359 A NONINVASIVE APPROACH TO DIAGNOSE TRANSGENIC CONCEPTI DURING PREGNANCY IN GOATS

The discovery of cell-free fetal DNA (cffDNA) circulating in the blood of pregnant women, and more recently in cows, ewes, and mares, paves the road towards the development of molecular tools to explore genetic features of embryos and/or fetuses before term. Albeit a wide range of analyses are in current use and development in humans, genetic diagnostic targets other than sex determination are still not described for other mammalian species. The aim of this study was to detect cffDNA from transgenic goat concepti for the human lysozyme (hLZ) gene in the blood of nontransgenic dams. Blood was collected from 3 nontransgenic goats carrying hLZ-transgenic concepti on Days 40–50, 80–90, and 110–120 of gestation. Also, blood was drawn 8 and 12 days after parturition from two other nontransgenic goats that delivered hLZ-transgenic offspring. Blood samples (10 mL) were spun at 1200 rpm for 10 min; resulting serum or plasma were stored at –20°C (serum) or 4°C (plasma). The DNA was extracted by mixing 350 µL of serum or plasma with an equal volume of TE buffer and 5 µL of proteinase K (20 mg mL–1). The mixtures were incubated at 55°C for 3 h, followed by phenol extraction and DNA precipitation by sodium acetate and 100% ethanol, with further incubation at –20°C overnight and centrifugation at 12 000 × g for 10 min. The DNA pellets were washed with 70% ethanol and eluted in 20 µL of ultrapure water. For the PCR, primer sets for the hLZ transgene (hLZ-i1-F 5′ CGGTCCAGGGCAAGGTCTTTGA 3′ and hLZ-i1-R 5′ ACTGCTCCTGGGGTTTTGCC 3′) and for GAPDH as the endogenous control were used. Reactions contained 3 µL of DNA, 200 nM of each primer, and 45 µL of PCR Mastermix (Quatro G Pesquisa & Desenvolvimento, Porto Alegre, Brazil). The DNA from serum and plasma of nontransgenic goats were used as negative controls. The cycling conditions were 95°C for 10 min, followed by 55 cycles of 95°C for 30 s, 58°C for 30 s and 72°C for 30 s, plus a final extension at 72°C for 10 min. The PCR products were analysed by electrophoresis in 2% agarose gel. As expected, GAPDH was amplified in most of the samples (12/13). The 200-bp PCR product corresponding to hLZ was detected in the dam's serum in all 3 gestational phases, with 2 out of 3 animals being positive on 40 to 50 and 80 to 90 days, and all 3 on 110 to 120 days of pregnancy. Furthermore, the transgene was amplified from dam's plasma in all samples after parturition. Only GAPDH amplification was detected in the blood of nontransgenic goats. These results suggest that cffDNA is present in the goat's blood circulation at the fetal phase during pregnancy and at least during the first 2 weeks after parturition. This method can be safely applied as a useful tool in zygote-DNA microinjection experiments, providing an early and preterm diagnostic of transgenic concepti through the dam's blood.Research was supported by FINEP.