scholarly journals Evaluation of Hepatic, Renal and Cardiac Diagnostic Markers in Patients With Severe COVID-19

2021 ◽  
Author(s):  
Sara Mobarak ◽  
Asma Mohammadi ◽  
Atefeh Zahedi ◽  
Saeed Jelvay ◽  
Fatemeh Maghsoudi ◽  
...  
Keyword(s):  
Diagnostic Markers ◽  
Direct Bilirubin ◽  
Inclusion Criteria ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Infectious Disease Physician ◽  
The Mean ◽  
And Gender ◽  
Age Range ◽  
D Dimer

SARS-CoV-2 that causes Coronavirus disease 2019 (COVID-19) was first known in Wuhan, China, in December 2019. The aim of this study was to evaluate the level of common hepatic, renal, and cardiac diagnostic markers in hospitals in patients with severe COVID 19. In this study, 259 patients with symptoms of severe COVID-19 and a positive RT-PCR assay of nasopharyngeal samples were enrolled. Inclusion criteria are positive for COVID-19 patients at the diagnosis of an infectious disease physician. Diagnostic markers of liver, kidney, and heart were evaluated by age and gender. In this study, 48.3% of patients severe with COVID-19 were male, and 51.7% were female. The mean of markers such as LDH, Direct Bilirubin, SGOT, SGPT, D-dimer was higher than normal, which was observed in men more than women. The mean of CK-MB also was higher than normal, which was observed in women more than men. The highest mean of markers was seen in the older ages. The mean of BUN was observed in the age range of 55-64 years and above 65 years above normal. But the mean of CPK, creatinine, potassium and alkaline phosphatase were normal. The results of the present study showed an increase in the level of some of the most important diagnostic markers of hepatic, renal, and cardiac in patients with COVID 19. This increase was greater in some markers, including SGOT, SGPT, Direct bilirubin, LDH, D-dimer, in men than in women, and more in older patients.

scholarly journals Evaluation of variation of D-dimer levels in COVID-19 patients to predict the disease outcome in a hospital based study

2020 ◽  
Vol 24 (5) ◽  
Author(s):  
Shahtaj Khan ◽  
Hamzullah Khan ◽  
Saba Khan ◽  
Mansoor Akhtar
Keyword(s):  
Relative Risk ◽  
Survival Rate ◽  
Standard Deviation ◽  
Age Groups ◽  
Female Gender ◽  
P Value ◽  
The Mean ◽  
And Gender ◽  
Age Range ◽  
D Dimer

Objectives: To determine the variation of d-dimers in COVID-19. To determine the contribution of demographic factors (age and gender) toward an elevated d-dimers values. To determine the probability of surviving in different age groups in COVID-19, with d-dimer > 0.5 µg/ml. Methodology:  A total of 193 patients were enrolled from COVID-19 isolation units, Hayatabad medical complex Peshawar, whose d-dimer levels were performed as per instructions of the treating physician and were followed. Relevant information’s were recorded on a pre-designed performa prepared in accordance with the objectives of the study. Results: Out of total 193 patients 152(78.8%) were males and 41(21.2%) females. 94(48.7%) patients were in the age range 35-55 y while 76(39.4%) patients had age more than 55 y. Regarding d-dimer readings, 162(83.9%) had d-dimer levels more than 0.5 µg/ml. The mean with standard deviation of age of the patients was 52 ± 13 y. The mean with standard deviation of d-dimer values of the patients was 4.9 ± 13.3 µg/ml. It was observed that, the relative risk of deranged values of d-dimers was 1.18 (rr = 1.18) in patients with age > 55 y. Similarly in female gender the relative risk of higher values of d-dimers above normal was 1.26 (rr = 1.26) without reaching a statistically significant p-value (p = 0.48). The probability of worse outcome in term of death was 2.06 times more in patients with d dimers > 0.5 µg/ml (OR = 2.06). Furthermore the probability of surviving was 90-100% by age < 50 y, 80% in age range 51-60 y, 45% in age range 61-70 y and 30% at age  > 80 y. Conclusion: The deranged d-dimer levels were noted in 84% of the COVID-19 patients. Age > 55 y and female gender are at higher risk of deranged d-dimers and further consequences. Survival rate of patients with deranged d-dimers drops to 30% in patients with age > 80 y, 45% at age < 70 y. Key word: COVID-19, D-dimers, survival rate, prognostic values Anaesth. pain intensive care 2020;24(5): Received: 20 June 2020, Reviewed: 24, 28 June 2020, Accepted: 1 July 2020

