Momordica charantia Inhibits Inflammatory Responses in Murine Macrophages via Suppression of TAK1

2018 ◽  
Vol 46 (02) ◽  
pp. 435-452 ◽  
Author(s):  
Woo Seok Yang ◽  
Eunju Yang ◽  
Min-Jeong Kim ◽  
Deok Jeong ◽  
Deok Hyo Yoon ◽  
...  
Keyword(s):  
Mrna Expression ◽  
Molecular Mechanisms ◽  
Transforming Growth Factor ◽  
Momordica Charantia ◽  
Luciferase Reporter ◽  
No Production ◽  
Dependent Manner ◽  
Raw264.7 Macrophages ◽  
Anti Inflammatory ◽  
Dose Dependent

Momordica charantia known as bitter melon is a representative medicinal plant reported to exhibit numerous pharmacological activities such as antibacterial, antidiabetic, anti-inflammatory, anti-oxidant, antitumor, and hypoglycemic actions. Although this plant has high ethnopharmacological value for treating inflammatory diseases, the molecular mechanisms by which it inhibits the inflammatory response are not fully understood. In this study, we aim to identify the anti-inflammatory mechanism of this plant. To this end, we studied the effects of its methanol extract (Mc-ME) on lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages. Specifically, we evaluated nitric oxide (NO) production, mRNA expression of inflammatory genes, luciferase reporter gene activity, and putative molecular targets. Mc-ME blocked NO production in a dose-dependent manner in RAW264.7 cells; importantly, no cytotoxicity was observed. Moreover, the mRNA expression levels of inducible NO synthase (iNOS) and cyclooxygenase (COX)-2 were decreased by Mc-ME treatment in a dose-dependent manner. Luciferase assays and nuclear lysate immunoblotting analyses strongly indicated that Mc-ME decreases the levels of p65 [a nuclear factor (NF)-[Formula: see text]B subunit] and c-Fos [an activator protein (AP)-1 subunit]. Whole lysate immunoblotting assays, luciferase assays, and overexpression experiments suggested that transforming growth factor [Formula: see text]-activated kinase 1 (TAK1) is targeted by Mc-ME, thereby suppressing NF-[Formula: see text]B and AP-1 activity via downregulation of extracellular signal-regulated kinases (ERKs) and AKT. These results strongly suggest that Mc-ME exerts its anti-inflammatory activity by reducing the action of TAK1, which also affects the activation of NF-[Formula: see text]B and AP-1.

scholarly journals Anti-inflammatory and Anti-oxidative Activities of Polyacetylene from Dendropanax dentiger

2014 ◽  
Vol 9 (11) ◽  
pp. 1934578X1400901 ◽  
Author(s):  
Shih-Chang Chien ◽  
Yen-Hsueh Tseng ◽  
Wei-Ning Hsu ◽  
Fang-Hua Chu ◽  
Shang-Tzen Chang ◽  
...  
Keyword(s):  
Folk Medicine ◽  
No Production ◽  
Raw 264.7 ◽  
Dependent Manner ◽  
Antioxidant Gene ◽  
Mrna And Protein Expression ◽  
Ancient Times ◽  
Anti Inflammatory ◽  
Chemoprevention Agent ◽  
Dose Dependent

Dendropanax dentiger has been used as a folk medicine since ancient times. In our current study, we observed that D. dentiger exhibited a significant anti-inflammatory activity, which could efficiently inhibit nitric oxide (NO) production in the lipopolysaccharide (LPS)-induced macrophage inflammation assay. (9 Z,16 S)-16-Hydroxy-9,17-octadecadiene-12,14-diynoic acid (HODA) was isolated from the leaves of D. dentiger following a bioactivity guided fractionation protocol. Our data indicated that HODA significantly inhibited the NO production in LPS-induced RAW 264.7 murine macrophage cells (IC50 = 4.28 μM). Consistent with these observations, the mRNA and protein expression levels of iNOS were also inhibited by HODA in a dose-dependent manner. HODA also reduced the translocation of NF-κB into nuclear fractions. Meanwhile, HODA enhanced Nrf-2 activation and its downstream antioxidant gene HO-1. We concluded that HODA possessed significant anti-inflammatory and anti-oxidative activity; the compound may have a potential for development as a chemoprevention agent.

