scholarly journals Use of Indomethacin for mild and moderate Covid -19 patients. A Randomized Control Trial

2021 ◽  
Author(s):  
ravichandran rajan ◽  
Krishna Mohan Surapaneni ◽  
Suresh Kumar Sukumaran ◽  
Devakumar Kamaraj ◽  
Sumetha Suga Devisuga ◽  
...  
Keyword(s):  
Symptomatic Relief ◽  
Hospital Setting ◽  
Blood Chemistry ◽  
The Other ◽  
Viral Agent ◽  
Rt Pcr ◽  
Patient Profile ◽  
High Flow Oxygen ◽  
Secondary Endpoints ◽  
Time Of Admission

Abstract Background Indomethacin has shown to be a broad spectrum anti-viral agent apart from it being a non-steroidal anti-inflammatory drug (NSAID). This randomized clinical trial in a hospital setting is to evaluate the efficacy and safety of this drug in RT-PCR positive Covid patients. Materials and Methods RT-PCR positive Covid-19 patients, who gave the consent for the trial, were allotted to a control, or case, arm based on block randomization procedure. The control arm received the standard care consisting of paracetamol, ivermectin and other adjuvant therapy. The case arm had indomethacin instead of paracetamol, retaining the other medications. The endpoint was the development of hypoxia/desaturation. Secondary endpoints were time to become afebrile and time to resolution of cough and myalgia. The results of 210 patients were available at this point, with 102 patients in the indomethacin arm and 108 in the paracetamol arm. The complete patient profile along with everyday clinical parameters were monitored. Blood chemistry at the time of admission and discharge were also carried out. Results As no one required high-flow oxygen, desaturation with an SpO2 level of 93 and below was considered an important goal. In the indomethacin group, no one out of the 102 patients developed desaturation. On the other hand, 20 of the 108 patients in the paracetamol arm developed desaturation. Patients who received indomethacin also experienced more rapid symptomatic relief compared to those in the paracetamol arm, with most symptoms disappearing in half the time. A total of 56 patients out of 108 in the paracetamol arm had fever on the seventh day, while no one recorded fever in the indomethacin arm. No adverse event was reported in either arms. A fourteenth day follow up revealed that the paracetamol arm patients had several discomforts including myalgia, joint pain and tiredness while the indomethacin arm patients complained only of tiredness. Conclusion Indomethacin is a safe and effective drug for the treatment of mild and moderate Covid-19 patients.

scholarly journals Efficacy and Safety of Indomethacin in Covid -19 patients

2021 ◽  
Author(s):  
Rajan Ravichandran ◽  
Prasanna Purna ◽  
Sivakumar Vijayaraghavalu ◽  
Ravi Kalavakollu ◽  
Shilpa Gaidhane ◽  
...  
Keyword(s):  
Mechanical Ventilation ◽  
Severe Disease ◽  
Symptomatic Relief ◽  
Blood Chemistry ◽  
Efficacy And Safety ◽  
Rt Pcr ◽  
Disease Group ◽  
Matched Group ◽  
Moderate Disease ◽  
Number Of Patients

Background Indomethacin, a well-known non-steroidal anti-inflammatory drug (NSAID), with effective broad spectrum anti-viral activity, was evaluated for efficacy and safety of indomethacin in treating RT-PCR positive covid-19 patients Materials and Methods Patients with RT-PCR positive covid-19 who were admitted to hospital were offered the option to receive indomethacin 50 to 75mg daily in addition to the Indian council of medical research (ICMR) standard covid-19 treatment. Patients who declined the indomethacin option were offered paracetamol for pain and fever. The endpoint was the development of hypoxia. Secondary endpoints were time to become afebrile and time to resolution of cough and myalgia. Propensity Score Matching was used to compare indomethacin and paracetamol treatments. A separate group of severely ill patients who were admitted with hypoxia were treated with indomethacin 75mg; the endpoint was the requirement for mechanical ventilation or admission to the intensive care unit (ICU). Blood chemistry was collected before and after the treatment. The patients were monitored every day for clinical parameters. . Results A total of 104 patients received indomethacin, 82 with mild-moderate disease and 22 with severe disease. Matching reduced the number of patients to 72. In the indomethacin mild-moderate disease group, one patient out of 72 in the matched group developed hypoxia and required oxygen compared with 28 out of 72 patients in the matched group who received paracetamol. Patients who received indomethacin also experienced more rapid symptomatic relief compared to paracetamol arm. In the indomethacin severe disease group no patient deteriorated enough to require mechanical ventilation. There were no adverse reactions to indomethacin or deterioration of renal or liver function. Conclusion The use of indomethacin compared with paracetamol, in addition to the standard ICMR treatment in hospitalised covid-19 patients was associated with marked reductions in the severity and duration of illness, without any adverse effects.

