Controlling Thrombopoietin Receptor Dimerization, Orientation and Activation Via Tryptophan 515

Abstract Abstract 3449 Background and Aims. The thrombopoietin receptor (TpoR, c-Mpl) plays a dual role in hematopoiesis. Beside the fact that it is one of the main regulators of megacaryopoiesis and platelet formation, TpoR is also expressed in HSCs and maintains them quiescent. TpoR signals as a homodimer after ligand binding in a 1:2 (ligand to receptor) ratio. Similar to other single pass membrane receptor, it contains an extracellular ligand binding domain, one helical transmembrane domain (TMD) and a cytoplasmic part important for JAKs binding and to mediate signaling. Unlike other cytokine receptors, TpoR contains a unique amphipathic motif (RW515QFP) at the junction between the TMD and the cytoplasmic domain. Mutations within this motif, namely W515K or W515L, lead to activation of the receptor and are associated with JAK2 V617F negative myeloproliferative neoplasms, specifically essential thrombocytopenia and primary myelofibrosis. We asked i) how a tryptophan at position 515 prevents autonomous activation of TpoR and ii) exactly how mutants at W515 impact on TpoR function and lead to oncogenesis. Methods. A combination of site-directed mutagenesis, biochemical and signaling assays, and spectroscopy analysis were employed. We made several specific mutations at position 515 to see if Trp515 is regulatory because of it size and/or aromatic character. We then tested the effect of mutations at adjacent positions in the wild type or mutated W515 constructs. Data were recorded from transiently transfected g2A cells and the results were confirmed in stably transduced BaF3 cells using dual luciferase and growth assays in the presence or absence of ligand. Adoptive transfer in lethally irradiated mice was used for assessing in vivo effects of TpoR mutants. The oligomerization status of the full length TpoR and some of our mutants was tested by employing the Gaussia princeps luciferase complementation assay, where Gaussia princeps luciferase fragments were fused in frame to the carboxyl terminus of TpoR or TpoR mutants. Recombination of the luciferase fragments results in a positive signal and reveals dimerization. Deuterium magic angle spinning (MAS) NMR spectroscopy and analytical ultracentrifugation were used to assess dimerization of the region encompassing the TMD. The tilt angle of this segment was assessed by FTIR spectroscopy. Results. Tryptophan seems to be absolutely required at position 515 to maintain the receptor inactive in absence of ligand. We identified secondary mutations (to tryptophan) that can prevent W515L/K/A activation of TpoR. The doubly mutated receptors behave like wild type receptors exhibiting no activation in absence of TPO and a normal response to TPO. These data suggest that W515 mutants may be specifically targeted for therapy. Mutations at W515 induced an increase in full length TpoR dimerization, and promoted dimerization of the segment comprising the TMD. However, our secondary site mutations showed differences between the mechanisms by which K or L versus A activate at W515. Overall, W515 impairs TpoR dimerization in a conformation productive for JAK2 activation. Measurements of the dichroic ratio by FTIR indicated that W515 increases the tilt angle of the TMD, thus reducing the interface required for TMD dimerization. We further explored the role of W515 in receptor activation by using a model where coiled coils are used to induce distinct dimeric conformations when fused to the TMD-cytosolic domains. W515 was essential for imparting differential signaling to the different dimers, both in cell lines and in vivo, where phenotypes in reconstituted mice no longer differ between receptors that have different dimeric orientations. Conclusions. Tryptophan 515 prevents TpoR dimerization in a productive orientation for JAK2 activation. This effect is reversible when secondary site mutations to tryptophan are introduced at certain positions around W515. Dimerization of TMD induced by ligand rotates W515 so that it is displaced from the headgroup region of the membrane to the dimer interface. This is crucial for imparting specific signaling as a function of dimeric orientation. Our results indicate that the region around W515 is a major switch for receptor function and could be exploited therapeutically. Disclosures: Constantinescu: Novartis: Membership on an entity's Board of Directors or advisory committees; Shire: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Amgen: Membership on an entity's Board of Directors or advisory committees.

Download Full-text

In Vivo Genome Editing of Liver Albumin for Therapeutic Gene Expression: Rescue of Hemophilic Mice Via Integration of Factor 9

Blood ◽

10.1182/blood.v120.21.751.751 ◽

2012 ◽

Vol 120 (21) ◽

pp. 751-751 ◽

Cited By ~ 1

Author(s):

Xavier M Anguela ◽

Rajiv Sharma ◽

Yannick Doyon ◽

Sunnie Y Wong ◽

David E Paschon ◽

...

Keyword(s):

