NDRG1 Expression Is Inhibited in AML and Its Knockdown Attenuates Neutrophil Differentiation.

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 927-927
Author(s):  
Mario P. Tschan ◽  
Deborah Shan ◽  
Judith Laedrach ◽  
Marianne Eyholzer ◽  
Elisabeth Oppliger Leibundgut ◽  
...  
Keyword(s):  
Mrna Expression ◽  
Cell Line ◽  
Cell Phenotype ◽  
Mrna Levels ◽  
U937 Cells ◽  
Rt Pcr ◽  
Atra Treatment ◽  
Significant Difference ◽  
Blast Cells ◽  
Neutrophil Differentiation

Abstract The N-myc down-regulated gene 1 (NDRG1) is a stressed induced protein whose expression is associated with growth arrest and differentiation of tumor cells. Although the exact function of NDRG1 protein remains unknown, various studies support its role as a suppressor of tumor metastasis. In prostate, colon and breast cancer its expression is associated with a better disease prognosis and patient survival. In hematopoietic cells, NDRG1 was identified in a differential display screen for differentiation-related genes in human myelomonocytic U937 cells. In the present study, we sought to investigate the role of NDRG1 in myeloid differentiation. To this end we first evaluated NDRG1 mRNA expression in acute myeloid leukemia (AML; n=82) patient samples as well as in CD34+ progenitor cells (n=5) and neutrophils (n=6) of healthy donors using quantitative real-time RT-PCR. We found significantly higher NDRG1 mRNA levels in granulocytes as compared to CD34+ (p=0.0043) or AML blast cells (p<0.0001), whereas no significant difference between CD34+ progenitor and AML blast cells was seen (Figure A). Moreover, we found that NDRG1 mRNA levels were increased in 4/5 APL patients upon ATRA therapy. In contrast, the closest relative of NDRG1, NDRG2, did not show significantly different expression in these primary cells, thus indicating a unique role for NDRG1 in granulocyte differentiation. Next we examined NDRG1 expression using quantitative RT-PCR and Western blotting in two different cell line models for ATRA-induced neutrophil differentiation. ATRA treatment of NB4 and HT93 acute promyelocytic leukemia (APL) cells induced NDRG1 mRNA 2.3- and 14.3- fold, respectively. Increased NDRG1 mRNA expression was paralleled by an increase of NDRG1 protein as well as a decrease in c-myc protein. Earlier reports described that NDRG1 is also suppressed by c-myc suggesting that down-regulation of c-myc in our cell line models allowed for an increase of NDRG1. In line with these observations, lentivirus-driven short hairpin (sh)RNA-mediated silencing of NDRG1 diminished ATRA-induced neutrophil differentiation of NB4 and U937 cells as measured by CD11b, CD11c and CD18 surface expression. In NB4 NDRG1 knockdown versus non-targeting shRNA expressing cells mean fluorescent intensities (MFI) for CD11b, CD11c and CD18 upon six days of ATRA-treatment were 99±17 vs 146±7, 20±2 vs 32±10 and 19±2 vs 45±6, respectively (Figure B). Similarly, U937 NDRG1 knockdown versus control cells displayed the following MFIs for CD11b and CD18 upon neutrophil differentiation: 61±1 vs 102±2 and 11±4 vs 33±13, respectively. In conclusion, we report here for the first time an association of low NDRG1 levels with an immature hematopoietic cell phenotype. Using RNAi technology we further provide evidence that NDRG1 is functionally involved in neutrophil maturation. Figure Figure

EAR-2: Identification of a Gene Involved in Maintenance of Clonogenicity in Haematopoiesis.

Blood ◽  
2004 ◽  
Vol 104 (11) ◽  
pp. 3226-3226
Author(s):  
Christine V. Ichim ◽  
Mahadeo A. Sukhai ◽  
J. Brandwein ◽  
Mark D. Minden ◽  
Aaron D. Schimmer ◽  
...  
Keyword(s):  
Bone Marrow ◽  
Cell Line ◽  
Nuclear Receptor ◽  
Doubling Time ◽  
Single Cells ◽  
U937 Cells ◽  
Orphan Nuclear Receptor ◽  
Proliferative Capacity ◽  
Rt Pcr ◽  
Significant Difference