scholarly journals A Case Series on Critically Ill Pregnant or Newly Delivered Patients with Covid-19, Treated at Karolinska University Hospital, Stockholm

2020 ◽  
Author(s):  
Rasha El-ahmad (Polcer) ◽  
Karin Pettersson ◽  
Elin Jones
Keyword(s):  
Intensive Care ◽  
Pregnant Women ◽  
Critically Ill ◽  
Invasive Mechanical Ventilation ◽  
The Other ◽  
University Hospital ◽  
High Flow Oxygen ◽  
Computer Tomography Scan ◽  
Gestational Week ◽  
Time Of Admission

In this retrospective report we present five cases of critically ill pregnant or newly delivered women positive for Covid-19 admitted to our obstetrical departments at Karolinska University Hospital. They compose 6% of eighty-three pregnant women that tested positive for SARS-CoV-2 during the period March 25 to May 4, 2020. Three patients were at the time of admission in gestational week between 21+4 to 22+5 and treated during their antenatal period, meanwhile the other two were admitted within 1 week postpartum. All of them were in a need of intensive care, one was treated with high flow oxygen therapy, the other four with invasive mechanical ventilation (three with endotracheal intubation and one with extra corporeal membrane oxygenation). Age above thirty, overweight and gestational diabetes are notable factors in the cases presented. At the time of admission, they all presented with symptoms as fever, cough and dyspnea. Chest imaging with computer tomography scan was performed in each case and demonstrated multifocal pneumonic infiltrates in all of them but no pulmonary embolism was confirmed in any. Neither did the echocardiogram indicates any cardiomyopathy. Four of the patients have been discharged from the hospital, with an average of 20 hospital days. One antenatal pregnant woman needed prolonged ECMO therapy, in gestational week 27+3 she went into cardiac arrest, resulting in an urgent c-section on maternal indication. At the time of writing she is still hospitalized. In coherence with other published reports our cases indicate that critically ill pregnant women infected by SARS-Cov-2 may develop severe respiratory distress syndrome requiring prolonged intensive care. The material is limited for conclusions to be taken, more detailed information on symptoms, treatment, and outcomes for pregnant and postpartum women managed in intensive care is therefore needed.

scholarly journals Efficacy and Safety of Indomethacin in Covid -19 patients

2020 ◽  
Author(s):  
Rajan Ravichandran ◽  
Prassana Purna ◽  
Sivakumar Vijayaragavan ◽  
Ravi Teja Kalavakollu ◽  
Shilpa Gaidhane ◽  
...  
Keyword(s):  
Mechanical Ventilation ◽  
Standard Care ◽  
Symptomatic Relief ◽  
Blood Chemistry ◽  
Standard Protocol ◽  
Efficacy And Safety ◽  
Rt Pcr ◽  
Supplementary Oxygen ◽  
End Point ◽  
Before And After

Abstract Background Indomethacin, a well-known non-steroidal anti-inflammatory drug (NSAID), has in addition broad spectrum anti-viral activity in the laboratory including on SARS-Cov-2 virus. This trial is to observe the likelihood of efficacy and safety of Indomethacin in treating RT-PCR positive Covid patients Materials and Methods The study was done in two groups. In the first group of the study, where mild and moderate patients were involved, Propensity Score Matching was used as a methodology to compare Indomethacin and paracetamol based treatments in addition to the standard protocol for treating covid-19 patients.. Blood chemistry was collected before and after the treatment. The patients were monitored every day for clinical parameters. In this part, a patient developing hypoxia was the end point. In the second group, severe patients admitted with hypoxia were treated with Indomethacin in addition to Remdesivir, and the end point was the requirement of mechanical ventilation/admission to ICU. Results It was observed that patients treated with Indomethacin had a reduction in the number of days to become afebrile, reduction in cough and myalgia by half compared to the paracetamol set. Only one out of 72 patients in the Indomethacin arm of the first group required supplementary oxygen while 28 of the 72 patients required supplementary oxygen in the paracetamol arm. No one in the second group deteriorated enough to require mechanical ventilation. There wea no evidence of adverse reaction to indomethacin or deterioration of renal or liver function. Conclusion Indomethacin, along with standard care, seems to provide faster symptomatic relief and prevent progression of pneumonia in Covid-19 patients. It should be considered to replace paracetamol when there is no contraindication for its use.