Board Of Directors ◽

Transgene Expression ◽

Factor Ix ◽

Safe Harbor ◽

Wild Type ◽

Advisory Committees ◽

Aav Vector ◽

Children's Hospital ◽

Children’S Hospital

Abstract Abstract 751 Gene correction using zinc finger nuclease (ZFN) technology can be applied to target virtually any locus in the human genome. Beyond correcting mutated genes causative of disease, ZFNs can also be utilized to target transgene insertion into genomic “safe harbors.” Ideally, specific gene targeting to such “safe harbor” sites would (i) ensure therapeutically relevant levels of transgene expression and (ii) tolerate transgene addition without deleterious effect on the host organism. For liver-derived protein replacement, albumin represents an attractive target locus. Firstly, albumin is very highly expressed exclusively in the liver, thus targeting of a relatively small percentage of alleles should yield therapeutically relevant levels of liver-specific transgene expression. Second, the reduction or complete absence of albumin in animals and even humans (analbuminemia) produces surprisingly few symptoms. Here, we sought to investigate whether ZFN-mediated targeted insertion of a promoter-less copy of the human F9 cDNA at the mouse albumin locus could result in human Factor IX production and successfully correct the hemophilic phenotype in mice. To address this question, we constructed an AAV vector encoding a pair of ZFNs targeting intron 1 of the mouse albumin locus (AAV8-mAlb-ZFN) and a donor AAV vector (AAV8-Donor) harboring a partial cDNA cassette containing exons 2–8 of the wild-type human F9 gene flanked by sequences lacking significant homology to the mouse genome. Co-delivery of 1e11 vg of AAV8-mAlb-ZFN along with 5e11vg of AAV8-Donor resulted in stable (>12wk) circulating F.IX levels of 1600–3200 ng/mL (32–64% of normal). As a control, mice injected with the AAV8-Donor along with an AAV vector encoding a ZFN pair targeting an unrelated locus exhibited background F.IX levels (∼50 ng/mL). A dose-response study was performed by administering a fixed dose of donor (5e11 vg/mouse) with decreasing doses of AAV8-mAlb-ZFN (1e11, 1e10 and 1e9 vg/mouse). Human F.IX levels increased as a function of ZFN dose in the range tested (3260±480, 225±43 and 31±4 ng/mL at the high, medium and low dose, respectively). Importantly, these results showed that donor homology to the target site is not required to achieve robust levels of gene addition to the albumin locus in adult mice, thus permitting the design of donor vectors harboring corrective copies of transgenes up to the maximum AAV packaging capacity of ∼4.7 Kb. Albumin and factor IX are both synthesized as pre-propeptides and turned into propeptides after the signal peptide is removed. Expression of human F9 exons 2–8 spliced with mouse albumin exon 1 is expected to yield a chimeric propeptide. The first 2 N-terminal amino acids would originate from proalbumin, followed by a Val to Leu mutation at position −17 of the hF.IX propeptide and 16 aa encoded by human F9. To evaluate whether this chimeric human F.IX derived from gene addition to the albumin locus would be processed correctly and normalize the prolonged clotting times in hemophilia B (HB) mice, we injected 1e11 vg of AAV8-mAlb-ZFN and 5e11vg of AAV8-Donor into HB animals. Two weeks post-treatment, hF.IX antigen levels were in the range of 20% of normal and activated partial thromboplastin time, a measurement of clot formation, was corrected to wild-type levels (42 seconds), from an average of 70 seconds pre-treatment. Thus expression of a therapeutic protein (F.IX) from the albumin locus is shown to correct the HB disease phenotype in vivo. In summary, these data provide the first demonstration of ZFN-mediated in vivo genome editing of a safe harbor locus for therapeutic protein production. While we provide here a proof of principle establishing phenotypic correction of hemophilia B, appropriately designed donors could expand this strategy. Most importantly the magnitude of albumin expression (>15 g / day) should enable production of a diverse range of transgenes at therapeutically consequential levels. Disclosures: Anguela: The Children's Hospital of Philadelphia: Patents & Royalties. Sharma:The Children's Hospital of Philadelphia: Patents & Royalties. Doyon:Sangamo BioSciences, Inc.: Employment. Wong:Sangamo BioSciences, Inc.: Employment. Paschon:Sangamo BioSciences, Inc.: Employment. Gregory:Sangamo BioSciences, Inc.: Employment. Holmes:Sangamo BioSciences, Inc.: Employment. Rebar:Sangamo BioSciences, Inc.: Employment. High:Shire Pharmaceuticals: Consultancy; Sangamo Biosciences, Inc: Collaborator, Collaborator Other; Novo Nordisk: Visiting Professor, Visiting Professor Other; Genzyme, Inc: Membership on an entity's Board of Directors or advisory committees; The Children's Hospital of Philadelphia: Patents & Royalties; Bluebird Bio, Inc: Membership on an entity's Board of Directors or advisory committees.

Download Full-text

Role Of B Cell Tolerance In PF4/Heparin Antibody Production

Blood ◽

10.1182/blood.v122.21.2396.2396 ◽

2013 ◽

Vol 122 (21) ◽

pp. 2396-2396

Author(s):

Yongwei Zheng ◽

Alexander W Wang ◽

Mei Yu ◽

Anand Padmanabhan ◽

Benjamin E Tourdot ◽

...

Keyword(s):

B Cells ◽

B Cell ◽

Board Of Directors ◽

Cell Tolerance ◽

Inflammatory Stimulus ◽

Wild Type ◽

B Cell Tolerance ◽

Advisory Committees

Abstract Heparin-induced thrombocytopenia (HIT) is an immune-mediated disorder that can cause fatal arterial or venous thrombosis/thromboembolism. Immune complexes consisting of heparin, platelet factor 4 (PF4) and PF4/heparin-reactive antibodies are central to the pathogenesis of HIT. However, heparin, a glycosoaminoglycan, and PF4 are normal body constituents and it is as yet unclear what triggers the initial induction of pathogenic antibodies. Here we described detection of B cells among peripheral blood mononuclear cells (PBMCs) from each of 9 healthy adults that produced PF4/heparin-specific IgM antibodies following in vitro stimulation with ubiquitous pro-inflammatory molecules containing unmethylated CpG dinucleotides derived from bacterial and viral DNA. PF4/heparin-specific IgM-generating B cells were present at a frequency of at least 0.03 to 1 per thousand B cells present in the PBMC population. Similarly, splenic B cells isolated from unmanipulated wild-type mice consistently produced PF4/heparin-reactive antibodies following in vitro stimulation with CpG. In addition, wild-type mice produced PF4/heparin-reactive antibodies upon in vivo challenge with CpG whereas unchallenged wild-type mice did not. These findings demonstrate that both humans and mice possess pre-existing, inactive and tolerant PF4/heparin-specific B cells. We suggest that tolerance can be broken by a strong inflammatory stimulus, leading to activation of these B cells and production of antibodies that recognize PF4/heparin in vitro and in vivo. Consistent with this concept, mice lacking protein kinase Cd (PKCd), a signaling molecule of the B-cell survival factor BAFF (B-cell activation factor), that are known to have breakdown of B-cell tolerance to self-antigens, spontaneously produced anti-PF4/heparin antibodies in the absence of an inflammatory stimulus. Taken together, these findings demonstrate that breakdown of tolerance can lead to PF4/heparin-specific antibody production and that B-cell tolerance plays an important role in HIT pathogenesis. Disclosures: White II: Bayer: Membership on an entity’s Board of Directors or advisory committees; CSL-Behring: Membership on an entity’s Board of Directors or advisory committees; NIH: Membership on an entity’s Board of Directors or advisory committees; Asklepios: Membership on an entity’s Board of Directors or advisory committees; Wyeth: Membership on an entity’s Board of Directors or advisory committees; Entegrion: Membership on an entity’s Board of Directors or advisory committees; Biogen: Membership on an entity’s Board of Directors or advisory committees; Baxter: Membership on an entity’s Board of Directors or advisory committees.

Download Full-text

A Transgenic Mouse Model of Cardiac AL Amyloidosis

Blood ◽

10.1182/blood-2021-146782 ◽

2021 ◽

Vol 138 (Supplement 1) ◽

pp. 1592-1592

Author(s):

Gemma Martinez-Rivas ◽

Maria Ayala ◽

Sebastien Bender ◽

Murielle Roussel ◽

Arnaud Jaccard ◽

...

