides with that of other dicotyledon peroxidases, i.e. much lower than in monocotyledon peroxidases.

Relationships, derived from optimum alignments, among amino acid sequences of plant peroxidases

1992 ◽  
Vol 70 (3) ◽  
pp. 543-556 ◽  
Author(s):  
Hugh Tyson
Keyword(s):  
Amino Acid ◽  
Dna Sequences ◽  
Average Distance ◽  
Amino Acid Sequences ◽  
Pairwise Distance ◽  
Distance Measurements ◽  
Plant Peroxidases ◽  
Optimum Alignment ◽  
Sequence Relationships ◽  
Sequence Similarities

The amino acid and (or) DNA sequences of 13 plant peroxidases (EC 1.11.1.7), which include isozymes within species, are currently available in data bases; all have similar lengths of approximately 300 amino acids. Sequence relationships among these 13, plus 2 microbial peroxidases of similar length, were examined. The 15 sequences were compared in all 105 pairwise combinations using optimum alignment procedures. Gap penalties were determined from analysis of penalty change effects. Distances between sequences generated by optimum alignments were analysed by clustering techniques to generate dendrograms. Specific distances, which provided pairwise distance measurements independent of the average distance for a sequence, were used to evaluate sequence similarities; closely related sequences produce closely correlated specific distances. Among the seven plant species, five subgroups were established: (1) horseradish isoperoxidases, (2) turnip and wheat, (3) cucumber and tobacco, (4) potato and tomato, and (5) in which cytochrome c peroxidase showed some similarity to ligninase, but both were only distantly related to plant peroxidases. Horseradish isoperoxidases were related to sequences in subgroups 2, 3, and 4 but resembled subgroups 2 and 3 more closely than 4. Subgroup 2 was more related to 3 than any other. Key words: plant peroxidases, sequence relationships, peroxidase profiles.

Diversity of Primary Structures of the Carboxy-terminal Regions of Mammalian Fibrinogen Aα-Chains

1993 ◽  
Vol 69 (04) ◽  
pp. 351-360 ◽  
Author(s):  
Masahiro Murakawa ◽  
Takashi Okamura ◽  
Takumi Kamura ◽  
Tsunefumi Shibuya ◽  
Mine Harada ◽  
...  
Keyword(s):  
Amino Acid ◽  
Rhesus Monkey ◽  
Syrian Hamster ◽  
Tandem Repeats ◽  
Mammalian Species ◽  
Amino Acid Sequences ◽  
Point Of View ◽  
Cross Linking ◽  
Amino Terminal ◽  
Rgd Sequence

SummaryThe partial amino acid sequences of fibrinogen Aα-chains from five mammalian species have been inferred by means of the polymerase chain reaction (PCR). From the genomic DNA of the rhesus monkey, pig, dog, mouse and Syrian hamster, the DNA fragments coding for α-C domains in the Aα-chains were amplified and sequenced. In all species examined, four cysteine residues were always conserved at the homologous positions. The carboxy- and amino-terminal portions of the α-C domains showed a considerable homology among the species. However, the sizes of the middle portions, which corresponded to the internal repeat structures, showed an apparent variability because of several insertions and/or deletions. In the rhesus monkey, pig, mouse and Syrian hamster, 13 amino acid tandem repeats fundamentally similar to those in humans and the rat were identified. In the dog, however, tandem repeats were found to consist of 18 amino acids, suggesting an independent multiplication of the canine repeats. The sites of the α-chain cross-linking acceptor and α2-plasmin inhibitor cross-linking donor were not always evolutionally conserved. The arginyl-glycyl-aspartic acid (RGD) sequence was not found in the amplified region of either the rhesus monkey or the pig. In the canine α-C domain, two RGD sequences were identified at the homologous positions to both rat and human RGD S. In the Syrian hamster, a single RGD sequence was found at the same position to that of the rat. Triplication of the RGD sequences was seen in the murine fibrinogen α-C domain around the homologous site to the rat RGDS sequence. These findings are of some interest from the point of view of structure-function and evolutionary relationships in the mammalian fibrinogen Aα-chains.

Bovine Factors X1And X2: Activation Peptide Based Chromatographic Differences

1979 ◽  
Author(s):  
Takashi Morita ◽  
Craig Jackson
Keyword(s):  
Amino Acid ◽  
Anion Exchange ◽  
Gel Filtration ◽  
Heart Association ◽  
Personal Communication ◽  
Exchange Chromatography ◽  
Amino Acid Sequences ◽  
Factor X ◽  
Activation Peptide ◽  
Activation Peptides

Bovine Factor X is eluted in two forms (X1and X2) from anion exchange chromatographic columns. These two forms have indistinguishable amino acid compositions, molecular weights and specific activities. The amino acid sequences containing the γ-carboxyglutamic acid residues have been shown to be identical in X1 and X2(H. Morris, personal communication). An activation peptide is released from the N-terminal region of the heavy chain of Factor X by an activator from Russell’s viper venom. This peptide can be isolated after activation by gel filtration on Sephadex G-100 under nondenaturing conditions. The activation peptides from a mixture of Factors X1 and X2 were separated into two forms by anion-exchange chromatography. The activation peptide (AP1) which eluted first was shown to be derived from Factor X1. while the activation peptiae (AP2) which eluted second was shown to be derived from X2 on the basis of chromatographic separations carried out on Factors X1 and X2 separately. Factor Xa was eluted as a symmetrical single peak. On the basis of these and other data characterizing these products, we conclude that the difference between X1 and X2 are properties of the structures of the activation peptides. (Supported by a grant HL 12820 from the National Heart, Lung and Blood Institute. C.M.J. is an Established Investigator of the American Heart Association).

