Empty houses across North America: Housing finance and Mexico’s vacancy crisis

Urban Studies ◽  
2018 ◽  
Vol 56 (10) ◽  
pp. 2075-2091 ◽  
Author(s):  
Paavo Monkkonen
Keyword(s):  
The United States ◽  
Mortgage Lending ◽  
Housing Finance ◽  
High Rate ◽  
Housing Crisis ◽  
Role Of Government ◽  
Central Cities ◽  
Urban Periphery ◽  
Vacancy Rates ◽  
Housing Vacancy

In the wake of the housing market crash in the United States in the late 2000s, images of abandoned homes on the periphery of American cities dominated international media. Mexico continues to face a housing crisis that began at the same time, and the media similarly focus on the high rate of housing vacancy in the urban periphery. The vacancy rate is extreme in many newly built subdivisions in Mexico, yet it is also high in most central cities. In this article, I describe the role of government mortgage lending in housing vacancy rates, across and within cities in Mexico. I do this using data from the 2010 Census of Population and Housing for the 100 largest cities in the country. Cities with more housing built under the federal housing finance system have higher vacancy rates overall, and the relationship is strong in central areas of cities as well as the urban periphery. These findings imply that policymakers should not only be concerned with vacancy in newly built suburban developments, but they should also consider how the expansion of credit for new suburban housing has played a role in the hollowing out of central cities. The article has direct implications for Mexico and raises questions about the frame for debate about housing policy internationally. The structure of housing finance systems is often under-scrutinised. Scholars working in emerging markets should work to identify incentives in finance systems and how they shape urbanisation.

Financing housing investment

2020 ◽  
pp. 47-56
Author(s):  
Bob Colenutt
Keyword(s):  
Real Estate ◽  
Real Estate Investment Trusts ◽  
Housing Finance ◽  
Quantitative Easing ◽  
Housing Crisis ◽  
Real Estate Investment ◽  
Role Of Government ◽  
Housing Investment ◽  
The Uk

This chapter looks at the overburdening presence of property and housing finance in the UK economy. It focuses on the economic instability created by mortgage dependency. This is a critical context for understanding the role of Government in creating barriers to resolving the housing crisis though its programme of Quantitative Easing, encouragement of Real Estate Investment Trusts, and by offering tax and residence advantages for overseas investors in UK property. It also explores the rise of investor interest in Build to Rent.

scholarly journals International Real Estate Review

2010 ◽  
Vol 13 (3) ◽  
pp. 351-394
Author(s):  
Luci Ellis ◽  
Keyword(s):  
United States ◽  
Financial Markets ◽  
Housing Prices ◽  
The United States ◽  
Mortgage Lending ◽  
Housing Crisis ◽  
Regulatory Systems ◽  
The Us ◽  
Credit Losses ◽  
Institutional Drivers

The crisis enveloping global financial markets since August 2007 was triggered by actual and prospective credit losses on US mortgages. Was the United States just unlucky to have been the first to experience a housing crisis? Or was it inherently more susceptible to one? I examine the limited international evidence available, to ask how the boom- bust cycle in the US housing market differed from elsewhere and what the underlying institutional drivers of these differences were. Compared with other countries, the United States seems to have: built up a larger overhang of excess housing supply; experienced a greater easing in mortgage lending standards; and ended up with a household sector more vulnerable to falling housing prices. Some of these outcomes seem to have been driven by tax, legal and regulatory systems that encouraged households to increase their leverage and permitted lenders to enable that development. Given the institutional background, it may have been that the US housing boom was always more likely to end badly than the booms elsewhere.