scholarly journals Cytotoxic and Anti- Inflammatory Activities of Glycosaminoglycans (GAGs) from Selected Sea Food Waste Extract on Cell Lines

2020 ◽  
Vol 981 ◽  
pp. 258-264
Author(s):  
Nurul Haida Idrus ◽  
Nina Suhaity Azmi ◽  
Che Nur Mazadillina Che Zahari ◽  
Solachuddin Jauhari Arief Ichwan
Keyword(s):  
Dermatan Sulfate ◽  
Biological Activities ◽  
Keratan Sulfate ◽  
Sea Bass ◽  
Raw Material ◽  
No Production ◽  
Dependent Manner ◽  
Alternative Source ◽  
Anti Inflammatory ◽  
Dose Dependent

Glycosaminoglycans (GAGs) are long unbranched polysaccharide that composed of repeating disaccharide units. They are classified into heparan sulfate (HS), heparin, chondroitin sulfate (CS), dermatan sulfate (DS), keratan sulfate (KS) and hyaluronic acid (HA). During the last decade, demand of GAGs were getting increased due to their potential uses. Vertebrate animal, commonly cartilaginous mammalian tissue, were potential producer of GAGs and have the higher number of biological activities extracted from sea bass waste. Sea bass waste from Lates calcarifer was used as the raw material to extract crude GAGs. Different part of sea bass waste such as, gills, viscera and air bladders were used. The higher content of crude GAGs in sea bass waste was used in cytotoxic and inflammatory study. Different concentration of extract GAGs from gills were used ranging between 0.16-20 mg/mL. GAGs from sea bass waste (gills) showed dose-dependent cytotoxic activity towards MCF-7 cell line in lower concentration. Meanwhile, for anti-inflammatory study GAGs from sea bass waste (gills) showed dose-dependent manner and also reduce NO production in LPS-stimulated cells. This research study concluded that, GAGs from sea bass waste are the alternative source that can be used for cancer and inflammation study.

scholarly journals IcarisideII facilitates the differentiation of ADSCs to SCs via let-7i/STAT3 axis to preserve erectile function

2019 ◽  
Vol 52 (1) ◽  
Author(s):  
Pingyu Ge ◽  
Yinxue Guo ◽  
Jun Shen
Keyword(s):  
Cell Proliferation ◽  
Erectile Function ◽  
Molecular Mechanisms ◽  
Therapeutic Option ◽  
Luciferase Reporter ◽  
Dependent Manner ◽  
Regulatory Relationship ◽  
Rat Models ◽  
Protein Levels ◽  
Dose Dependent

Abstract Background IcarisideII (ICAII) could promote the differentiation of adipose tissue-derived stem cells (ADSCs) to Schwann cells (SCs), leading to improvement of erectile function (EF) and providing a realistic therapeutic option for the treatment of erectile dysfunction (ED). However, the underlying molecular mechanisms of ADSCs and ICAII in this process remain largely unclear. Methods ADSCs were treated with different concentrations of ICAII. Cell proliferation was determined by MTT assay. qRT-PCR and western blot were performed to detect expressions of SCs markers, signal transducer and activator of transcription-3 (STAT3), and microRNA-let-7i (let-7i). Luciferase reporter assay was conducted to verify the regulatory relationship between let-7i and STAT3. The detection of intracavernosal pressure (ICP) and the ratio of ICP/mean arterial pressure (MAP) were used to evaluate the EF in bilateral cavernous nerve injury (BCNI) rat models. Results ICAII promoted cell proliferation of ADSCs in a dose-dependent manner. The mRNA and protein levels of SCs markers were increased by ICAII treatment in a dose-dependent manner in ADSCs. Moreover, let-7i was significantly decreased in ICAII-treated ADSCs and upregulation of let-7i attenuated ICAII-induced promotion of SCs markers. In addition, STAT3 was a direct target of let-7i and upregulated in ICAII-treated ADSCs. Interestingly, overexpression of STAT3 abated the let-7i-mediated inhibition effect on differentiation of ADSCs to SCs and rescued the ICAII-mediated promotion effect on it. Besides, combination treatment of ADSCs and ICAII preserved the EF of BCNI rat models, which was undermined by let-7i overexpression. Conclusion ICAII was effective for preserving EF by promoting the differentiation of ADSCs to SCs via modulating let-7i/STAT3 pathway.