Abstract Primary acute myelogenous leukaemia (AML) samples are heterogeneous in clonogenicity, both among patients and within the leukaemic cell population of a single patient. To explain this heterogeneity the leukaemia stem cell model postulates that leukaemic hematopoiesis is organized in a hierarchy, sustained by leukaemia stem cells that may either self-renew or differentiate aberrantly to give rise to blasts that can no longer proliferate. This process is akin to the irreversible growth arrest entered by terminally differentiating normal blood cells. We wished to identify genes associated with clonogenicity in AML. To obtain pure populations of cells of defined growth abilities, we analyzed low passage cultures of the cell line OCI-AML4. This cell line resembles primary AML cells in several important respects; it is growth factor-dependent, contains a low proportion of clonogenic cells, and has a relatively simple karyotype. Clones consisting of four cells were micromanipulated so that a single cell was sampled for global RT-PCR while its three clonal siblings served as reporters of clonogenicity. By microarray analysis we found the orphan nuclear receptor EAR-2 to be expressed four-fold lower in leukemia single cells that spontaneously lose proliferative ability, compared to single cells with greater proliferative capacity. EAR-2 is a member of the COUP transcription factor family, which play roles in various developmental processes through interactions with nuclear receptors and other transcription factors. We assessed expression of EAR-2 in monoblastic leukaemia U937 cells induced to differentiate with a variety of induction agents. Treatment with dimethylsulfoxide, phorbol ester, vitamin D3, and all trans retinoic acid (ATRA) all induced significant decreases in EAR-2 expression. This phenomenon was also seen in a mouse model of acute promyelocytic leukaemia (APL). When primary bone marrow cultures of hCG-NuMA-RAR transgenic mice were induced to differentiate with ATRA, an average decrement in EAR-2 expression of 5.58 fold was observed (p<0.005). Since aberrant differentiation is an invariant feature of AML, we hypothesized that the overall expression of EAR-2 would be greater in AML patients relative to healthy controls. Analysis by quantitative RT-PCR of 15 AML, 10 CMML, 12 MDS and 16 normal bone marrow samples showed that EAR-2 is overexpressed in all three disease categories (p<0.0009 AML, 0.03 CMML, 0.0003 MDS). To characterize the effect of forced expression of EAR-2 on clonogenicity we transduced U937 cells with a retrovirus encoding either EAR-2 (U937-EAR2) or EGFP (U937-GFP). Analysis of FACS-purified U937-EAR2 and U937-GFP cultures showed that forced expression of EAR-2 reduces the doubling time of these populations (U937-EAR2 = 24h; U937-GFP = 34h; p<< 0.001), while no significant difference was observed in cell cycle profile. The decrease in doubling time of U937-EAR2 cells may reflect a decrease in the rate of cell loss in the population, consistent with the hypothesis that EAR-2 functions as a repressor of terminal differentiation. We have observed that expression of the orphan nuclear receptor EAR-2 is positively associated with maintenance of proliferative capacity and negatively associated with differentiation. These observations establish the importance of EAR-2 in the regulation of clonogenicity and terminal differention.

Blocking the Autophagy Gene 5 (ATG5) Impairs ATRA-Induced Myeloid Differentiation, and ATG5 Is Downregulated in AML

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 309-309 ◽  
Author(s):  
Adrian Britschgi ◽  
Shida Yousefi ◽  
Judith Laedrach ◽  
Deborah Shan ◽  
Hans-Uwe Simon ◽  
...  
Keyword(s):  
Cell Death ◽  
Mrna Expression ◽  
Western Blotting ◽  
Surface Expression ◽  
Myeloid Differentiation ◽  
Tetrazolium Salt ◽  
Mrna Levels ◽  
Atra Treatment ◽  
Hl60 Cells ◽  
Neutrophil Differentiation