scholarly journals A Case Series on Critically Ill Pregnant or Newly Delivered Patients with Covid-19, Treated at Karolinska University Hospital, Stockholm

2021 ◽  
Vol 2021 ◽  
pp. 1-7
Author(s):  
Rasha El-ahmad Polcer ◽  
Elin Jones ◽  
Karin Pettersson
Keyword(s):  
Intensive Care ◽  
Pregnant Women ◽  
Critically Ill ◽  
Invasive Mechanical Ventilation ◽  
The Other ◽  
University Hospital ◽  
High Flow Oxygen ◽  
Computer Tomography Scan ◽  
Gestational Week ◽  
Time Of Admission

In this retrospective report, we present five cases of critically ill pregnant or newly delivered women positive for Covid-19 admitted to our obstetrical departments at Karolinska University Hospital. They compose 6% of eighty-three pregnant women that tested positive for SARS-CoV-2 during the period March 25 to May 4, 2020. Three patients were at the time of admission in gestational week between 21 + 4 and 22 + 5 and treated during their antenatal period; meanwhile, the other two were admitted within 1 week postpartum. All of them were in need of intensive care: one was treated with high flow oxygen therapy, the other four with invasive mechanical ventilation (three with endotracheal intubation and one with extracorporeal membrane oxygenation). Age above thirty, overweight, and gestational diabetes are notable factors in the cases presented. At the time of admission, they all presented with symptoms such as fever, cough, and dyspnea. Chest imaging with computer tomography scan was performed in each case and demonstrated multifocal pneumonic infiltrates in all of them, but no pulmonary embolism was confirmed in any. Neither did the echocardiogram indicate any cardiomyopathy. Four of the patients have been discharged from the hospital, with an average of 20 hospital days. One antenatal pregnant woman needed prolonged ECMO therapy; in gestational week 27 + 3 , she went into cardiac arrest, resulting in an urgent C-section on maternal indication. At the time of writing, she is still hospitalized. In coherence with other published reports, our cases indicate that critically ill pregnant women infected by SARS-Cov-2 may develop severe respiratory distress syndrome requiring prolonged intensive care. The material is limited for conclusions to be made; more detailed information on symptoms, treatment, and outcomes for pregnant and postpartum women managed in intensive care is therefore needed.

Enteric viruses in drinking water supplies

2002 ◽  
Vol 2 (3) ◽  
pp. 17-22
Author(s):  
A.P. Wyn-Jones ◽  
J. Watkins ◽  
C. Francis ◽  
M. Laverick ◽  
J. Sellwood
Keyword(s):  
Drinking Water ◽  
Heavy Rainfall ◽  
Liquid Culture ◽  
Plaque Assay ◽  
Enteric Viruses ◽  
Enteric Virus ◽  
The Other ◽  
Raw Water ◽  
Rt Pcr ◽  
Water Supplies

Two rural spring drinking water supplies were studied for their enteric virus levels. In one, serving about 30 dwellings, the water was chlorinated before distribution; in the other, which served a dairy and six dwellings the water was not treated. Samples of treated (40 l) and untreated (20 l) water were taken under normal and heavy rainfall conditions over a six weeks period and concentrated by adsorption/elution and organic flocculation. Infectious enterovirus in concentrates was detected in liquid culture and enumerated by plaque assay, both in BGM cells, and concentrates were also analysed by RT-PCR. Viruses were found in both raw water supplies. Rural supplies need to be analysed for viruses as well as bacterial and protozoan pathogens if the full microbial hazard is to be determined.