The Anti-inflammatory Effects of Lignan Glycosides from Cistanche tubulosa stems on LPS/IFN-γ-induced RAW264.7 Macrophage Cells via PI3K/AKT Pathway

2020 ◽  
Vol 21 ◽  
Author(s):  
Jinhan Guo ◽  
Shuming Tang ◽  
Yuyang Miao ◽  
Lanlan Ge ◽  
Junfa Xu ◽  
...  
Keyword(s):  
Raw264.7 Cells ◽  
Akt Pathway ◽  
No Production ◽  
Dependent Manner ◽  
Ifn Γ ◽  
Cox 2 ◽  
Cistanche Tubulosa ◽  
Anti Inflammatory ◽  
Lignan Glycosides ◽  
Dose Dependent

Background: Cistanche tubulosa is a tonic in traditional Chinese medicines and has a broad spectrum of biological activity, including anti-inflammatory. However, its anti-inflammatory major constituents of C. tubulosa and their underlying mechanisms are still unknown. Objective: The aim of the current study was to explore the separation and structural characterization of lignan glycosides from C. tubulosa (Schenk) Wight., their anti-inflammatory activity and underlying mechanism. Materials and Methods: Fractionation and isolation of the 85% EtOH extract of C. tubulosa (Schenk) Wight. were carried out and the primary ingredients lignan glycosides (1-6) were structurally characterized. CCK8 methods were used to evaluate the cytotoxic effect of lignan glycosides (1-6). Effects of lignan glycosides (1-6) on NO production in LPS/IFN-γ-induced RAW264.7 macrophages cells were measured using Griess reagent by reaction with nitrite. The mRNA expression levels of iNOS, COX-2, IL-1β, IL-6, TNF-a, and TGF-β treated RAW264.7 cells with various concentrations (0, 25 and 50 μg/ml) of lignan glycosides (1, 4) in the presence of LPS (10 ng/ml) and IFN-γ (20 ng/ml) for 24 h were analyzed by quantitative RT-PCR. Also the protein expressions of iNOS, COX-2, PI3K, AKT, p-AKT and β-actin were determined using Western blot analysis. A molecular docking study was performed to investigate the interactions between the lignan glycosides and the PI3K using Autodock vina 1.1.2 package. Results: Six lignan glycosides (1-6) were isolated from stems of C. tubulosa. Among them, (+)-pinoresinol-4-O-β-D-glucopyranosyl- (1→6)-β-D- glucopyranoside (5) and eleutheroside E (6) were firstly isolated from C. tubulosa. Of these lignans, 1 and 4 exhibited pronounced inhibitions on NO production with the values of 33.63 ± 4.78 and 39.28 ± 5.52 % at 50 μg/ml, respectively. Additionally, LPS/IFN-γ-induced expression of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), interleukin-1β (IL-1β), IL-6, and tumor necrosis factor-a (TNF-a) was significantly suppressed by pre-treatment of 1 and 4 in a dose-dependent manner. While 1 and 4 increased the mRNA levels of anti-inflammatory cytokines (TGF-β). Furthermore, 1 and 4 significantly inhibited the protein levels of PI3K and p-AKT in a dose-dependent manner. Conclusion: Taken together, these results suggest that 1 and 4 play an important role in the attenuation of LPS/IFN-γ-induced inflammatory responses in RAW264.7 cells and that the mechanisms involve down-regulation of the PI3K/AKT pathway.

Identification of a Functional Interferon-Gamma Response Element in the Fibrinogen FGG Gene.

Blood ◽  
2009 ◽  
Vol 114 (22) ◽  
pp. 3174-3174
Author(s):  
Chantelle M. Rein ◽  
David H. Farrell
Keyword(s):  
Hepg2 Cells ◽  
Transforming Growth Factor ◽  
Conflicts Of Interest ◽  
Consensus Sequence ◽  
Luciferase Reporter ◽  
Luciferase Expression ◽  
Dependent Manner ◽  
Down Regulation ◽  
Ifn Γ ◽  
Dose Dependent