Keyword(s):

Mouse Model ◽

Board Of Directors ◽

Transgenic Mouse ◽

Amyloid Fibrils ◽

Plasma Cells ◽

Transgenic Mouse Model ◽

Full Length ◽

Al Amyloidosis ◽

Advisory Committees

Abstract Background: AL amyloidosis is the most frequent type of amyloidosis caused by the deposition in tissues of fibrillar aggregates composed of an abnormal immunoglobulin (Ig) light chain (LC) and leading to organ dysfunction. The most frequent and severe forms involve kidney and heart. Research on this disease suffers from the lack of reliable animal models, that could allow a better understanding of the disease and the design of new therapeutic strategies. In the present study, we aimed at reproducing AL amyloidosis in a mouse model. Methods: We developed an original transgenic approach using an insertion of a human pathogenic LC gene in the endogenous mouse kappa locus, such as the LC is produced by the naturally Ig producing B and plasma cells. Then, to avoid the association of human LCs with endogenous murine HCs, we backcrossed this strain with the DH-LMP2A mice, characterized by a high number of plasma cells devoid of endogenous HC. This strategy leads to a production of the human free LC similar or higher than in patients and proved efficient to reproduce in mice several monoclonal gammopathies of clinical significance (MGCS) (Fig.1A). Results: Despite strong LC production (Fig.1B), mice did not naturally develop AL amyloidosis. In vitro, the full length LC was resistant to amyloid formation at physiological conditions but the variable domain (IGLV6) showed high propensity to form fibrils. A single injection of amyloid fibrils and/or seeds, obtained from the variable domain (VL) of the human LC gene, led to amyloid deposits starting at 1 month post-injection, especially in the heart, spleen, liver and, to a lesser extent, in the kidney (Fig.1C). We confirmed that the deposits contain the full-length human LCs, which elongate VL fibrils in vivo (Fig.1D). Conclusions: This is, to our knowledge, the first transgenic mouse model of AL amyloidosis closely reproducing human lesions, especially in heart. Further studies are needed to better understand the early biochemical events leading to AL amyloidosis in vivo, but this model already shows that a partial degradation of the LC is likely required to initiate amyloid fibrils and that once seeded, the full length LC can elongate these fibrils. This mouse model opens new perspectives to better understand the toxicity of amyloid LC, their involvements in different biological processes and organ dysfunction and of course, to test new therapeutic approaches. Figure 1 Figure 1. Disclosures Roussel: Takeda: Consultancy; Janssen: Membership on an entity's Board of Directors or advisory committees; GSK: Honoraria; BMS: Honoraria; Amgen: Consultancy. Jaccard: Janssen: Membership on an entity's Board of Directors or advisory committees; Pfizer: Honoraria; Abbvie: Honoraria. Bridoux: Janssen: Consultancy; AstraZeneca: Consultancy, Speakers Bureau. Sirac: Attralus, Inc: Patents & Royalties, Research Funding.

Download Full-text

Mice Deficient in ß2-Glycoprotein I Have a Delayed Time to Thrombosis

Blood ◽

10.1182/blood-2019-130521 ◽

2019 ◽

Vol 134 (Supplement_1) ◽

pp. 2423-2423

Author(s):

Ravi Kumar Alluri ◽

Gabriel L Forbes ◽

Suman Kundu ◽

Alvin H. Schmaier ◽

Keith R McCrae

Keyword(s):

Carotid Artery ◽

Board Of Directors ◽

Rose Bengal ◽

Antiphospholipid Antibodies ◽

Male Mice ◽

Wild Type ◽

Advisory Committees ◽

Exon 2 ◽

Glycoprotein I

Introduction: Antiphospholipid syndrome (APS) is an autoimmune disorder caused by "antiphospholipid" antibodies (aPL) directed in part against β2-glycoprotein I (β2GPI). Though β2GPI is proposed to have numerous anti- and procoagulant properties in vitro, its effect in vivo is not well studied. Β2GPI binds thrombin via exosite 1 and exosite 2 and impairs thrombin activity, in particular thrombin-mediated activation of FXI. Β2GPI also is found to inhibit thrombin mediated platelet aggregation and it inhibits phospholipid-dependent coagulation reactions, such as the prothrombinase and tenase complexes. β2GPI also may inhibit the activation of protein C, an effect potentiated by antiphospholipid antibodies. However, there is little direct information on β2GPI effects on thrombosis in vivo. Methods: We created β2GPI deficient mice using CRISPR-Cas9 technology. Two pairs of guide RNAs (sgRNAs) flanking upstream and downstream exons 2 and 3 on a C57BL/6J background were designed using the CRISPOR program (http://crispor.tefor.net/crispor.py). The PCR product spanning exons 2 and 3 was used to test the efficiency of SgRNA cleavage using the Guide-it Complete sgRNA Screening System. An efficient pair of sgRNAs, one upstream of exon-2 (sgRNA-UP: ATCTTTCCCTTATATGCTAG) and another downstream of exon-3 (sgRNA-DOWN: TCGAGTTAATCACGTGTAGG) were injected into the embryos of C57BL/6J mice with Cas9 protein. Founder mice were genotyped to identify mice with expected deletions in the APOH (encoding β2GPI) gene. Strong founder male mice containing mutated APOH were crossed with wild type C57BL/6J females. Male and female F1 heterozygotes were backcrossed and F2 homozygous knockouts (APOH-/-) were characterized. The Rose-Bengal carotid artery thrombosis assay was performed on 6 to 9 week old wild type and APOH-/- mice. In brief, mice were anesthetized using sodium pentobarbital intraperitoneally. Rose Bengal [isobenzofuran-1(3H)9[9H] xanthan)-3:1 dipotassium salt] was injected via tail vein at a concentration of 50 mg/kg in 0.9% saline in a 100 μl volume. Green laser light at 540 nm was applied to the carotid artery following injection of Rose Bengal. Continuous flow was monitored at the site of injury and time to occlusion was determined. Results: Genotyping of APOH-/- mice revealed complete deletion of exon 2 and 3 (1900 to 2000 bp deletion). Plasma derived from WT-mice, APOH+/- and APOH-/- mice was analyzed by immunoblotting: APOH-/- mice lacked β2GPI protein while heterozygotes had intermediate levels. APOH-/- mice appeared healthy with no obvious phenotype. Carotid artery occlusion times were compared in 5 WT and 5 APOH-/- male mice. In WT-mice, complete vessel occlusion occurred at a mean time of 19.2 +/- 3.1 min, whereas the occlusion time in APOH-/- mice was prolonged approximately 2-fold (38.6 +/- 7.1 min). The prolonged time to occlusion in APOH-/- mice was highly significant (p <0.0005). Conclusion: These results indicate that APOH-/- mice have a net anticoagulant phenotype compared to WT mice, and suggest that β2GPI may have procoagulant properties in vivo. The mechanisms underlying this observation are not immediately apparent and are currently under investigation. However, given the reported effects of β2GPI on inhibition of thrombin generation and thrombin-mediated platelet activation, these findings are unexpected. Additional studies with other thrombosis models are in progress. Identification of β2GPI as a "procoagulant protein" suggests a reconsideration of its role in the pathogenesis of antiphospholipid syndrome. Disclosures McCrae: Sanofi Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees; Pfizer Pharmaceutical: Membership on an entity's Board of Directors or advisory committees; Rigel Pharmaceutical: Membership on an entity's Board of Directors or advisory committees; Dova Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees.