Development and validation of risk stratification models for adult spinal deformity surgery

2019 ◽  
Vol 31 (4) ◽  
pp. 587-599 ◽  
Author(s):  
Ferran Pellisé ◽  
Miquel Serra-Burriel ◽  
Justin S. Smith ◽  
Sleiman Haddad ◽  
Michael P. Kelly ◽  
...  
Keyword(s):  
Spinal Deformity ◽  
Adult Spinal Deformity ◽  
The United States ◽  
Adverse Outcomes ◽  
High Rate ◽  
Prognostic Models ◽  
Time To Event ◽  
European Continent ◽  
Event Risk ◽  
Risk Estimates

OBJECTIVEAdult spinal deformity (ASD) surgery has a high rate of major complications (MCs). Public information about adverse outcomes is currently limited to registry average estimates. The object of this study was to assess the incidence of adverse events after ASD surgery, and to develop and validate a prognostic tool for the time-to-event risk of MC, hospital readmission (RA), and unplanned reoperation (RO).METHODSTwo models per outcome, created with a random survival forest algorithm, were trained in an 80% random split and tested in the remaining 20%. Two independent prospective multicenter ASD databases, originating from the European continent and the United States, were queried, merged, and analyzed. ASD patients surgically treated by 57 surgeons at 23 sites in 5 countries in the period from 2008 to 2016 were included in the analysis.RESULTSThe final sample consisted of 1612 ASD patients: mean (standard deviation) age 56.7 (17.4) years, 76.6% women, 10.4 (4.3) fused vertebral levels, 55.1% of patients with pelvic fixation, 2047.9 observation-years. Kaplan-Meier estimates showed that 12.1% of patients had at least one MC at 10 days after surgery; 21.5%, at 90 days; and 36%, at 2 years. Discrimination, measured as the concordance statistic, was up to 71.7% (95% CI 68%–75%) in the development sample for the postoperative complications model. Surgical invasiveness, age, magnitude of deformity, and frailty were the strongest predictors of MCs. Individual cumulative risk estimates at 2 years ranged from 3.9% to 74.1% for MCs, from 3.17% to 44.2% for RAs, and from 2.67% to 51.9% for ROs.CONCLUSIONSThe creation of accurate prognostic models for the occurrence and timing of MCs, RAs, and ROs following ASD surgery is possible. The presented variability in patient risk profiles alongside the discrimination and calibration of the models highlights the potential benefits of obtaining time-to-event risk estimates for patients and clinicians.

Fall, Crush, Kick: Mechanisms and Outcomes in a Cohort of Equine-Related Injuries

2021 ◽  
pp. 000313482110488
Author(s):  
Pratik Bhade ◽  
Amelia Parsons ◽  
Abbey Smiley ◽  
Jacob Shreffler ◽  
Nick Nash ◽  
...  
Keyword(s):  
Traumatic Injury ◽  
The United States ◽  
Rib Fractures ◽  
High Rate ◽  
Protective Equipment ◽  
Solid Organ ◽  
Mechanism Of Injury ◽  
Severe Injuries ◽  
Protective Devices ◽  
Animal Size

Introduction The potential for significant traumatic injury to individuals who interact with horses remains high due to animal size, forces applied, and unpredictability. Despite an estimated 30 million riders in the United States annually, few recent publications have addressed this patient population. Objectives This study describes characteristics of patients injured in interactions with horses, focusing on mechanism of injury and use of protective equipment. Methods We queried our institution’s trauma registry for all patients admitted for equine-related injuries (ERI) between January 1, 2013 and December 31, 2017. We categorized by specific mechanism of injury (fall, crush, kick, fall + crush, and fall + kick) and presence or absence of protective devices. Results We discovered 143 patients admitted for injuries in equine-related accidents. Patients averaged 49.2 years old, and 62.2% were female. Crush injuries resulted in a high rate of rib fractures. Riders who were kicked had an increased chance of solid organ and facial injuries and falls most commonly led to rib fractures and extremity trauma. Despite lack of documentation on most subjects, protective devices were associated with less severe injuries in those with data (n = 36). Conclusions In this relatively large series of patients with ERI, we found mechanism differences within injury groups. Providers should more carefully document specific circumstances of ERIs. All individuals working with or around horses should exercise prudence and consider using protective equipment.