Abstract Abstract 3174 Poster Board III-114 Fibrinogen is the zymogen precursor to the main structural protein in blood coagulation, and is proteolytically activated during coagulation to form fibrin clots. Fibrinogen is an acute phase protein that is produced by the liver, and elevated fibrinogen levels are a known risk factor for cardiovascular disease, including heart attack and stroke. Fibrinogen is synthesized from three separate genes, FGA, FGB, and FGG encoding the Aαa, Bβ, and γ chains, respectively. Several inflammatory cytokines, particularly interleukin-6 (IL-6), are known to up-regulate fibrinogen synthesis, while interleukin-1β, tumor necrosis factor-αa, and transforming growth factor-β are known to antagonize IL-6 stimulation of fibrinogen synthesis. Here we report that interferon-γ (IFN-γ), a cytokine that is highly expressed in atherosclerotic lesions, decreases the production of fibrinogen by two-fold over a 24 hour period in HepG2 hepatocellular carcinoma cells, both at the protein and mRNA level. In addition, IFN-γ antagonizes IL-6 up-regulation of fibrinogen production. Since IFN-γ is known to signal via the IFN-γ receptor through a STAT1-dependent pathway, we investigated the mechanism by which IFN-γ inhibits fibrinogen production. We identify a previously unknown IFN-γ activation sequence (GAS), AGGAGCTTACATAAAGGGACAA, within the promoter of the human γ chain gene FGG. This sequence is homologous to the known GAS consensus sequence TTNCNNNAA. Nuclear extracts from IFN-γ-stimulated HepG2 cells, but not from unstimulated HepG2 cells, form a complex with oligonucleotides containing this GAS sequence, as demonstrated by electrophoretic mobility shift assays. The formation of this complex is blocked by unlabeled competing oligonucleotides and by an antibody to phosphorylated STAT1. The involvement of pSTAT1 in this complex is consistent with the known role of pSTAT1 downstream of IFN-γ receptor signaling. In addition, IFN-γ stimulates STAT1 phosphorylation in a dose-dependent manner in HepG2 cells. Furthermore, using an FGG promoter construct fused to a luciferase reporter gene in transiently transfected HepG2 cells, we show that IFN-γ inhibits luciferase expression in a dose-dependent manner. Together, these data demonstrate that IFN-γ down-regulation of fibrinogen production occurs through a pSTAT1-mediated pathway. Since IFN-γ is known to demonstrate both pro and anti-atherogenic actions, this down-regulation of fibrinogen production may serve an anti-atherogenic function in vivo. Disclosures No relevant conflicts of interest to declare.

scholarly journals Anti-Inflammatory Compounds from Vietnamese Piper bavinum

2020 ◽  
Vol 2020 ◽  
pp. 1-7
Author(s):  
Viet Dung Hoang ◽  
Phi Hung Nguyen ◽  
Minh Thu Doan ◽  
Manh Hung Tran ◽  
Nhu Tuan Huynh ◽  
...  
Keyword(s):  
Raw 264.7 Cells ◽  
No Production ◽  
Dependent Manner ◽  
Protein Levels ◽  
Chemical Structures ◽  
Anti Inflammatory ◽  
First Time ◽  
Dose Dependent ◽  
Potent Inhibitory Activity

This study reports the anti-inflammatory activity-guided fractionation of the aerial part of Piper bavinum C. CD. (Piperaceae) that led to the isolation of eight secondary metabolites (1–8). The chemical structures of 1–8 were established mainly by NMR and mass spectra. Compound 5 was isolated from P. bavinum for the first time. All the isolated compounds were evaluated against LPS-induced NO production in macrophage RAW 264.7 cells in vitro. Among them, compound 4 showed the most potent inhibitory activity against the LPS-induced NO production with an IC50 value of 5.2 μM followed by compound 5 that inhibited NO production with an IC50 value of 13.5 μM. In the protein levels, compound 4 suppressed LPS-induced COX-2 and iNOS expressions in a dose-dependent manner. The results suggested that P. bavinum and its constituents might exert anti-inflammatory effects.