Download Full-text

Specific Targeting of KRAS Using a Novel High-Affinity KRAS Antisense Oligonucleotide in Multiple Myeloma

Blood ◽

10.1182/blood-2019-124391 ◽

2019 ◽

Vol 134 (Supplement_1) ◽

pp. 3104-3104 ◽

Cited By ~ 1

Author(s):

Antonio Sacco ◽

Cinzia Federico ◽

Katia Todoerti ◽

Bachisio Ziccheddu ◽

Arianna Giacomini ◽

...

Keyword(s):

Cell Cycle ◽

Board Of Directors ◽

Research Funding ◽

Laser Scanning ◽

Laser Scanning Microscopy ◽

Confocal Laser ◽

Wild Type ◽

Down Regulation ◽

Advisory Committees

INTRODUCTION. The multiple myeloma (MM) mutational landscape has identified KRAS as the most recurring somatic variant, observed in around 26% of cases, therefore KRAS may represent an important therapeutic target. Despite several attempts to develop a targeted therapeutic for KRAS mutant cancers, either direct KRAS enzymatic inhibition, or inhibition of MAPK- and PI3K- downstream effector cascades have not been successful. Therefore, there is a need to develop novel therapeutic approaches that may target the KRAS mutational event in MM. We have studied AZD4785, a novel, potent and selective high affinity 2'-4' constrained ethyl residues containing therapeutic antisense oligonucleotide (ASO) targeting KRAS, both in vitro and in vivo. METHODS. AZD4785 productive uptake was assessed by measuring KRAS knockdown at both the mRNA and protein level. Molecular mechanisms underlying AZD4785-dependent anti-MM activity were studied, interrogating the transcriptome profiling of AZD4785-treated MM cells. Anti-MM activity of AZD4785 was assessed in vitro in the context of primary MM patients' derived bone marrow stromal cells (BMSCs). Endpoints included evaluation of cell proliferation, cytotoxicity, cell cycle modulation, apoptosis, MM cell migration and adhesion; modulation of MAPK-, PI3K-, apoptotic-signaling. KRAS-mutated (MM1S; KMS20); -wild type (U266; KMS11) MM cell lines; BM MM patients' and peripheral blood healthy donor derived cells were tested. A non-targeting ASO (ASO-ctrl) was used as control. Synergism between AZD4785 and bortezomib, in modulating MM growth was tested. AZD4785-dependent modulation of tumor growth was studied in vivo in a subcutaneous MM.1S.-Luc model and a disseminated GFP/Luc-MM.1S model (BLI); MM cell dissemination to distant BM niches was studied ex vivo, using confocal laser scanning microscopy. RESULTS. AZD4785 led to specific dose-dependent inhibition of KRAS mRNA and protein expression, in KRAS-mutant, -wild-type cell lines and MM patient-derived CD138+ cells; without affecting NRAS and HRAS content. Wide mRNA transcriptome was performed using AZD4785 treated MM.1S cells vs control: GSEA showed down-regulation of MAPK, cell cycle, TP53 signaling pathways (FDR<0.25; P<0.05) in AZD4785-treated MM cells. Functionally, AZD4785 significantly impaired proliferation and survival of KRAS-mutant MM cells in a dose- and time-dependent manner even in the presence of patients' derived BM-MSCs. Cell growth of KRAS-wild type MM cells was not significantly affected. AZD4785 did not target healthy donors' derived PBMCs. Consistently with the effect on cell growth, AZD4785-treated KRAS mutant MM cells showed S-phase down-regulation, increased of G0/G1 phase and increased apoptotic rate, supported by up-regulation of cleaved-caspase-3, -PARP and BIM. The efficacy of AZD4785 in targeting MM cells within the context of the BM milieu was tested, revealing AZD4785-dependent impairment of MM cell adhesion and migration towards primary BM-MSCs, supported by inhibition of paxillin, cofilin, Src. Protein studies showed inhibition of both MAPK (phospho(p)-ERK1/2, p-MEK, p-RSK90, p-CRAF), and PI3K-Akt signaling pathways, selectively in AZD4785-treated KRAS mutant cells. AZD4785-dependent anti-MM activity was potentiated by the combinatory use of bortezomib, resulting in a significantly higher inhibition of MM cell proliferation, induction of apoptosis, and cell cycle arrest. AZD4785 exerted in vivo down-regulation of KRAS and anti-tumour activity in MM models, being more efficacious when used in combination with bortezomib, in terms of both inhibition of tumor growth and MM cell BM niches colonization, as evaluated by using in vivo whole body-bioluminescence imaging and ex vivo confocal laser scanning microscopy, respectively. CONCLUSION. Taken together, these data suggest that AZD4785 may represent a novel therapeutic approach for targeting mutant KRAS in MM, either alone or in combination with proteasome inhibitors; and warrant further development. Disclosures Giacomini: Fondazione Cariplo: Research Funding. Belotti:Amgen: Membership on an entity's Board of Directors or advisory committees; Janssen: Membership on an entity's Board of Directors or advisory committees; Celgene: Membership on an entity's Board of Directors or advisory committees. Revenko:Ionis Pharmaceuticals: Employment. MacLeod:Ionis Pharmaceuticals: Employment. Willis:AstraZeneca: Employment. Cai:AstraZeneca: Employment. Hauser:AstraZeneca: Employment. Rooney:AstraZeneca: Employment. Ambrose:AstraZeneca: Employment. Staniszewska:AstraZeneca: Employment. Hanson:AstraZeneca: Employment. Rossi:Janssen: Membership on an entity's Board of Directors or advisory committees; Celgene: Membership on an entity's Board of Directors or advisory committees; Amgen: Membership on an entity's Board of Directors or advisory committees; Gilead: Membership on an entity's Board of Directors or advisory committees; Sanofi: Membership on an entity's Board of Directors or advisory committees; Abbvie: Membership on an entity's Board of Directors or advisory committees; Pfizer: Membership on an entity's Board of Directors or advisory committees; Jazz: Membership on an entity's Board of Directors or advisory committees; Astellas: Membership on an entity's Board of Directors or advisory committees; Novartis: Honoraria; Mundipharma: Honoraria; BMS: Honoraria; Sandoz: Honoraria; Daiichi-Sankyo: Consultancy; Roche: Membership on an entity's Board of Directors or advisory committees. Ronca:Associazione Italiana per la Ricerca sul Canctro (AIRC): Research Funding. Bolli:GILEAD: Other: Travel expenses; JANSSEN: Honoraria; CELGENE: Honoraria. Moschetta:AstraZeneca: Employment. Ross:AstraZeneca: Employment. Roccaro:Celgene: Membership on an entity's Board of Directors or advisory committees; European Hematology Association: Research Funding; Amgen: Membership on an entity's Board of Directors or advisory committees; Transcan2-ERANET: Research Funding; AstraZeneca: Research Funding; Janssen: Membership on an entity's Board of Directors or advisory committees; Associazione Italiana per al Ricerca sul Cancro (AIRC): Research Funding.