New Perspectives for SARS-CoV-2 Rapid Detection

Coronaviruses ◽  
2021 ◽  
Vol 02 ◽  
Author(s):  
Latifa Khattabi ◽  
Mustapha Mounir Bouhenna ◽  
Feriel Sellam
Keyword(s):  
Rapid Detection ◽  
High Sensitivity ◽  
The Other ◽  
Host Cells ◽  
Rt Pcr ◽  
Human Immune System ◽  
Virus Attachment ◽  
Testing Procedures ◽  
Diagnostic Kits ◽  
Human Immune

: The present paper elucidates the conceivable application of two key molecules in SARS-CoV-2 detection of suspected infected persons. These molecules were selected from the basis of ACE-2 and S protein strong interaction that allows virus attachment to its host cells, on the other hand specific immunocompetant effectors generated by human immune system during the infection. Several testing procedures are already used to diagnose SARS-CoV-2 infection, particularly RT-PCR technique. ELISA and LFIA are possible assays for the employment of shACE-2/ hAc-anti-S (the molecules of interest) as the main agents of the test and confer a dual principal functions (capture and detection). The future diagnostic kits involving shACE-2 and hAc-anti-S will have the particularity of high sensitivity and rapid detection in addition to its advantage of relatively easy conception. It could be largely considered as a technical advanced kits in regards to the current SARS-CoV-2 diagnostic immunoassays.

scholarly journals Yellow fever in two unvaccinated French tourists to Brazil, January and March, 2018

2018 ◽  
Vol 23 (21) ◽  
Author(s):  
Emma Oliosi ◽  
Chantal Serero Corcos ◽  
Paulo Feijo Barroso ◽  
Alexandre Bleibtreu ◽  
Gilda Grard ◽  
...  
Keyword(s):  
At Risk ◽  
Yellow Fever ◽  
Minas Gerais ◽  
The Other ◽  
Rt Pcr ◽  
Serological Tests ◽  
Vaccination Recommendation

We report two yellow fever cases in unvaccinated French travellers in Brazil in January and March 2018, respectively; one exposed during an excursion in Minas Gerais and the other in Ilha Grande. Both presented with fever, hepatitis, thrombocytopenia and leucopenia. Yellow fever diagnosis was based on RT-PCR and serological tests. Both patients recovered within a few days. The increasing occurrence of cases in unvaccinated travellers highlights the need to reinforce vaccination recommendation for travellers at-risk.

scholarly journals O-104 Low SARS-CoV-2 positivity rate in women included in ART programs following the recommendations of the Spanish scientific societies on reproduction (SEF/ASEBIR)

2021 ◽  
Vol 36 (Supplement_1) ◽  
Author(s):  
D Mataro ◽  
I Cuevas-Saiz ◽  
J A Castilla ◽  
J A Dominguez ◽  
N Prados ◽  
...  
Keyword(s):  
Clinical Symptoms ◽  
Intrauterine Insemination ◽  
Cross Sectional Study ◽  
Screening Strategy ◽  
Clinical Interview ◽  
The Other ◽  
Medical Procedure ◽  
Rt Pcr ◽  
Cross Sectional ◽  
Aggregated Data