scholarly journals First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain

Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 75-75 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
C. Córdoba-Sellés ◽  
T. Tornos ◽  
M. C. Cebrián ◽  
M. I. Font
Keyword(s):  
Plant Viruses ◽  
Dwarf Virus ◽  
Eastern Coast ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Specific Primers ◽  
First Report ◽  
Type Isolate ◽  
The Mean ◽  
Pittosporum Tobira

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5′ TATGCGAGAATTGGGAGTGGGTAGT 3′) and EMDV-R (5′ CATTGTTATCCCGGGAAGTATTT 3′) targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

scholarly journals Dynamics of ORF1ab and N Gene among hospitalized COVID-19 positive cohorts: A hospital based retrospective study

2020 ◽  
Author(s):  
Pojul Loying ◽  
Vaishali Sarma ◽  
Suranjana C. Hazarika ◽  
Monjuri Kataki ◽  
Dina Raja ◽  
...  
Keyword(s):  
Retrospective Study ◽  
N Gene ◽  
Time Interval ◽  
Rt Pcr ◽  
The Mean ◽  
Exhaustive Study ◽  
And Gender ◽  
Mean Differences ◽  
And Control ◽  
Relationship Of

1.AbstractObjectiveThe present study hospital based retrospective study aimed at investigating the dynamics of ORF1ab and N gene from hospitalized COVID-19 positive cohorts considering the Ct values of both genes.Study design and MethodologyRetrospective analyses of Ct values were done from 115 hospitalized COVID-19 positive patients in different time interval. Patients were admitted to the hospital either by RAT or/and RT-PCR and first RT-PCR testing were made after 9 days of incubation followed by testing in every 3 days of interval till negative, subsequently release of the patients.ResultsWe have looked into the dynamics of ORF1ab and N gene and found that N gene require longer duration of days with 12.68 (S.D.±3.24) to become negative than ORF1ab with 12.09 (S.D.±2.88) days and it differs significantly (p=0.012; p<0.05). The persistent of N gene found in 46 patients out of 115 (39.65%) to the succeeding reading after 3 days. We have also looked into the mean differences in the between N and ORF1ab genes every readings separately and found that there were no significant differences between the mean Ct value of ORF1ab and N gene except in the day 3 (p=0.015; p<0.05). Further, we have looked into the relationship of age and gender of patients with the duration of positivity; however we did not find any significant role.ConclusionIn COVID-19 hospital positive cohorts, the persistent of positivity of N gene is significantly for more duration than ORF1ab. As the SARS-CoV-2 is a new virus and study on it is evolving, so, exhaustive study is required on the dynamic of N gene positivity persistent in relation to the other pathophysiological parameters for the management and control of COVID-19.

scholarly journals Infants have lower RT-PCR cycle threshold for SARS-CoV-2 in comparison with older children and adults

2021 ◽  
Author(s):  
Marcia Polese-Bonatto ◽  
Ivaine Tais Sauthier Sartor ◽  
Fernanda Hammes-Varela ◽  
Gabriela Luchiari Tumioto Gianinni ◽  
Thais Raupp Azevedo ◽  
...  
Keyword(s):  
Viral Load ◽  
Significant Role ◽  
Signs And Symptoms ◽  
Viral Dynamics ◽  
Older Children ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Cycle Threshold ◽  
The Mean