Download Full-text

Crispr/Cas9 Engineered 61bp Deletion in the Calr Gene of Mice Leads to Development of Thrombocytosis

Blood ◽

10.1182/blood.v128.22.4274.4274 ◽

2016 ◽

Vol 128 (22) ◽

pp. 4274-4274 ◽

Cited By ~ 5

Author(s):

Thomas Balligand ◽

Younes Achouri ◽

Ilyas Chachoua ◽

Christian Pecquet ◽

Jean-Philippe Defour ◽

...

Keyword(s):

Bone Marrow ◽

Board Of Directors ◽

Advisory Committees ◽

Mutational Status ◽

Thrombopoietin Receptor ◽

Exon 9 ◽

Calr Mutations

Abstract In a subset of patients suffering from myeloproliferative neoplasms (MPNs), calreticulin (CALR) exon 9 frameshift mutations are known to be responsible for the development of either essential thrombocythemia (ET) or primary myelofibrosis (PMF) (1, 2). The most prevalent mutations are a 52-bp deletion (del52, type-1 mutation) and a 5-bp TTGTC insertion (ins5, type-2 mutation). In these patients, the mutational status is almost always heterozygous. Our group and collaborators have recently shown that the pathogenic mutant CALR proteins require interaction with and activation of the thrombopoietin receptor (TpoR) for activation of the JAK-STAT pathway (3, 4). Until now, no knock-in mouse model of these diseases has been published. In this abstract, we show how we succeeded in creating such a model. We had shown that the murine CALR mutant proteins behave just like their human counterparts (5). Specifically, the del52, ins5 and del61 (61bp deletion, type-1) Calr mutations were able to transform Ba/F3 cells (murine pro-B lymphocytic cells normally dependent on IL-3 for growth) expressing the thrombopoietin receptor (TpoR) and render them cytokine-independent. Importantly, we also mutated the Ba/F3 genome using the widely adopted CRISPR/Cas9 system in order to create a 61-bp deletion of the exon 9 of Calr. This too successfully transformed the Ba/F3 cells, showing that endogenous levels of expression of a mutant CALR protein are sufficient to induce phenotype in vitro. Now, using the same approach, we injected C57BL/6J mouse zygotes with the same CRISPR/Cas9 constructs to create the same 61-bp deletion in the murine Calr gene. Out of 46 pups born from the procedure, one male pup was heterozygous for the 61-bp deletion. By in vitro fertilization, we subsequently obtained heterozygous Calr del61/WT pups. After inter-breeding the mice, we analyzed the blood of 12 Calr del61/WT males and 12 Calr WT/WT males (littermates) at three different timepoints (15, 18 and 22 weeks old) and found that the Calr del61/WT mice showed significantly higher levels of circulating platelets. Conversely, red blood and white blood cell numbers were the same between both groups at all time points. We further show that expression of a mutant CALR protein, in a heterozygous state, is sufficient to induce abnormal proliferation of megakaryocytes and develop an ET phenotype in vivo in mice. Follow-up in dynamics of the phenotype and bone marrow and spleen pathology (examination of myeloproliferation and fibrosis) allow comparison with the retroviral murine models of CALR-mutant MPNs and with the known features of the human disease. The only limitation of our model is the fact that the Calr del61 mutation is parentally acquired and widespread throughout the organism. With this new model, we aim to test the efficiency of various drugs to prevent or cure the MPN phenotype, such as ruxolitinib, a JAK2 type-1 inhibitor that is already used in clinics in patients suffering from CALR-mutated MPNs. We also now have a means to generate a high number of Calr del61/WT bone marrow cells to extensively study the oncogenic properties of the Calr mutations at different stages of the hematopoeisis. It will also be of great interest to study, if generated, a homozygous mutational status of Calr del61 in vivo. Thus, our system will shed light on the importance of the negatively charged tail of CALR and on the effects of the novel positively charged tail on myeloproliferation. References 1. Klampfl T, Gisslinger H, Harutyunyan AS, Nivarthi H, Rumi E, Milosevic JD, et al. N Engl J Med. 2013 Dec 10;369(25):2379-90. 2. Nangalia J, Massie CE, Baxter EJ, Nice FL, Gundem G, Wedge DC, et al. N Engl J Med. 2013 Dec 10;369(25):2391-405. 3. Chachoua I, Pecquet C, El-Khoury M, Nivarthi H, Albu RI, Marty C, et al. Blood. 2015 Dec 14;10.1182/blood-2015-11-681932. 4. Marty C, Pecquet C, Nivarthi H, Elkhoury M, Chachoua I, Tulliez M, et al. Blood. 2015 Nov 25;10.1182/blood-2015-11-679571. 5. Balligand T, Achouri Y, Pecquet C, Chachoua I, Nivarthi H, Marty C, et al. Leukemia. 2016 Feb 29;10.1038/leu.2016.47. Disclosures Constantinescu: Teva: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Novartis: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Shire: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau; Personal Genetics: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau.