Abstract Autophagy describes a process of membrane trafficking where specialized compartments (autophagosomes) engulf damaged or dispensable organelles and target them to lysosomic degradation. Thus, autophagy has cytoprotective functions e.g. during starvation, but autophagy can also lead to caspase-independent cell death (PCD type II). ATG5 is a central player in autophagy and inactivating ATG5 severely impairs normal development. In hematopoiesis, ATG5 is essential for maturation of B lymphocytes as well as for T cell survival and proliferation. In recent years, several differentiation and death-inducing agents were shown to activate autophagy in acute myeloid leukemia (AML) cell line models, but the mechanisms involved are still poorly defined. We therefore decided to investigate the role of ATG5 and autophagy in all-trans retinoic acid (ATRA)-induced neutrophil differentiation of AML cells. We found that ATG5 mRNA was upregulated 5.9-, 3.8- and 3.4-fold after 6 days of ATRA-treatment in HL60, NB4 and HT93 AML cells, respectively. In contrast, PMA-induced macrophage differentiation of HL60 and U937 cells only slightly induced ATG5 mRNA by 1.3- and 1.5-fold, respectively, indicating a specific role for ATG5 in granulocyte differentiation. In line with the above observation in leukemic cell lines, we found that ATG5 mRNA levels were increased in 5/5 APL patients upon ATRA therapy. In addition, ATG5-ATG12 conjugates, hallmarks of the autophagic process, were markedly activated in ATRA-treated NB4 and HL60 cells compared to control cells as measured by Western blotting. In agreement, we found increased autophagic activity during myeloid differentiation as evidenced by two additional autophagy markers, i.e. conversion of light chain 3 B (LC3B)-I into LC3B-II and degradation of sequestosome 1 (SQSTM1, p62) protein by Western blotting. Inhibition of autophagy during ATRA treatment of NB4 and HL60 cells with 3-Methyladenine or Bafilomycin A significantly impaired neutrophil differentiation by 80% as measured by CD11b surface expression. Similarly, lentivirus-driven short hairpin (sh)RNA-mediated silencing of ATG5 in NB4 cells resulted in an 85% reduction of ATRA-induced neutrophil differentiation as measured by CD11b surface expression and by quantitative RT-PCR of the myeloid differentiation markers GCSFR, C/EBPε and lactotransferrin. Interestingly, inhibition of autophagy increased overall cell death during the myeloid differentiation process rather than reducing it as measured by reduction of tetrazolium salt (XTT assay). Enhanced cell death and reduced myeloid differentiation upon blocking ATG5 would suggest that autophagy is needed for maintaining myeloid differentiation. Further support for our hypothesis that ATG5 is needed for neutrophil development stems from our survey of ATG5 mRNA expression in primary hematopoietic cells. We found significantly higher ATG5 mRNA levels in granulocytes and macrophages (n=7) as compared to CD34+ hematopoietic progenitor cells from healthy donors (n=4; p=0.0424) as well as compared to primary AML patient samples at diagnosis (n=76; p=0.0003). ATG5 mRNA expression in CD34+ and AML patients was not significantly different (p=0.6669). In summary, we show a correlation of high ATG5 expression with terminal myeloid differentiation and of low ATG5 expression with a myeloid leukemic phenotype. Using chemical inhibitors of autophagy as well as RNAi technology to knockdown ATG5, we further provide evidence that ATG5 and consequently autophagy are essential for neutrophil development.

Activation of nuclear factor of activated T cells 5 in the peritoneal membrane of uremic patients

2015 ◽  
Vol 308 (11) ◽  
pp. F1247-F1258 ◽  
Author(s):  
Daniel Kitterer ◽  
Joerg Latus ◽  
Christoph Ulmer ◽  
Peter Fritz ◽  
Dagmar Biegger ◽  
...  
Keyword(s):  
T Cells ◽  
Mrna Expression ◽  
Mrna Levels ◽  
Nuclear Factor ◽  
Activated T Cells ◽  
Significant Difference ◽  
Ccl2 Mrna ◽  
Uremic Patients ◽  
High Concentrations

Peritoneal inflammation and fibrosis are responses to the uremic milieu and exposure to hyperosmolar dialysis fluids in patients on peritoneal dialysis. Cells respond to high osmolarity via the transcription factor nuclear factor of activated T cells (NFAT5). In the present study, the response of human peritoneal fibroblasts to glucose was analyzed in vitro. Expression levels of NFAT5 and chemokine (C-C motif) ligand (CCL2) mRNA were quantified in peritoneal biopsies of five nonuremic control patients, five uremic patients before PD (pPD), and eight patients on PD (oPD) using real-time PCR. Biopsies from 5 control patients, 25 pPD patients, and 25 oPD patients were investigated using immunohistochemistry to detect the expression of NFAT5, CCL2, NF-κB p50, NF-κB p65, and CD68. High glucose concentrations led to an early, dose-dependent induction of NFAT5 mRNA in human peritoneal fibroblasts. CCL2 mRNA expression was upregulated by high concentrations of glucose after 6 h, but, most notably, a concentration-dependent induction of CCL2 was present after 96 h. In human peritoneal biopsies, NFAT5 mRNA levels were increased in uremic patients compared with nonuremic control patients. No significant difference was found between the pPD group and oPD group. CCL2 mRNA expression was higher in the oPD group. Immunohistochemistry analysis was consistent with the results of mRNA analysis. CD68-positive cells were significantly increased in the oPD group. In conclusion, uremia results in NFAT5 induction, which might promote early changes of the peritoneum. Upregulation of NFAT5 in PD patients is associated with NFκB induction, potentially resulting in the recruitment of macrophages.