Background: The viral dynamics and the role of children in the spread of SARS-CoV-2 are not completely understood. Our aim was to evaluate how RT-PCR Ct values among children with confirmed SARS-CoV-2 compared with that of adult subjects. Methods: Patients (aged from 2 months to ≤18 years, and adults) with signs and symptoms of acute SARS-CoV-2 infection for less than 7 days, were prospectively enrolled in the study from May to November 2020. All participants performed RT-PCR assay for SARS-CoV-2 detection; Ct values of ORF1ab, N, and S gene-targets, and the average of all the three probes were used as surrogates of viral load. Results: Of the total of 376 participants with confirmed SARS-CoV-2 infection there were 21 infants, 62 children and 293 adults. The RT-PCR Ct values of children under 18 were not significantly different from that of adults, as observed by the analyzed probes (namely ORF1ab, N, and S), and by the mean of all 3 gene-targets. However, infants had significantly lower Ct values compared to children and adults (P = 0.044). Discussion: Ct values for children were not significantly different than that of adults with positive SARS-CoV-2. Interestingly, infants had even lower Ct values when compared to older children and adults. Although viral load is not the only determinant of transmission, infants may play a significant role in the spread of SARS-CoV-2 in the community, especially if or when this population returns to regular daycare activities.

scholarly journals PERBEDAAN RERATA FAKTOR HEMOSTASIS PADA PREEKLAMPSIA BERAT DAN EKLAMPSIA

2019 ◽  
Vol 2 (1) ◽  
pp. 10-15
Author(s):  
Dyhan Purna Setia ◽  
Ferdinal Ferry ◽  
Dovy Djanas
Keyword(s):  
Medical Record ◽  
Cross Sectional Study ◽  
Severe Preeclampsia ◽  
Inclusion Criteria ◽  
Exclusion Criteria ◽  
Cross Sectional ◽  
Hemostatic Factors ◽  
The Mean ◽  
The Difference ◽  
D Dimer

Objective : To find the difference in mean hemostatic factors in severe preeclampsia and eclampsia.Method : The study was analytic descriptive using a cross sectional study design by looking at the subject's Medical Record according to the time and place of research. The sample is the entire medical record of pregnant women who suffer from preeclampsia and eclampsia in the obstetric and gynecology departments of Dr. M. Djamil Padang Hospital in the period 15 January 2016 to 31 December 2017. The assessment was in the form of assessed platelet levels, PT, APTT and D-Dimer. Samples were taken from populations that met the inclusion criteria and did not have exclusion criteria. Sampling using consecutive sampling techniques taken from the Medical Record Dr. M.Djamil Padang. Statistical analysis to assess significance using the T-Test.Result : The severity the condition of pregnancy the lower the platelet mean and PT. Significant differences were obtained between platelets in PEB and eclampsia (p> 0.05). The mean PT, APTT and D-Dimer showed no significant differences in pregnancy conditions. Statistical test with T-Test did not show significant differences in mean PT, APTT, and D-dimer between eclampsia and PEB (p> 0.05).Conclusion : There were significant differences in mean in platelets, whereas in PT, APTT, and D-dimers in PEB and eclampsia there were no significant differences.Keywords: Pregnancy, severe preeclampsia, eclampsia, platelets, PT, APTT, D-Dimer.

scholarly journals Assessment of Severity and Outcome of COVID-19 Cases by Haematological and Biochemical Markers at Tertiary Care Centre in India

2020 ◽  
pp. 196-207
Author(s):  
Amresh Kumar Singh ◽  
Jayesh Pandey ◽  
Indra Prasad Adhikari ◽  
Vivek Gaur ◽  
Ankur Kumar ◽  
...  
Keyword(s):  
Critically Ill ◽  
Serum Ferritin ◽  
Biochemical Parameters ◽  
Venous Blood ◽  
Tertiary Care ◽  
Rt Pcr ◽  
Biochemical Biomarkers ◽  
Corona Virus ◽  
The Mean ◽  
D Dimer