Anti-inflammatory Activity of Herbal Medicines: Inhibition of Nitric Oxide Production and Tumor Necrosis Factor-α Secretion in an Activated Macrophage-like Cell Line

2005 ◽  
Vol 33 (03) ◽  
pp. 415-424 ◽  
Author(s):  
Eunkyue Park ◽  
Susan Kum ◽  
Chuanhua Wang ◽  
Seung Yong Park ◽  
Bo Sook Kim ◽  
...  
Keyword(s):  
Nitric Oxide ◽  
Tumor Necrosis ◽  
No Production ◽  
Dependent Manner ◽  
Aqueous Extracts ◽  
Tnf Α ◽  
Activated Macrophage ◽  
Anti Inflammatory ◽  
Dose Dependent ◽  
Necrosis Factor

Houttuynia cordata Thunb. (HC), Glycyrrhiza uralensis Fischer (GU), Forsythia suspense (Thunb.) Vahl (FS), and Lonicera japonica Thunb. (LJ) are Chinese herbs known to possess anti-inflammatory properties. The effects of aqueous extracts of these herbs on the production of the pro-inflammatory mediators, nitric oxide (NO) and tumor necrosis factor-alpha (TNF-α) were examined in an activated macrophage-like cell line, RAW 264.7 cells. Aqueous extracts from FS at 0.0625–2.0 mg/ml inhibited in vitro production of NO and secretion of TNF-α in a dose-dependent manner. FS at 1.0–2.0 mg/ml and 0.125–2.0 mg/ml significantly inhibited NO production and TNF-α, respectively. An extract of LJ demonstrated potent inhibition of both NO production and TNF-α secretion in a dose-dependent manner. An aqueous extract from HC inhibited NO production in a dose-dependent manner, but minimally (approximately 30%) inhibited TNF-α secretion at 0.0625 and 0.125 mg/ml. In contrast, an aqueous extract of GU had a minimal effect on both the production of NO and the secretion of TNF-α. Viability of cells at all concentrations studied was unaffected as determined by MTT cytotoxicity assay and trypan blue dye exclusion. These results suggest that aqueous extracts from FS, LJ and HC have anti-inflammatory actions as measured by inhibition of NO production and/or TNF-α secretion.

scholarly journals Akt/Protein Kinase B Activation by Adenovirus Vectors Contributes to NFκB-Dependent CXCL10 Expression

2005 ◽  
Vol 79 (23) ◽  
pp. 14507-14515 ◽  
Author(s):  
Qiang Liu ◽  
Lindsay R. White ◽  
Sharon A. Clark ◽  
Daniel J. Heffner ◽  
Brent W. Winston ◽  
...  
Keyword(s):  
Mrna Expression ◽  
Transcriptional Activation ◽  
Dominant Negative ◽  
Luciferase Reporter ◽  
Dependent Manner ◽  
Akt Activation ◽  
Downstream Effector ◽  
Serotype 5 ◽  
Adenovirus Vectors ◽  
Dose Dependent

ABSTRACT In gene therapy, the innate immune system is a significant barrier to the effective application of adenovirus (Ad) vectors. In kidney epithelium-derived (REC) cells, serotype 5 Ad vectors induce the expression of the chemokine CXCL10 (IP-10), a response that is dependent on NFκB. Compared to the parental vector AdLuc, transduction with the RGD-deleted vector AdL.PB resulted in reduced CXCL10 activation despite increasing titers, implying that RGD-αV integrin interactions contribute to adenovirus induction of inflammatory genes. Akt, a downstream effector of integrin signaling, was activated within 10 min of transduction with Ad vectors in a dose-dependent manner. Akt activation was not present following transduction with AdL.PB, confirming the importance of capsid-αV integrin interactions in Ad vector Akt activation. Inhibition of the phosphoinositide-3-OH kinase/Akt pathway by Wortmannin or Ly294002 compounds decreased Ad vector induction of CXCL10 mRNA. Similarly, adenovirus-mediated overexpression of the dominant negative AktAAA decreased CXCL10 mRNA expression compared to the reporter vector AdLacZ alone. The effect of Akt on CXCL10 mRNA expression occurred via NFκB-dependent transcriptional activation, since AktAAA overexpression and Ly294002 both inhibited CXCL10 and NFκB promoter activation in luciferase reporter experiments. These results show that Akt plays a role in the Ad vector activation of NFκB and CXCL10 expression. Understanding the mechanism underlying the regulation of host immunomodulatory genes by adenovirus vectors will lead to strategies that will improve the efficacy and safety of these agents for clinical use.