scholarly journals Human mononuclear cells express 12-LX: coordinated mRNA regulation with 5-LX and FLAP genes

Blood ◽  
1996 ◽  
Vol 87 (1) ◽  
pp. 331-340
Author(s):  
WE Kaminski ◽  
E Jendraschak ◽  
K Baumann ◽  
R Kiefl ◽  
S Fischer ◽  
...  
Keyword(s):  
Gene Expression ◽  
Mrna Expression ◽  
Time Course ◽  
Cell Activation ◽  
Mononuclear Cells ◽  
Constitutive Expression ◽  
Ionophore A23187 ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Human Mononuclear Cells

Lipoxygenases (LXs) catalyze formation of leukotrienes and hydroxy-eicosatetraenoic acids (HETEs), proinflammatory, and spasmogenic autacoids that are critical for host defense systems. We studied the expression and regulation of LX genes (12-LX, 5-LX, and 15-LX) and the 5-lipoxygenase activating protein (FLAP) in human mononuclear cells (MNC) and granulocytes using a quantitative reverse transcription polymerase chain reaction (RT-PCR) technique. We show that 12-LX mRNA is constitutively expressed in resting platelet-free MNC. 12-LX gene expression was upregulated by activation with lipopolysaccharide (LPS). The formation of 12-HETE was inducible with ionophore in MNC, as assessed by high-performance liquid chromatography (HPLC) and gas chromatography, and increased after LPS pretreatment. In addition to 12- LX, resting MNC expressed the genes for 5-LX and FLAP constitutively. Quantitative time course analyses of 12-LX, 5-LX, and FLAP gene expression suggested coregulation of 12-LX and FLAP mRNAs, and reciprocal regulation of 5-LX and FLAP mRNAs. During cell stimulation with LPS 5-LX mRNA levels remained unchanged, whereas FLAP gene expression increased. No 15-LX mRNA expression or 15-HETE formation was detectable in unstimulated and activated MNC. In contrast to MNC, quantitative RT-PCR mRNA analysis showed intermittent intraindividual expression of the 5-LX and FLAP genes in resting granulocytes. mRNAs for 12-LX and 15-LX were not expressed. On stimulation of granulocytes ex vivo, mRNA expression of 5-LX and FLAP was upregulated. Stimulation by LPS differed from that by ionophore A23187. Neither LPS nor ionophore induced gene expression of 12-LX or 15-LX in granulocytes. Our data indicate that resting human MNC and granulocytes express LX and FLAP genes in a cell-specific manner. Cell activation induces coordinated upregulation of 12-LX and FLAP genes in MNC, and 5-LX and FLAP genes in granulocytes, respectively. The constitutive expression of 12-LX mRNA, its upregulation on cell activation, and the formation of 12-HETE clearly indicate the presence of a functional 12-LX in human MNC.

scholarly journals Human mononuclear cells express 12-LX: coordinated mRNA regulation with 5-LX and FLAP genes

Blood ◽  
1996 ◽  
Vol 87 (1) ◽  
pp. 331-340 ◽  
Author(s):  
WE Kaminski ◽  
E Jendraschak ◽  
K Baumann ◽  
R Kiefl ◽  
S Fischer ◽  
...  
Keyword(s):  
Gene Expression ◽  
Mrna Expression ◽  
Time Course ◽  
Cell Activation ◽  
Mononuclear Cells ◽  
Constitutive Expression ◽  
Ionophore A23187 ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Human Mononuclear Cells