Background: In December 2019, a cluster of pneumonia cases caused by a novel corona virus (2019-nCov), later named as severe acute respiratory syndrome corona virus-2 (SARS-CoV-2) was detected in China. In India, 30th January 2020 first positive case ofSARS-CoV-2was reported from Kerala. The reverse transcriptase polymerase chain reaction (RT-PCR) is the standard method of choice for diagnosis of SARS-CoV-2 infection. Certain biomarker molecules that are being evaluated for assessment of severity and prognosis are; D-dimer, C reactive protein (CRP), lactate dehydrogenase (LDH), complete blood counts (CBC) and serum ferritin. The elevated levels of these biomarkers were associated with extent of inflammation. Objective: This prospective study was designed to assess the severity and prognosis of pneumonia cases caused by SARS-CoV-2 using different haematological and biochemical biomarkers. Materials and Methods: This study was conducted among 242 participants attending covid-19 facility of BRD Medical College Gorakhpur, after confirmation by RT-PCR. Different haematological and biochemical biomarkers were analyzed using 5 ml fasting venous blood samples and these were analysed in auto analysers using standard protocol as per manufacturer’s instructions. Finally result was analyzed using standard statistical calculation by %positivity, confidence interval, p values and ≤ 0.05 is considered as statistically significant. Results: Among a total of 242 COVID-19 cases based on different haematological and biomarkers assessment; 92 were critically ill and 150 non-critically ill. The mean ±SD of various haematological parameters among critically ill cases were; haemoglobin (13.0±1.8),TLC (13846.13±3903.76),PLT (92213.48±61415.07),NLR(36.5±30.4).The mean ±SD of the biochemical parameters of critically ill participant was; CRP 44.7±35.4 (95%CI 25.06,2.93),D. dimer 2.9±2.6 (95%CI 1.69,0.10), serum ferritin 1204.7±750.7 (95%CI 581.8,60.1),LDH 397.2±180.8 (95% CI 133.01,0.0163). The level of different haematological and biochemical parameters was raised also in non-critically ill cases but at lower side. Out of these 242 cases; 106 (43.8%) were died and 136 (56.2%) survived but the mortality was high in critically ill cases. Conclusion: Our findings show that level of D-dimer, LDH, CRP, NLR and serum ferritin,can be used to assess the severity and prognosis of COVID-19 cases. Among these biomarkers; D-dimer levels correlate more precisely with severity and can be considered as a reliable prognostic marker.

scholarly journals Estimation of D-dimer levels in COVID-19 patients and its correlation with age and gender

2021 ◽  
Author(s):  
Kalash Chander
Keyword(s):  
District Hospital ◽  
Age Group ◽  
Older Individuals ◽  
Rt Pcr ◽  
Fibrin Degradation Product ◽  
Age And Gender ◽  
Safe Level ◽  
Product Test ◽  
And Gender ◽  
D Dimer

Background: COVID-19 patients show some kind of abnormal coagulation parameters, related to thrombotic disorders, which can act as marker of the disease. One such marker is D-dimer, which is a widely used fibrin degradation product test used for initial diagnosis of thrombotic disorders. D-dimer levels from patients coming in OPD of sub-district hospital Bishnah, Jammu were analyzed to estimate the degree of this relation to its severity, age and gender.Methods: A retrospective study was conducted on the D-dimer data, collected from the patients coming in OPD of sub-district hospital Bishnah, Jammu, from March 2019 to March 2020. Randomly selected 134 patients infected with COVID-19, with known age and gender and confirmed by RT-PCR were included in the study.Results: Out of these 134 patients, 76 were males (56.72%) and 58 were females (43.28%). 41.04% patients belonged to the age group 51 to 70 years; 92 patients had elevated levels of D-dimer levels, 52 (38.8%) patients showed D-dimer levels four-folds the safe level, >1000 ng/ml and a significant number of females (70.7%) were found to be with elevated D-dimer levels. Women were found to be at a higher risk of developing thrombotic disorders than men. There was slight relation of thrombotic disorders such as D-dimer with postmenopausal age of women as well.Conclusions: This study has shown a clear guidance that women and older individuals are at a higher risk of developing thrombotic disorders during COVID-19 infection. 

A MONITORING PARAMETER IN THROMBOLYSIS?