Neurofeedback for Opioid Dependent Patients in an Outpatient Setting: A Pilot Feasibility Study

2021 ◽  
Author(s):  
Helena A. Rempala ◽  
Justin A. Barterian
Keyword(s):  
Large Scale ◽  
The United States ◽  
Outpatient Setting ◽  
Opioid Use Disorder ◽  
High Rate ◽  
Treatment Center ◽  
Opioid Use ◽  
Treatment As Usual ◽  
Factors Affecting ◽  
Study Approach

Abstract Background: Neurofeedback (NF) has been described as “probably efficacious” when used in conjunction with other interventions for substance use disorders, including the most recent studies in population of individuals with opioid use disorder. Despite these promising outcomes, the seriousness of the opioid epidemic, and the high rate of relapse even with the most effective medication-assisted maintenance treatments NF continues to be an under-researched treatment modality. This article explores factors that affected the feasibility of adding Alpha/Theta Neurofeedback to treatment as usual for opioid dependence in an outpatient urban treatment center. The study strived to replicate previous research completed in Iran that found benefits of NF for opioid dependence.Methods: Out of approximately two dozen patients eligible for Alpha/Theta NF, about 60% (n=15) agreed to participate; however, only 2 participants completed treatment. The rates of enrollment in response to active treatment were monitored. Results: The 4 factors affecting feasibility were: 1) the time commitment required of participants, 2) ineffectiveness of standard incentives to promote participation, 3) delayed effects of training, and 4) the length and number of treatments required.Conclusion: The findings indicate a large scale study examining the use of NF for the treatment of opioid use disorder in the United States will likely be difficult to accomplish without modification to the traditional randomized control study approach and suggests challenges to the implementation of this treatment in an outpatient setting.

Ground Beef Consumption Patterns in the United States, FoodNet, 2006 through 2007

2012 ◽  
Vol 75 (2) ◽  
pp. 341-346 ◽  
Author(s):  
ETHEL V. TAYLOR ◽  
KRISTIN G. HOLT ◽  
BARBARA E. MAHON ◽  
TRACY AYERS ◽  
DAWN NORTON ◽  
...  
Keyword(s):  
United States ◽  
Foodborne Pathogens ◽  
College Education ◽  
Ground Beef ◽  
The United States ◽  
High Rate ◽  
Foodborne Illnesses ◽  
Beef Patties ◽  
Uremic Syndrome ◽  
Using Data

Infection resulting from foodborne pathogens, including Escherichia coli O157:H7, is often associated with consumption of raw or undercooked ground beef. However, little is known about the frequency of ground beef consumption in the general population. The objective of this study was to describe patterns of self-reported ground beef and pink ground beef consumption using data from the 2006 through 2007 FoodNet Population Survey. From 1 July 2006 until 30 June 2007, residents of 10 FoodNet sites were contacted by telephone and asked about foods consumed within the previous week. The survey included questions regarding consumption of ground beef patties both inside and outside the home, the consumption of pink ground beef patties and other types of ground beef inside the home, and consumption of ground beef outside the home. Of 8,543 survey respondents, 75.3% reported consuming some type of ground beef in the home. Of respondents who ate ground beef patties in the home, 18.0% reported consuming pink ground beef. Consumption of ground beef was reported most frequently among men, persons with incomes from $40,000 to $75,000 per year, and persons with a high school or college education. Ground beef consumption was least often reported in adults ≥65 years of age. Men and persons with a graduate level education most commonly reported eating pink ground beef in the home. Reported consumption of ground beef and pink ground beef did not differ by season. Ground beef is a frequently consumed food item in the United States, and rates of consumption of pink ground beef have changed little since previous studies. The high rate of consumption of beef that has not been cooked sufficiently to kill pathogens makes pasteurization of ground beef an important consideration, especially for those individuals at high risk of complications from foodborne illnesses such as hemolytic uremic syndrome.

scholarly journals First Report of Southern tomato virus on Tomatoes in Southwest France