Abstract Lipoxygenases (LXs) catalyze formation of leukotrienes and hydroxy-eicosatetraenoic acids (HETEs), proinflammatory, and spasmogenic autacoids that are critical for host defense systems. We studied the expression and regulation of LX genes (12-LX, 5-LX, and 15-LX) and the 5-lipoxygenase activating protein (FLAP) in human mononuclear cells (MNC) and granulocytes using a quantitative reverse transcription polymerase chain reaction (RT-PCR) technique. We show that 12-LX mRNA is constitutively expressed in resting platelet-free MNC. 12-LX gene expression was upregulated by activation with lipopolysaccharide (LPS). The formation of 12-HETE was inducible with ionophore in MNC, as assessed by high-performance liquid chromatography (HPLC) and gas chromatography, and increased after LPS pretreatment. In addition to 12- LX, resting MNC expressed the genes for 5-LX and FLAP constitutively. Quantitative time course analyses of 12-LX, 5-LX, and FLAP gene expression suggested coregulation of 12-LX and FLAP mRNAs, and reciprocal regulation of 5-LX and FLAP mRNAs. During cell stimulation with LPS 5-LX mRNA levels remained unchanged, whereas FLAP gene expression increased. No 15-LX mRNA expression or 15-HETE formation was detectable in unstimulated and activated MNC. In contrast to MNC, quantitative RT-PCR mRNA analysis showed intermittent intraindividual expression of the 5-LX and FLAP genes in resting granulocytes. mRNAs for 12-LX and 15-LX were not expressed. On stimulation of granulocytes ex vivo, mRNA expression of 5-LX and FLAP was upregulated. Stimulation by LPS differed from that by ionophore A23187. Neither LPS nor ionophore induced gene expression of 12-LX or 15-LX in granulocytes. Our data indicate that resting human MNC and granulocytes express LX and FLAP genes in a cell-specific manner. Cell activation induces coordinated upregulation of 12-LX and FLAP genes in MNC, and 5-LX and FLAP genes in granulocytes, respectively. The constitutive expression of 12-LX mRNA, its upregulation on cell activation, and the formation of 12-HETE clearly indicate the presence of a functional 12-LX in human MNC.

scholarly journals Dose-dependent immune response in milk cells and mammary tissue after intramammary administration of lipopolysaccharide in dairy cows

2008 ◽  
Vol 52 (No. 6) ◽  
pp. 231-244 ◽  
Author(s):  
C. Werner-Misof ◽  
M.W. Pfaffl ◽  
R.M. Bruckmaier
Keyword(s):  
Immune Response ◽  
Mrna Expression ◽  
Real Time ◽  
Polymorphonuclear Neutrophils ◽  
Mammary Tissue ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Lps Challenge ◽  
Cell Counts ◽  
Cox 2

The immune response in milk cells and the status of mammary tight junctions (TJ) in response to intramammary (IM) infusion of different doses of <i>Escherichia col</i>i lipopolysaccharide (LPS) was investigated. <i>Experiment I</i>: Seven German Braunvieh cows were IM infused into one quarter with 1 &mu;g (LPS-1) and 3 &mu;g (LPS-3) of LPS, respectively, and the contralateral control quarter with saline (9 g/l; C). Milk samples were taken immediately before and 12, 24, 36, 48, 60, 84 and 108 h after infusion and analysed for somatic cell counts (SCC), lactose, sodium (Na) and chloride (Cl) ions, and electrical conductivity (EC). Milk cell mRNA expression of various inflammatory factors was quantified by real-time RT-PCR. Blood samples were taken immediately after milking for the analysis of leukocytes (WBC), polymorphonuclear neutrophils (PMN), Na and Cl. Milk SCC, lactose, Na, Cl and EC did not differ significantly between LPS-1 and C quarters after the challenge. In LPS-3 quarters SCC levels increased within the first 12 h, reached peak levels between 12 and 36 h (<i>P</i> &le; 0.001) and decreased (<i>P</i> &le; 0.05) thereafter to reach baseline at 108 hours. Lactose in LPS-3 quarters decreased (<i>P</i> &le; 0.05) to a minimum at 24 h and increased slightly thereafter while EC, Na, and Cl increased transiently in response to LPS-3. WBC and PMN levels in both groups decreased numerically within 24 h after LPS administration. In LPS-1, WBC at 24, 48 and 108 h were significantly lower whereas in LPS-3 they were significantly higher than at time 0. TNF&alpha;-mRNA expression in both groups did not change in response to IM LPS-challenge. IL-1&beta;-mRNA expression at 12, 24 and 36 h in LPS-1 quarters increased significantly as compared to time 0. In LPS-3 quarters the mRNA expression values of all tested ILs increased significantly as compared to time 0 within 12 h after LPS-challenge. IL-1&beta;-mRNA expression decreased (<i>P</i> &le; 0.05) at 48 and 84 h in LPS quarters. IL-8 mRNA was significantly decreased at 84 h after challenge in LPS-3 quarters. COX-2-mRNA expression in LPS-1 quarters decreased significantly as compared to time 0 at 48, 84 and 108 h, with a minimum at 84 h (<i>P</i> &le; 0.05). In LPS-3 quarters COX-2-mRNA levels increased (<i>P</i> &le; 0.05) within 48 h after the LPS-challenge. <i>Experiment II</i>: Six cows (5 German Braunvieh, 1 Brown Swiss) were injected in one quarter with 100 &mu;g LPS and in the contralateral quarter with saline (9 g/l; C). Mammary biopsy samples of both quarters were taken immediately before and at 3, 6, 9 and 12 h after infusion and mRNA expression of TJ proteins occludin (OCLN) and zonula occludens (ZO-) 1, 2 and 3 were quantified by real-time RT-PCR. OCLN-mRNA expression did not change in response to the IM infusion while that of ZO-1, ZO-2 and ZO-3 decreased significantly within six hours. In conclusion, a dose of 1 &mu;g LPS did not initiate a immune response in the mammary gland. Furthermore the dose of 100 &mu;g of LPS enhanced TJ permeability by reducing TJ plaque proteins density.