Application of the Innovative and Non-Invasive Technique, Molecular Music Therapy (MMT), Bio-Frequency Therapy, for the Treatment of a Wide Range of Disorders and Pathologies, with Consequent Verification of Molecular Parameters by Using Bi-Digital O-Ring Test (BDORT)

2020 ◽  
Vol 44 (3) ◽  
pp. 177-189
Author(s):  
Momir Dunjic ◽  
Stefano Turini ◽  
Dejan Krstic ◽  
Katarina Dunjic ◽  
Marija Dunjic ◽  
...  
Keyword(s):  
Amino Acid ◽  
Music Therapy ◽  
Amino Acid Sequences ◽  
Sirtuin 1 ◽  
Ring Test ◽  
Invasive Technique ◽  
Specific Gene ◽  
Radiofrequency Therapy ◽  
Wide Range ◽  
Clinical Pictures

Radiofrequency therapy is an unconventional method, already applied for some time, with numerous results in numerous clinical pictures. Our group has developed a software, later called SONGENPROT-SOLARIS, capable of directly converting nucleotide sequences (DNA and/or RNA) and amino acid sequences (polypeptides and proteins) into musical sequences, based on mathematic matrices, designed by the French physicist and musician Joel Sternheimer, which allows to associate a musical note with a nucleotide or an amino acid. Innovation in our software is that, in the algorithm that defines it, a variant is directly implemented that allows the reproduction of sounds, phase-shifted by 30 Hz, between one ear and another reproducing the phenomenon of Binaural Tones, capable of induce a specific brain activity and also the release of particles called solitons. Thanks to this software we have developed a technique called MMT (Molecular Music Therapy) and currently, we are in the phase of applying the technique on a cohort of 91 patients, with a high spectrum of clinical pictures, examining the same, using the technique Bi-Digital-ORing-Test (BDORT), before and after treatment with MMT. Aim of project is to stimulate the expression of a specific gene (the same genetic sequence that the patient listens to, translated into music), only through the use of sound sequences. We have concentrated our attention on three main molecules: Sirtuin-1, Telomers and TP-53. The results obtained with BDORT, after treatment with MMT, showed a significant increase in the values of the three molecules, on all the examined patients, demonstrating the operative efficacy of the technique and the its applicability to numerous diseases. In order to confirm the data obtained by BDORT, we propose, with the help of an accredited laboratory, to perform epigenetic tests on the three parameters listed above, paving the way to understanding how frequencies can influence gene expression.

The Inducing Roles of the New Isolated Bursal Hexapeptide and Pentapeptide on the Immune Response of AIV Vaccine in Mice

2019 ◽  
Vol 26 (7) ◽  
pp. 542-549 ◽  
Author(s):  
Shan Shan Hao ◽  
Man Man Zong ◽  
Ze Zhang ◽  
Jia Xi Cai ◽  
Yang Zheng ◽  
...  
Keyword(s):  
Immune Response ◽  
Dendritic Cells ◽  
Amino Acid ◽  
T Cell ◽  
Antigen Presentation ◽  
Amino Acid Sequences ◽  
Cell Subpopulation ◽  
Igg Antibody ◽  
Antibody Titers ◽  
Specific Igg

Background: Bursa of Fabricius is the acknowledged central humoral immune organ. The bursal-derived peptides play the important roles on the immature B cell development and antibody production. Objective: Here we explored the functions of the new isolated bursal hexapeptide and pentapeptide on the humoral, cellular immune response and antigen presentation to Avian Influenza Virus (AIV) vaccine in mice immunization. Methods: The bursa extract samples were purified following RP HPLC method, and were analyzed with MS/MS to identify the amino acid sequences. Mice were twice subcutaneously injected with AIV inactivated vaccine plus with two new isolated bursal peptides at three dosages, respectively. On two weeks after the second immunization, sera samples were collected from the immunized mice to measure AIV-specific IgG antibody levels and HI antibody titers. Also, on 7th day after the second immunization, lymphocytes were isolated from the immunized mice to detect T cell subtype and lymphocyte viabilities, and the expressions of co-stimulatory molecule on dendritic cells in the immunized mice. Results: Two new bursal hexapeptide and pentapeptide with amino acid sequences KGNRVY and MPPTH were isolated, respectively. Our investigation proved the strong regulatory roles of bursal hexapeptide on AIV-specific IgG levels and HI antibody titers, and lymphocyte viabilities, and the significant increased T cells subpopulation and expressions of MHCII molecule on dendritic cells in the immunized mice. Moreover, our findings verified the significantly enhanced AIV-specific IgG antibody and HI titers, and the strong increased T cell subpopulation and expressions of CD40 molecule on dendritic cells in the mice immunized with AIV vaccine and bursal pentapeptide. Conclusion: We isolated and identified two new hexapeptide and pentapeptide from bursa, and proved that these two bursal peptides effectively induced the AIV-specific antibody, T cell and antigen presentation immune responses, which provided an experimental basis for the further clinical application of the bursal derived active peptide on the vaccine improvement.