scholarly journals Anti-inflammatory effects of Morus alba Linne bark on the activation of toll-like receptors and imiquimod-induced ear edema in mice

2021 ◽  
Vol 21 (1) ◽  
Author(s):  
Lin Umeyama ◽  
Besse Hardianti ◽  
Shiori Kasahara ◽  
Dya Fita Dibwe ◽  
Suresh Awale ◽  
...  
Keyword(s):  
Molecular Mechanisms ◽  
Inflammatory Diseases ◽  
Morus Alba ◽  
Raw264.7 Cells ◽  
Luciferase Reporter ◽  
Γδt Cells ◽  
Ear Edema ◽  
Raw264.7 Macrophages ◽  
Anti Inflammatory

Abstract Background Morus alba L. bark has been widely used in traditional medicine for treating several inflammatory diseases, such as hypertension, diabetes mellitus and coughing; however, the molecular mechanisms underlying its anti-inflammatory effects are not well understood. Methods We examined the effects of an extract of Morus alba L. bark (MabE) on Toll-like receptor (TLR) ligand-induced activation of RAW264.7 macrophages using a luciferase reporter assay and immunoassays. For the in vivo experiment, we used an imiquimod-induced ear edema model to examine the anti-inflammatory effects of MabE. Results MabE inhibited the TLR ligand-induced activation of NF-κB in RAW264.7 cells without affecting their viability. Consistent with the inhibition of NF-κB activation, MabE also inhibited the production of IL-6 and IL-1β from TLR ligand-treated RAW264.7 cells. In vivo MabE treatment inhibited the ear swelling of IMQ-treated mice, in addition to the mRNA expression of IL-17A, IL-1β and COX-2. The increases in splenic γδT cells in IMQ-treated mice and the production of IL-17A from splenocytes were significantly inhibited by MabE treatment. Conclusion Our study suggests that the anti-inflammatory effects of MabE on the activation of the macrophage cell line RAW246.7 by TLRs and IMQ-induced ear edema are through the inhibition of NF-κB activation and IL-17A-producing γδT cells, respectively.

scholarly journals Caragana rosea Turcz Methanol Extract Inhibits Lipopolysaccharide-Induced Inflammatory Responses by Suppressing the TLR4/NF-κB/IRF3 Signaling Pathways

Molecules ◽  
2021 ◽  
Vol 26 (21) ◽  
pp. 6660
Author(s):  
Ankita Mitra ◽  
Akash Ahuja ◽  
Laily Rahmawati ◽  
Han Gyung Kim ◽  
Byoung Young Woo ◽  
...  
Keyword(s):  
Signaling Pathways ◽  
Molecular Mechanisms ◽  
Methanol Extract ◽  
Inflammatory Responses ◽  
Eastern China ◽  
Mrna Levels ◽  
Dependent Manner ◽  
Concentration Dependent Manner ◽  
Raw264.7 Macrophages ◽  
Anti Inflammatory

Caragana rosea Turcz, which belongs to the Leguminosae family, is a small shrub found in Northern and Eastern China that is known to possess anti-inflammatory properties and is used to treat fever, asthma, and cough. However, the underlying molecular mechanisms of its anti-inflammatory effects are unknown. Therefore, we used lipopolysaccharide (LPS) in RAW264.7 macrophages to investigate the molecular mechanisms that underlie the anti-inflammatory activities of a methanol extract of Caragana rosea (Cr-ME). We showed that Cr-ME reduced the production of nitric oxide (NO) and mRNA levels of iNOS, TNF-α, and IL-6 in a concentration-dependent manner. We also found that Cr-ME blocked MyD88- and TBK1-induced NF-κB and IRF3 promoter activity, suggesting that it affects multiple targets. Moreover, Cr-ME reduced the phosphorylation levels of IκBα, IKKα/β and IRF3 in a time-dependent manner and regulated the upstream NF-κB proteins Syk and Src, and the IRF3 protein TBK1. Upon overexpression of Src and TBK1, Cr-ME stimulation attenuated the phosphorylation of the NF-κB subunits p50 and p65 and IRF3 signaling. Together, our results suggest that the anti-inflammatory activity of Cr-ME occurs by inhibiting the NF-κB and IRF3 signaling pathways.

Sign in / Sign up

Export Citation Format

Share Document