Alternation of Cellular Morphology and Proliferation Induced by microRNA in Human Leukemia Cell Line, UT-7/EPO.

Blood ◽  
2006 ◽  
Vol 108 (11) ◽  
pp. 4203-4203
Author(s):  
Nobuyoshi Kosaka ◽  
Yusuke Yamamoto ◽  
Nami Nogawa ◽  
Keiichi Sugiura ◽  
Hiroshi Miyazaki ◽  
...  
Keyword(s):  
Cell Cycle ◽  
Cell Line ◽  
Cell Lines ◽  
Macrocytic Anemia ◽  
Leukemia Cell ◽  
Leukemia Cell Line ◽  
Human Leukemia ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Morphological Studies

Abstract Mature microRNA (miRNA) originated from primary miRNA (pri-miRNA) is a new group of potential regulator for cell differentiation, apoptosis, proliferation and oncogenesis. Some miRNAs were recently identified in hematopoietic cells, while the roles of miRNAs in erythrocytic and megakaryocytic cells had not been well examined. As a first step to explore for miRNAs specific for hematopoietic lineage, the expressions of several known primary microRNAs in erythrocytic and megakaryocytic cell lines, such as TF-1, HL-60, HEK293 and UT-7 leukemia cells, were examined by RT-PCR. We consequently focused on the pri-miR-10a, a primary transcript of miR-10a located within Hox gene clusters, and found the significant expression in TF-1 cells and UT-7/EPO cells. The UT-7/EPO cells were a subline established from the original UT-7 cells, as well as UT-7/GM and UT-7/TPO cells; therefore it was suitable for the further comparative analysis. Interestingly, in UT-7/EPO cells, the expression of pri-miR-10a increased under stimulation of erythropoietin (EPO; 1U/mL and 10U/mL). Based on these observations, it was postulated that pri-miR-10a might involve in modulating erythrocyte differentiation or proliferation. To clarify the role of pri-miR-10a in UT-7/EPO, we have established clonal cell lines by transfecting UT-7/EPO cells with either the control vector or the pri-miR-10a expression vector pCMV-pri-miR10a. Overexpression of pri-miR-10a in the UT-7/EPO cell line (miR10a-UT-7/EPO) was confirmed by RT-PCR. MiR10a-UT-7/EPO showed higher proliferation rate even at low concentration of EPO (0.1 mU/mL). Overexpression of pri-miR-10a did not appear to affect HOXB4 and HOXA1 expression, as similar mRNA levels were seen in both cell lines. It was notable that the cellular size of miR10a-UT-7/EPO became larger than its parental cells. Morphological studies of miR10a-UT-7/EPO were performed in detail. It is possible that miR-10a was capable to modulate morphological features particularly in cellular size relating to cell cycle regulation. For instance, loss of the E2F family members result in marked macrocytic anemia with megaloblastic features in adult mice (Mol Cell. 2000 Aug;6(2):281–91., Mol Cell Biol. 2003 May;23(10):3607–22., Blood. 2006 Aug 1;108(3):886–95.). Data presented here hypothesized that the roles of miR-10a in erythroid cells are tightly associated with cell cycle.