Download Full-text

Nfe2 Is Dispensable for Early, but Required for Adult Thrombocyte Formation and Function in Zebrafish

Blood ◽

10.1182/blood.v128.22.2534.2534 ◽

2016 ◽

Vol 128 (22) ◽

pp. 2534-2534

Author(s):

Megan S Rost ◽

Ilya Shestopalov ◽

Yang Liu ◽

Andy H Vo ◽

Francesca Barrett ◽

...

Keyword(s):

Board Of Directors ◽

Endothelial Injury ◽

Wild Type ◽

Advisory Committees ◽

High Fecundity ◽

Platelet Production ◽

Zebrafish Larvae ◽

Equity Ownership ◽

And Function

Abstract The NFE2 transcription factor is expressed in multiple hematopoietic lineages with a well-defined role in regulating megakaryocyte biogenesis and platelet production in mammals. Mice deficient in NFE2 completely lack circulating platelets, causing early lethality due to neonatal hemorrhage. Recent data in mice suggest some differences in embryonic and adult thrombopoiesis, and overexpression of NFE2 in murine bone marrow cells increases megakaryocyte maturation and platelet release, suggesting a role for NFE2 in both early and late megakaryocyte development. Zebrafish have emerged as an excellent model for studying hematopoiesis and thrombopoiesis due to their external development, optical transparency, high fecundity, and conservation of nearly the entire hemostatic system. Rather than platelets, zebrafish possess thrombocytes - nucleated cells believed to be the functional equivalent in mammals. We designed TALENs to target exon 4 of zebrafish nfe2, producing two mutant strains containing either an 8 or 10 base pair deletion, both resulting in a frameshift and null allele. We tracked survival for over one year and found that unlike mammals, zebrafish survive into adulthood in the absence of Nfe2 function with no signs of overt bleeding or lethality. We bred the nfe2 mutation into a transgenic background in which thrombocytes and hematopoietic progenitor cells express green fluorescent protein (Tg(cd41:GFP)) and are characterized by GFPhigh and GFPlow expression, respectively. We performed flow cytometry analysis and found that the percentage of GFPhigh cells (circulating thrombocytes) in the peripheral blood was significantly decreased from 0.67% to 0.2% in homozygous mutants (p < 0.001). In contrast, the percentage of GFPlow cells in the kidney marrow, the site of hematopoiesis in adult zebrafish, was increased from 0.47% to 1.17% in nfe2-/- mutants (p < 0.001). Surprisingly, quantification of circulating thrombocytes in 6 day old nfe2 null zebrafish larvae showed no significant differences from wild type siblings. Finally, we performed colony forming assays on whole kidney marrow lysates to measure the ability of hematopoietic progenitors to differentiate into thrombocytes. Both mutant and wild type adults are capable of producing thrombocytic colonies in the presence of thrombopoietin and erythropoietin. We and others have shown that thrombocytes participate in the formation of induced thrombi upon laser-mediated endothelial injury in zebrafish embryos and larvae. We tested the functionality of nfe2-/- thrombocytes and were surprised to find that wild type and nfe2 null zebrafish larvae form fibrin- and thrombocyte-rich clots in response to endothelial injury at day of life 3 (venous circulation) and 6 (arterial circulation), respectively. Measurement of both the time to occlusion as well as the total number of thrombocytes adhering to the site of injury revealed no significant differences between wild type and nfe2-/- larvae. These data suggest that loss of Nfe2 results in a late block in thrombopoiesis with secondary expansion of thrombocytic precursors, both features that are consistent with mammals. Surprisingly, Nfe2 appears to be dispensable for early embryonic thrombocyte production and function. These results suggest parallels with erythropoiesis, including distinct primitive and definitive pathways of development. This includes the potential for a previously unknown Nfe2-independent pathway of embryonic thrombopoiesis. The long term homozygous mutant survival will also facilitate more in depth study of Nfe2 deficiency in vivo, and further investigation could lead to alternative methodologies for the enhancement of platelet production in vivo or ex vivo. Disclosures Zon: Fate, Inc.: Equity Ownership, Membership on an entity's Board of Directors or advisory committees, Other: Founder; Scholar Rock: Equity Ownership, Membership on an entity's Board of Directors or advisory committees, Other: Founder; Marauder Therapeutics: Equity Ownership, Other: Founder.

Download Full-text

Dose-Dependent Role of the Cohesin Complex in Normal and Malignant Hematopoiesis

Blood ◽

10.1182/blood.v126.23.435.435 ◽

2015 ◽

Vol 126 (23) ◽

pp. 435-435

Author(s):

Aaron D. Viny ◽

Christopher J. Ott ◽

Barbara Spitzer ◽

Martin A Rivas ◽

Cem Meydan ◽

...

Keyword(s):