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
T. Candresse ◽  
A. Marais ◽  
C. Faure
Keyword(s):  
North America ◽  
Seed Transmission ◽  
The United States ◽  
High Rate ◽  
Reference Sequence ◽  
Tomato Mosaic Virus ◽  
Potential Contribution ◽  
First Report ◽  
Tomato Sample ◽  
Potential Pathogenicity

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5′ CTGGAGATGAAGTGCTCGAAGA 3′ and STV-rev 5′ TGGCTCGTCTCGCATCCTTCG 3′) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

scholarly journals Earthquake Magnitude Estimation from High-Rate GNSS Data: A Case Study of the 2021 Mw 7.3 Maduo Earthquake

2021 ◽  
Vol 13 (21) ◽  
pp. 4478
Author(s):  
Zhiyu Gao ◽  
Yanchuan Li ◽  
Xinjian Shan ◽  
Chuanhua Zhu
Keyword(s):  
Magnitude Estimation ◽  
The United States ◽  
High Rate ◽  
Convergence Time ◽  
Western China ◽  
Peak Ground Velocity ◽  
Stability And Convergence ◽  
Critical Parameters ◽  
United States Geological Survey ◽  
Gnss Data

Peak ground displacement (PGD) and peak ground velocity (PGV) are critical parameters during earthquake early warning, as they can provide rapid magnitude estimation before rupture end. In this study, we used the high-rate Global Navigation Satellite System (GNSS) data from 55 continuous stations to estimate the magnitude of the 2021 Maduo earthquake in western China. We used the relative positioning method and variometric approach to acquire real-time GNSS displacement and velocity waveforms, respectively. The results showed the amplitude of displacement and velocity waveforms gradually decreased with increasing hypocentral distance. Our results showed that the fluctuation of PGD magnitudes over time is smaller than that of PGV magnitudes. Nonetheless, the earthquake magnitudes estimated from both methods were consistent with their counterparts (Mw 7.3) reported by the United States Geological Survey (USGS). The final magnitude estimated from the PGD and PGV methods were Mw 7.25 and Mw 7.31, respectively. In addition, our results highlighted how the number of high-rate GNSS stations could influence the stability and convergence time of magnitude estimation.

scholarly journals Aetiological Factors of Osteoarthritis: A Review Update

2015 ◽  
Vol 2 (1) ◽  
pp. 18-23
Author(s):  
M. Jahidul Islam ◽  
M. Shahadat Hossain ◽  
M. Ruhul Amin ◽  
Monzur Ahmed
Keyword(s):  
United States ◽  
Joint Damage ◽  
The Elderly ◽  
The United States ◽  
Common Type ◽  
High Rate ◽  
Lumbosacral Spine ◽  
First Metatarsal ◽  
High Prevalence ◽  
Wear And Tear

Osteoarthritis (OA) is no longer considered ‘degenerative’ or ‘wear and tear’ arthritis; rather involves dynamic biomechanical, biochemical and cellular process. Indeed, the joint damage that occurs in OA is the result of active remodeling involving all the joint structures. Although articular cartilage is at the center of change, OA is viewed as a disease of the entire joint. Traditionally, OA has been viewed as an inevitable degenerative condition of the cartilage. It is currently viewed as a biomechanical and biochemical inflammatory disease of the entire joints. Osteoarthritis (OA) is the most common type of arthritis. Its high prevalence, especially in the elderly, and the high rate of disability related to disease make it a leading cause of disability in the elderly. Because of the aging of Western populations and because obesity, a major risk factor, are increasing in prevalence, the occurrence of osteoarthritis is on the rise. In the United States, osteoarthritis prevalence will increase from 66–100% by the year 2020. OA affects certain joints, yet spares others. Commonly affected joints include the cervical and lumbosacral spine, hip, knee, and first metatarsal phalangeal joint (MTP). In the hands, the distal and proximal inter-phalangeal joints and the base of the thumb are often affected. Usually spared are the wrist, elbow, and ankle.Journal of Current and Advance Medical Research 2015;2(1):18-23DOI: http://dx.doi.org/10.3329/jcamr.v2i1.22584

Sign in / Sign up

Export Citation Format

Share Document