Methanolic Extract of Cynara Cardunculus L. Inhibits Cell Proliferation and Bcr/Abl Expression in K562 Cell Line

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 4247-4247
Author(s):  
Antonio Russo ◽  
Filomena Conforti ◽  
Maria Cristina Caroleo ◽  
Roberta Ionà ◽  
Giancarlo Statti ◽  
...  
Keyword(s):  
Cell Growth ◽  
Western Blot ◽  
Cell Line ◽  
Blot Analysis ◽  
Proliferative Activity ◽  
Methanolic Extract ◽  
Mrna Levels ◽  
Cynara Cardunculus ◽  
Rt Pcr ◽  
K562 Cell Line

Abstract Introduction: Chronic myeloid leukaemia (CML) is a myeloid neoplasm defined by the Bcr/Abl oncoprotein that is considered essential for leukaemogenesis and accumulation of neoplastic cells. Evidence exists showing that extracts of antichoke Cynara cardunculus L. (CCE) are able to inhibit cancer cell growth in vitro (1). In the present study we have investigated the antiproliferative effect of methanolic extract of CEE on K562 Bcr-Abl positive leukemia cell line. In addition we evaluated whether the extract of CEE also affects the mRNA levels of Bcr-Abl and p210 expression in this cell line. Materials and Methods: Preparation of methanolic extract of CEE. The aerial parts of CEE were air dried until dryness at room temperature, cut into small pieces and then extracted with methanol through maceration (48 h for 3 times). The resultant total extracts were dried under reduced pressure and their weight was determined. Cell culture. The K562 cells were grown in RPMI 1640 with L-glutamine supplemented with 10% (v/v) heat-inactivated FBS, 1% penicillin/streptomycin in humidified atmosphere of 5% CO2 at 37°C. In all experiments growing cells at optimal concentration were placed in 24 or 96 well plate and then treated with vehicle or 5–100–200 μg/ml methanolic extract of CEE. 48h after the treatment cultures were tested for proliferative activity, mRNA level of Bcr-Abl by RT-PCR and p210 protein expression by western blotting analysis. Proliferative activity. Proliferative activity was determined using the MTT technique according to the method described by Tubaro et al. (1996). The assay was performed in triplicate and absorbance values at 550 nm were measured using a microplate reader. RT-PCR Analysis. The total cellular mRNA was isolated from treated and control cells using an silica coloumns. Using equal amounts of the RNA from each sample, the cDNA was synthesized by Superscript VILO™ cDNA kit. PCR was performed using Platinum® Taq DNA polymerase and specific primers for t(9;22) p210 transcripts (b3a2): GAAGTGTTTCAGAAGCTTTCC (sense) and GTTTGGGCT-TCACACCATTCC (antisense). 35 amplification cycles were performed at 94°C for 30s, 55°C for 30s and 72°C for 1min. Gel electrophoresis and ethidium bromide staining was used to visualize the PCR products. Western Blot Analysis. Cell pellets from control and treated cultures were lysed using lysis buffer with protease and phosphatase inhibitors. The proteins were then quantified and equal amounts (30 ug) were separated by SDS-PAGE and electro-blotted to nitrocellulose. After blocking procedure the blots were incubated with specific primary antibody against p210 protein and then challenged with specific horseradish peroxidase-conjugated secondary antibody. The reactive protein was visualized using an enhanced chemiluminescence detection system. Results: The results have shown that treatment of K562 cell line with methanolic extract of CEE reduced cell viability in a dose-dependent fashion (IC50=41.7 μg/ml) as demonstrated by MTT assay. PCR and Western blot analysis revealed that the cell growth inhibition was associated to a dramatic decrease of mRNA levels of Bcr-Abl and to a significant reduction of p210 protein expression suggesting that the antiproliferative effect of methanolic extract of CEE likely due to the inhibition at transcriptional level of Bcr-Abl oncoprotein. Further studies are needed to better elucidate this mechanisms and to identify the compound of crude extract which is responsible of cancer growth suppression.

scholarly journals mRNA expression profiles for corticotrophin-releasing hormone, urocortin, CRH-binding protein and CRH receptors in human term gestational tissues determined by real-time quantitative RT-PCR

2004 ◽  
Vol 32 (2) ◽  
pp. 339-348 ◽  
Author(s):  
B Sehringer ◽  
HP Zahradnik ◽  
M Simon ◽  
R Ziegler ◽  
C Noethling ◽  
...  
Keyword(s):  
Mrna Expression ◽  
Real Time ◽  
Binding Protein ◽  
Receptor Subtype ◽  
Receptor Subtypes ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Releasing Hormone ◽  
Gestational Tissues ◽  
Crh Receptors