Progenitor Cells ◽

Board Of Directors ◽

Cohesin Complex ◽

Wild Type ◽

Advisory Committees ◽

Self Renewal ◽

Hematopoietic Stem ◽

Regulatory Architecture ◽

Dose Dependent

Abstract Cohesin complex members have recently been identified as putative tumor suppressors in hematologic and epithelial malignancies. The cohesin complex guides chromosome segregation, however cohesin-mutant leukemias do not show genomic instability suggesting an alternate role in malignant transformation. We hypothesized reduced cohesin function alters chromatin structure and disrupts cis-regulatory architecture of hematopoietic stem/progenitor cells. We therefore investigated the impact of both complete loss and haploinsufficiency of Smc3, an obligate member of the cohesin complex, in normal hematopoiesis and in myeloid transformation by developing a conditional Smc3 knockout allele. Somatic loss of Smc3 in hematopoietic cells induced lethal bone marrow aplasia (median survival 11 days; p<0.001), with premature sister chromatid separation and abnormal nucleolar organization. Competitive transplant assays showed that Smc3 loss completely abrogated stem cell self-renewal in vivo. These data are consistent with an absolute requirement for the cohesin complex in hematopoietic stem/progenitor cells. By contrast, Smc3 haploinsufficiency increased self-renewal in vitro and in vivo, with increased serial replating, expanded hematopoietic stem/progenitor cells, and a self-renewal/engraftment advantage in competitive transplantation assays in vivo (Figure a). Smc3 haploinsufficiency altered coordinated transcriptional output, including reduced expression of master regulatory transcription factors governing lineage commitment. Consistent with these data, Smc3 loss resulted in expanded Cd150+ Cd48+ ST-HSC (p=0.008), reduction in Cd150+ Cd48- LT-HSC (p=0.001), and altered chromatin architecture with dysregulated expression of genes with specific chromatin architecture footprints. Smc3 haploinsufficiency cooperated with Flt3ITD to induce acute leukemia in vivo (Figure b), with dysregulated expression of hematopoietic master regulators and altered nucleolar topology similar to that observed in germline cohesinopathy syndromes and in AML patients with cohesin mutations (Figure c). To further explore the mechanism by which Smc3 loss cooperates with Flt3ITD to induce leukemia, we investigated chromatin cis-regulatory architecture with transposase hypersensitivity assays (ATAC-seq). We hypothesized that increased accessibility at cis-regulatory elements and the alterations in gene expression seen in cells with combined Smc3 haploinsufficiency and Flt3ITD may be in a large part driven by potentiated Stat signaling at chromatin. We analyzed 146 transcription factor recognition motifs within the THS differentially observed in Smc3Δ/+Flt3ITD and wild-type cells. Chromatin accessibility gained in Smc3Δ/+Flt3ITD cells are enriched in Stat family transcription factor binding sites, including Stat5. We also observed enrichment of the Stat5 gene expression signature in the Smc3Δ/+Flt3ITD cells compared to Smc3Δ/+, Flt3ITD and wild-type cells, suggesting the divergent mutations cooperate to potentiate oncogenic Stat5 signaling in HSPCs. Our results demonstrate a key dose-dependent role for the cohesin complex in hematopoiesis, and show that reduced cohesin functions to alter enhancer-mediated transcription and contribute to aberrant self-renewal and myeloid transformation. Figure 1. Figure 1. Disclosures Levine: Loxo Oncology: Membership on an entity's Board of Directors or advisory committees; CTI BioPharma: Membership on an entity's Board of Directors or advisory committees; Foundation Medicine: Consultancy.

Download Full-text

Dual Inhibition of MDM2 and BET Cooperate to Eradicate Acute Myeloid Leukemia

Blood ◽

10.1182/blood.v126.23.674.674 ◽

2015 ◽

Vol 126 (23) ◽

pp. 674-674 ◽

Cited By ~ 1

Author(s):

Anne-Louise Latif ◽

John J Cole ◽

Joana Monteiro Campos ◽

William Clark ◽

Lynn McGarry ◽

...

Keyword(s):

Board Of Directors ◽

Cell Lines ◽

Single Agent ◽

Rna Seq ◽

Wild Type ◽

Advisory Committees ◽

Bet Inhibitor ◽

Dual Inhibition

Abstract Background: There remains a critical requirement for novel therapies for Acute Myeloid Leukemia (AML). Bromodomain and extra-terminal domain (BET) inhibitors are emerging as exciting therapeutic agents for hematopoietic malignancies. Pharmacological inhibition of BET bromodomains targets malignant cells by preventing reading of acetylated lysine residues, thus disrupting chromatin-mediated signal transduction, which reduces transcription at oncogenic loci. Although a heterogeneous disease, most AML retains wild type p53. However, p53 is often rendered functionally deficient by over-expression of MDM2. Potentiating the p53 response though MDM2 antagonism is therefore potentially beneficial to most AML subtypes. We hypothesized that dual inhibition of MDM2 and BET would be synthetic lethal to p53 wild type AML. Methods: For in vitro experiments CPI203 (BET inhibitor, Constellation Pharmaceuticals) and nutlin-3 (MDM2 antagonist, Sigma) were assessed on p53 wild type cell lines (OCI-AML3, MOLM-13 and MV411) and p53 wild type primary murine AML. To assess the combination's dependency on wild type p53; p53 mutated cell lines (KG1a, KASUMI-1 and THP1) were tested. Cell viability was assessed using resazurin (Alamar blue dye) across numerous dose ratios on the OCI-AML3 cell line and analysed using the Envision Fluorescent Reader. Drug combination indices (CI) were evaluated using Calcusyn (version 2.0). Apoptosis was assessed using flow cytometry staining for Annexin V and propidium iodide (PI) on all p53 wild type and mutated cell lines. For in vivo experiments CPI0610 (clinical grade BET inhibitor, Constellation Pharmaceuticals) and RG7112 (MDM2 inhibitor, Roche) were tested as single agents, in combination and with relevant vehicle controls. RNA seq was performed on the GAIIX sequencer and gene ontology analysis was performed using DAVID/INGENUITY pathway analysis (IPA). Results: In the OCI-AML3 cell line, resazurin analysis demonstrated that combining CPI203 with nutlin-3 was potently synergistic in decreasing viable cells for a 1:12.5 (mean CI=0.07) and 1:25 ratio (mean CI=0.299), and synergistic for a 1:50(mean CI=0.44) and 1:100(mean CI= 0.66) ratios. There was no benefit in using the combination treatment on the p53 mutated cell lines. Apoptosis was enhanced at least 1.5 fold (median 1.7, range 1.5-2.65) by the drug combination versus the single agents, in the panel of p53 wild type cell lines tested. Analysis of whole genome RNA seq on OCI-AML3 treated cells, showed that genes up-regulated by the combination of CPI203 and nutlin-3, had a thirty-fold enrichment for p53 signalling (FDR (<0.05). Down-regulated genes were enriched for FOXM1-dependent cell cycle progression genes. To evaluate the combination in vivo, we used a Trib-2 driven primary AML where leukemogenesis is induced through inhibition of C/EBPα. Myeloblasts were transduced with GFP on the same retroviral construct asTrib-2 for disease tracking. Treatment was commenced in all mice (n=40), post confirmation of disease engraftment. Three mice from each treatment group were sacrificed after 48hrs and cells sorted for GFP to perform RNA seq in this in vivo setting. After 21 days of treatment all mice were sacrificed (n=27, one vehicle control succumbed to disease 15 days post engraftment). End of treatment results (primary read out was the GFP% which equates to the blast%) demonstrated superior in vivo efficacy of dual inhibition of MDM2 and BET in comparison with controls in eradicating AML, p<0.0001, (see figure). Importantly, normal haematopoiesis was spared - as evidenced by normal full blood counts and comparable myeloid, B-cell and T-cell populations with our C57bl6 wild type controls. RNA seq of the murine blasts revealed that many more genes significantly (FDR<0.05) changed expression in the combination treated mice than single agent treated mice. The p53 pathway was the most common up-stream regulator of genes changing expression post combination treatment, p<0.0001. The combination affected many more genes in the p53 pathway than RG7112 alone (120 genes versus 20 genes respectively), in line with our in vitro results. Conclusion: This combination of BET and MDM2 inhibition is effective and superior to single agent therapy on all p53 wild type AMLs tested, in vitro and in vivo. In both contexts this is associated with potentiating the p53 response and could be relevant to many patients with p53 wild type AML. Figure 1. Figure 1. Disclosures Latif: Novartis: Honoraria. Copland:Ariad: Honoraria, Membership on an entity's Board of Directors or advisory committees; BMS: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Novartis: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Pfizer: Honoraria, Membership on an entity's Board of Directors or advisory committees.