Abstract Study question What is the SARS-CoV-2 positivity rate following the Spanish Fertility Society (SEF)/Association for the Study of Reproductive Biology (ASEBIR) screening recommendations? Summary answer The SARS-CoV-2 positivity rate in the centers following the SEF/ASEBIR screening recommendations was 0.316% after the first survey and 0.364% after the second one What is known already Due to the Sars-Cov-2 pandemic, all the Medical Assisted Reproduction (MAR) centers in Spain had to interrupt their activity most of the time during the first pandemic wave. On April 27th activity was restarted, and SEF and ASEBIR jointly elaborated a guide describing their SARS-CoV-2 screening recommendations for MAR centers. This document aims to achieve a safe environment for patients and staff. It includes the possibility of screening patients through a targeted clinical interview and the use of reverse-transcriptase polymerase chain reaction (RT-PCR). The aim of this study is to quantify the SARS-CoV-2 positivity rate based on these recommendations. Study design, size, duration National multicenter cross-sectional study. Information was gathered from centers using an anonymous survey asking for aggregated data about the number of positive cases among screened patients, sent twice. The first survey covered the period April 27th - June 30th. Second survey covered July 1st - August 31st. Response rates among centres were 9% (29/319) and 6% (20/319), respectively. This study includes 2,695 and 4,068 screenings performed in the first and the second survey, respectively. Participants/materials, setting, methods The SEF/ASEBIR recommendations describe two screening strategies. Strategy (a) consists in a targeted clinical interview (TCI) evaluating clinical symptoms and exposure risk, first before starting the cycle, and before egg-retrieval, intrauterine insemination (IUI), and/or embryo transfer (ET). Suspicious cases could be confirmed by further RT-PCR testing. Strategy (b) consists in conducting the same first TCI, and a systematic RT-PCR testing before the medical procedure in all patients. All patients in both strategies have a TCI. Main results and the role of chance In the 1st survey, 1,177 screenings and 919 RT-PCR (78.07%) were performed before the egg-retrieval. One patient with a negative TCI and positive RT-PCR was detected, and the cycle was cancelled. 1,518 screenings and 1,161 RT-PCRs (76.48%) were performed before the ET/IUI. Two patients with a positive TCI were detected, one did not perform a RT-PCR, while the other resulted in a positive RT-PCR. Both cycles were cancelled. Besides, 5 patients with negative TCI performed a RT-PCR with a positive result; all 5 were cancelled. Overall, the SARS-CoV-2 positivity rate was 8/2533 (0.316%), of which 7/2533 (0.276%) were identified by RT-PCR testing. The 2nd survey included 1,376 screenings and 1,009 RT-PCR (73.32%) performed before the egg-retrieval. Four patients with negative TCI and further positive RT-PCR were detected, and their cycle was cancelled. 2,692 screenings and 2,134 RT-PCR (79.27%) were performed before ET/IUI. Two patients had a positive TCI, one with a negative, the other with a positive RT-PCR testing; both cycles were cancelled. Besides, 8 patients with negative TCI, but positive RT-PCR testing, were detected and their cycles cancelled. Overall, the SARS-CoV-2 positivity rate was 14/3846 (0.364%), of which 13/3846 (0.338%) after positive RT-PCR testing. Limitations, reasons for caution The criteria for performing the RT-PCR testing were not the same in all MAR Centres or even in the same centre at different times. Due to the low response rate of the study, we should not extend these results to all the MAR Centres in Spain. Wider implications of the findings The results of the surveys suggest that the SEF/ASEBIR recommendations could be a good screening strategy for SARS-Cov-2 at MAR Centres. Further survey collected at different times of the pandemic are warranted, including new strategies for screening as antigen tests or vaccination status. Trial registration number Not applicable

Pathogenesis, Pathology and Genetics of Osteoarthritis

2021 ◽  
Author(s):  
Ferhat Ege
Keyword(s):  
Aging Process ◽  
Symptomatic Relief ◽  
Natural Aging ◽  
The Other ◽  
Joint Tissue ◽  
Proinflammatory Mediators ◽  
High Prevalence ◽  
New Treatments ◽  
Biomechanical Factors ◽  
Shed Light

Osteoarthritis (OA) is a condition with high prevalence worldwide. OA affects not only the articular cartilage, but the entire joint, including the subchondral bone, ligaments, capsule, synovial membrane and the periarticular muscles. Despite the fact that the risks associated with OA increase with age, it is not a part of the natural aging process. It typically involves the knee, hip, spine, hand and foot joints. Several factors play an important role in the pathogenesis of OA, including biomechanical factors, proinflammatory mediators and proteases. On the other hand, it was mostly the results of the studies conducted on the genetic, genomic and epigenetic aspects of OA, from among many of its underlying etiological factors, which shed light on the molecular processes involved in the etiopathogenesis of OA. As the mechanisms that cause joint tissue damage in OA come to light, the treatment of OA will go beyond just providing symptomatic relief. Consequentially, new treatments will emerge that will either slow or completely stop the progression of OA.

scholarly journals Mulberry (Morus alba) is a new natural host of Citrus leaf blotch virus in China

Plant Disease ◽  
2020 ◽  
Author(s):  
Zhiyou Xuan ◽  
Jiaxi Xie ◽  
Haodong Yu ◽  
Song Zhang ◽  
Ruhui Li ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Complete Genome ◽  
Genome Structure ◽  
Viral Agent ◽  
Rt Pcr ◽  
Specific Primer ◽  
Leaf Blotch ◽  
Citrus Leaf ◽  
Citrus Leaf Blotch Virus ◽  
Sequence Identities

Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches’ broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses_NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4–90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5’ and 3’ termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV.

Sign in / Sign up

Export Citation Format

Share Document