Increasing maternal plasma levels of corticotrophin-releasing hormone (CRH) during the last weeks of pregnancy suggest that this stress hormone plays an important role in the control of human parturition. Little is known about the quantitative contribution of gestational tissues (other than placenta) to intrauterine formation of CRH, urocortin and CRH-binding protein (CRH-BP), or about the distribution of CRH receptors within the uterus. We have investigated the mRNA expression of CRH, urocortin, CRH-BP and CRH receptors 1 and 2 (CRH-R1 and -R2) in gestational tissues by real-time RT-PCR. Placenta, myometrium and choriodecidua were collected after uncomplicated pregnancies at term, before the onset of labour. Distribution of CRH-R1 and CRH-R2 protein was also investigated by immunostaining with receptor subtype-specific antibodies. The placenta was identified as the main site of CRH and CRH-BP mRNA expression, displaying mRNA levels >1000 and >20 times higher than those found in the myometrium and choriodecidua respectively (P<0.05 in each case). mRNA expression of urocortin was low in all tissues investigated. Myometrium and choriodecidua expressed relevant amounts of both receptor subtypes, whereas the CRH receptor population in placenta consisted mainly of CRH-R2. The high expression of CRH in placenta and the substantial expression of CRH receptors in choriodecidua and myometrium suggested that CRH derived from placenta exerts direct or indirect actions on these tissues. Neither CRH produced by myometrium or choriodecidua nor urocortin from other intrauterine sources seem to play a major role in the control of labour.

scholarly journals P017 C86/CD16 macrophages accumulate in the mucosa of B3 patients and could mediate EMT in Crohn’s disease

2020 ◽  
Vol 14 (Supplement_1) ◽  
pp. S138-S138
Author(s):  
A Boronat-Muñoz ◽  
A Cejudo-Garces ◽  
P Lledo-Gil ◽  
J Cosín-Roger ◽  
S Coll ◽  
...  
Keyword(s):  
Crohn’S Disease ◽  
Statistical Analysis ◽  
Crohn's Disease ◽  
Mrna Expression ◽  
U937 Cells ◽  
Macrophage Phenotype ◽  
Rt Pcr ◽  
Intestinal Tissue ◽  
Healthy Donors ◽  
Emt Markers

Abstract Background Macrophages contribute to fibrosis through the release of different mediators and the pattern of secretion may vary according to their phenotype. Methods The aim of the present study is to analyse the pattern of expression of macrophages, of EMT-related genes and cytokines in surgical resections from Crohn’s disease (CD, n = 43) patients which were categorised according to Montreal classification (B2 or B3); unaffected mucosa of patients with ileocecal cancer was used as control (n = 20). mRNA was isolated from intestinal samples and the expression of macrophage, EMT markers and cytokines were analysed by RT-PCR. PBMCS were isolated from healthy donors and treated during 5 days with secretomes, from control, B2 or B3 surgical resections; the mRNA expression of macrophage markers was determined by RT-PCR. U937 cells were differentiated to macrophages and then treated with IFNγ (20 ng/ml) for 4 days, the mRNA expression of macrophages markers were determined by RT-PCR. Results are expressed as mean ± SEM (n ≥ 5). Statistical analysis was performed by ANOVA + Newman–Keuls or t-test. Correlations between data were analysed using Pearson’s correlation coefficient (*p &lt; 0.05). Results The expression of CD16 and CD86 was significantly higher in intestinal samples from B3 CD patients (7.2 ± 1.1 and 7.7 ± 1.3, respectively) than in controls (1.4 ± 0.2 and 2.5 ± 0.4, respectively) or B2 CD patients (4.8 ± 0.9 and 4.5 ± 0.6, respectively). The mRNA expression of CD16 and CD86 were significantly higher in PBMCS treated with B3-secretomes than in those treated with B2- or control secretomes. The expression of CD16 and CD86 significantly correlated with FSP1 (r = 0.74, p = 0.002* and r = 0.66, p = 0.003*, respectively), VIMENTIN (r = 0.60, p = 0.02* and r = 0.82, p = 0.001*, respectively), SNAIL1 (r = 0.61, p &lt; 0.01* r = 0.52, p = 0.04*, respectively), IL4 (r = 0.63, p = 0.01* and r = 0.60, p = 0.02*, respectively) and IFNγ (r = 0.56, p = 0.001* and r = 0.58, p = 0.01*, respectively) in intestinal tissue from the fistulising CD group. U937 cells treated with IFNγ increased significantly the mRNA expression of CD16 (1.94 ± 0.24* vs. vehicle) and CD86 (1.60 ± 0.17* vs. vehicle). Conclusion A macrophage phenotype expressing CD86/CD16 may act as a source of EMT mediators in intestinal tissue from CD patients with a penetrating (B3) behaviour. IFNγ could be responsible for the increase in the number of CD86/CD16 macrophages in the B3 behaviour.

Sign in / Sign up

Export Citation Format

Share Document