Download Full-text

Combinatorial Antigen Targeting Strategy for Acute Myeloid Leukemia

Blood ◽

10.1182/blood-2020-141540 ◽

2020 ◽

Vol 136 (Supplement 1) ◽

pp. 22-23

Author(s):

Pinar Ataca Atilla ◽

Mary K McKenna ◽

Norihiro Watanabe ◽

Maksim Mamonkin ◽

Malcolm K. Brenner ◽

...

Keyword(s):

T Cells ◽

T Cell ◽

Board Of Directors ◽

Tumor Control ◽

Publicly Traded ◽

Advisory Committees ◽

Car T Cells ◽

Car T Cell ◽

Car T

Introduction: Efforts to safely and effectively treat acute myeloid leukemia (AML) by targeting a single leukemia associated antigen with chimeric antigen receptor T (CAR T) cells have had limited success. We determined whether combinatorial expression of chimeric antigen receptors directed to two different AML associated antigens would augment tumor eradication and prevent relapse in targets with heterogeneous expression of myeloid antigens. Methods: We generated CD123 and CD33 targeting CARs; each containing a 4-1BBz or CD28z endodomain. We analyzed the anti-tumor activity of T cells expressing each CAR alone or in co-transduction with a CLL-1 CAR with CD28z endodomain and CD8 hinge previously optimized for use in our open CAR-T cell trial for AML (NCT04219163). We analyzed CAR-T cell phenotype, expansion and transduction efficacy by flow cytometry and assessed function by in vitro and in vivo activity against AML cell lines expressing high, intermediate or low levels of the target antigens (Molm 13= CD123 high, CD33 high, CLL-1 intermediate, KG1a= CD123 low, CD33 low, CLL-1 low and HL60= CD123 low, CD33 intermediate, CLL-1 intermediate/high) For in vivo studies we used NOD.SCID IL-2Rg-/-3/GM/SF (NSGS) mice with established leukemia, determining antitumor activity by bioluminescence imaging. Results: We obtained high levels of gene transfer and expression with both single (CD33.4-1BBʓ, CD123.4-1BBʓ, CD33.CD28ʓ, CD123.CD28ʓ, CLL-1 CAR) and double transduction CD33/CD123.4-1BBʓ or CD33/CD123.CD28ʓ) although single-transductants had marginally higher total CAR expression of 70%-80% versus 60-70% after co-transduction. Constructs containing CD28 co-stimulatory domain exhibited rapid expansion with elevated peak levels compared to 41BB co-stim domain irrespective of the CAR specificity. (p<0.001) (Fig 1a). In 72h co-culture assays, we found consistently improved anti-tumor activity by CAR Ts expressing CLL-1 in combination either with CD33 or with CD123 compared to T cells expressing CLL-1 CAR alone. The benefit of dual expression was most evident when the target cell line expressed low levels of one or both target antigens (e.g. KG1a) (Fig 1b) (P<0.001). No antigen escape was detected in residual tumor. Mechanistically, dual expression was associated with higher pCD3ʓ levels compared to single CAR T cells on exposure to any given tumor (Fig 1c). Increased pCD3ʓ levels were in turn associated with augmented CAR-T degranulation (assessed by CD107a expression) in both CD4 and CD8 T cell populations and with increased TNFα and IFNɣ production (p<0.001 Fig 1d). In vivo, combinatorial targeting with CD123/CD33.CD28ʓ and CLL-1 CAR T cells improved tumor control and animal survival in lines (KG1a, MOLM13 and HL60) expressing diverse levels of the target antigens (Fig 2). Conclusion: Combinatorial targeting of T cells with CD33 or CD123.CD28z CARs and CLL-1-CAR improves CAR T cell activation associated with superior recruitment/phosphorylation of CD3ʓ, producing enhanced effector function and tumor control. The events that lead to increased pCD3ʓ after antigen engagement in the dual transduced cells may in part be due to an overall increase in CAR expression but may also reflect superior CAR recruitment after antigen engagement. We are now comparing the formation, structure, and stability of immune synapses in single and dual targeting CARs for AML. Disclosures Brenner: Walking Fish: Current equity holder in publicly-traded company, Membership on an entity's Board of Directors or advisory committees; Bluebird Bio: Membership on an entity's Board of Directors or advisory committees; Tumstone: Membership on an entity's Board of Directors or advisory committees; Tessa Therapeutics: Membership on an entity's Board of Directors or advisory committees, Other: Founder; Maker Therapeutics: Current equity holder in private company, Membership on an entity's Board of Directors or advisory committees, Other: Founder; Memmgen: Membership on an entity's Board of Directors or advisory committees; Allogene: Current equity holder in publicly-traded company, Membership on an entity's Board of Directors or advisory committees. Atilla:Bluebird Bio: Membership on an entity's Board of Directors or advisory committees; Tumstone: Membership on an entity's Board of Directors or advisory committees; Tessa Therapeutics: Membership on an entity's Board of Directors or advisory committees, Other: founder; Marker Therapeuticsa: Current equity holder in publicly-traded company, Membership on an entity's Board of Directors or advisory committees, Other: Founder, Patents & Royalties; Allogene: Current equity holder in publicly-traded company, Membership on an entity's Board of Directors or advisory committees; Walking Fish: Current equity holder in publicly-traded company, Membership on an entity's Board of Directors or advisory committees, Patents & Royalties; Memgen: Membership on an entity's Board of Directors or advisory committees; KUUR: Membership on an entity's Board of Directors or advisory committees.

Download Full-text