Corticosteroid Catabolism by Klebsiella pneumoniae as a Possible Mechanism for Increased Pneumonia Risk

2019 ◽  
Vol 20 (4) ◽  
pp. 309-316 ◽  
Author(s):  
Pritam Chattopadhyay ◽  
Goutam Banerjee
Keyword(s):  
Amino Acid ◽  
Klebsiella Pneumoniae ◽  
Kegg Pathway ◽  
Degradation Pathway ◽  
Amino Acid Sequences ◽  
Biological Mechanism ◽  
Clinical Strains ◽  
Catabolism Pathway ◽  
Steroid Catabolism ◽  
Nutrition Source

Background: Several strains of Klebsiella pneumoniae are responsible for causing pneumonia in lung and thereby causing death in immune-suppressed patients. In recent year, few investigations have reported the enhancement of K. pneumoniae population in patients using corticosteroid containing inhaler. Objectives: The biological mechanism(s) behind this increased incidence has not been elucidated. Therefore, the objective of this investigating was to explore the relation between Klebsiella pneumoniae and increment in carbapenamase producing Enterobacteriaceae score (ICS). Methods: The available genomes of K. pneumoniae and the amino acid sequences of steroid catabolism pathway enzymes were taken from NCBI database and KEGG pathway tagged with UniPort database, respectively. We have used different BLAST algorithms (tBLASTn, BLASTp, psiBLAST, and delBLAST) to identify enzymes (by their amino acid sequence) involved in steroid catabolism. Results: A total of 13 enzymes (taken from different bacterial candidates) responsible for corticosteroid degradation have been identified in the genome of K. pneumoniae. Finally, 8 enzymes (K. pneumoniae specific) were detected in four clinical strains of K. pneumoniae. This investigation intimates that this ability to catabolize corticosteroids could potentially be one mechanism behind the increased pneumonia incidence. Conclusion: The presence of corticosteroid catabolism enzymes in K. pneumoniae enhances the ability to utilize corticosteroid for their own nutrition source. This is the first report to demonstrate the corticosteroid degradation pathway in clinical strains of K. pneumoniae.

Computational Analysis of Therapeutic Enzyme Uricase from Different Source Organisms

2020 ◽  
Vol 17 (1) ◽  
pp. 59-77
Author(s):  
Anand Kumar Nelapati ◽  
JagadeeshBabu PonnanEttiyappan
Keyword(s):  
Uric Acid ◽  
Amino Acid ◽  
Sequence Alignment ◽  
Multiple Sequence Alignment ◽  
Protein Sequences ◽  
Amino Acid Sequences ◽  
Amino Acid Residues ◽  
Multiple Sequence ◽  
Physiochemical Properties ◽  
Pharmaceutical Industries

Background:Hyperuricemia and gout are the conditions, which is a response of accumulation of uric acid in the blood and urine. Uric acid is the product of purine metabolic pathway in humans. Uricase is a therapeutic enzyme that can enzymatically reduces the concentration of uric acid in serum and urine into more a soluble allantoin. Uricases are widely available in several sources like bacteria, fungi, yeast, plants and animals.Objective:The present study is aimed at elucidating the structure and physiochemical properties of uricase by insilico analysis.Methods:A total number of sixty amino acid sequences of uricase belongs to different sources were obtained from NCBI and different analysis like Multiple Sequence Alignment (MSA), homology search, phylogenetic relation, motif search, domain architecture and physiochemical properties including pI, EC, Ai, Ii, and were performed.Results:Multiple sequence alignment of all the selected protein sequences has exhibited distinct difference between bacterial, fungal, plant and animal sources based on the position-specific existence of conserved amino acid residues. The maximum homology of all the selected protein sequences is between 51-388. In singular category, homology is between 16-337 for bacterial uricase, 14-339 for fungal uricase, 12-317 for plants uricase, and 37-361 for animals uricase. The phylogenetic tree constructed based on the amino acid sequences disclosed clusters indicating that uricase is from different source. The physiochemical features revealed that the uricase amino acid residues are in between 300- 338 with a molecular weight as 33-39kDa and theoretical pI ranging from 4.95-8.88. The amino acid composition results showed that valine amino acid has a high average frequency of 8.79 percentage compared to different amino acids in all analyzed species.Conclusion:In the area of bioinformatics field, this work might be informative and a stepping-stone to other researchers to get an idea about the physicochemical features, evolutionary history and structural motifs of uricase that can be widely used in biotechnological and pharmaceutical industries. Therefore, the proposed in silico analysis can be considered for protein engineering work, as well as for gout therapy.

Sign in / Sign up

Export Citation Format

Share Document