1987 ◽  
Author(s):  
R Roth ◽  
F Duckert ◽  
G Marbet
Keyword(s):  
Conformational Epitope ◽  
Vein Thrombosis ◽  
Monitoring Parameter ◽  
Thrombolytic Effect ◽  
The Mean ◽  
Age Range ◽  
The Relationship ◽  
Derivatives Of ◽  
Range Test ◽  
D Dimer

D-dimers are specific derivatives of cross-linked fibrin. Their concentration may be used to conduct thrombolysis and predict its outcome. In this investigation we studied the relationship between D-dimer plasma levels during thrombolysis of deep leg vein thrombosis (DVT) and the phlebographic success.METHODS: 17 patients (9 males, 8 females, age range 17-56 years) were studied. All patients had DVT and were treated with either an acylated streptokinaseplasminogen complex (n=lO) or streptokinase (n=5) or both drugs successively (n=2) for 4.6 days on average. The thrombolytic effect was assessed by ascending phlebography and the patients were divided into 3 groups: A complete clearance, B partial clearance, C no change. The D-dimers were measured by a non-competitive EIA assay with a monoclonal antibody against a conformational epitope on the plasmin-resistant D-dimer, fragment of cross-linked fibrin.RESULTS: The table gives the mean D-dimer levels in the 3 groups of patients at 12 hours intervals.The statistical analysis (Newman-Keuls multiple range test) suggests that low D-dimer levels, especially over the first 36 hours are related to treatment failures.CONCLUSIONS: Despite some overlapping between successful and non-successful cases and lack of absolute specificity of the assay the D-dimer concentration may predict treatment failure in the first two days.

scholarly journals Gambaran Komplikasi Transurethral Resection of the Prostate pada Pasien Benign Prostatic Hyperplasia

2017 ◽  
Vol 10 (1) ◽  
pp. 44
Author(s):  
Zuhirman Zuhirman ◽  
Desby Juananda ◽  
Putry Lestari
Keyword(s):  
Benign Prostatic Hyperplasia ◽  
Transurethral Resection ◽  
Gold Standard ◽  
Medical Records ◽  
Benign Tumor ◽  
Descriptive Study ◽  
Prostatic Hyperplasia ◽  
Inclusion Criteria ◽  
The Mean ◽  
Age Range

Benign prostatic hyperplasia (BPH) is a benign tumor that most common, a serious problem and may affect thequality of life. Transurethral resection of the prostate (TURP) is the gold standard for BPH management. The aim ofthis study was to describe the complications of TURP in patients with BPH. This was a descriptive study by reviewingthe medical records of BPH patients underwent TURPs at RSUD Arifin Achmad, Riau Province in 2011-2015. Therewere 280 medical records fulfilled the inclusion criteria in which showed 93 patients who experienced complicationsof TURP. The most age range was 60-69 years old (12,9%), the mean of the resection duration was 30(10-80) minutesand the mean of weight of the resected prostatic tissue was 30 (10-50)grams. The most common complications wasbleeding (42,9%), urinary retention (27,6%).In the research, we conclude the complications were higher than theones in the literatures.

scholarly journals Pulmonary thromboembolism in COVID-19 Patients on CT Pulmonary Angiography - A Single-Centre Retrospective Cohort Study in the United Arab Emirates

2021 ◽  
Author(s):  
Ghufran Aref Saeed ◽  
Waqar Haider Gaba ◽  
Abd Al Kareem Mohd Adi ◽  
Reima Obaid Al Marshoodi ◽  
Safaa Saeed Al Mazrouei ◽  
...  
Keyword(s):  
Pulmonary Embolism ◽  
United Arab Emirates ◽  
Pulmonary Thromboembolism ◽  
Pulmonary Angiography ◽  
Rt Pcr ◽  
Ct Pulmonary Angiography ◽  
Exclusion Criteria ◽  
The Mean ◽  
Positive Groups ◽  
D Dimer

Purpose. Our aim is to identify the prevalence and distribution of pulmonary thromboembolism in COVID-19 infected patients in our hospital. Materials and Methods. Data of all patients with COVID-19 infection either on RT-PCR testing or non-contrast high resolution CT(HRCT) who had CT pulmonary angiography (CTPA) from April to June 2020 were included. 133 patients were initially included in the study, 7 were excluded according to exclusion criteria, leaving a total number of 126 patients. Results. Twenty (15.8%) patients had evidence of pulmonary embolism (PE) on CTPA with mean age of 50 years (range 31-85) of which 95% were males. The mean D-dimer was 5.61mcg/mL among the PE-negative and 14.49 mcg/mL in the PE-positive groups respectively. Among the patients with evidence of pulmonary embolism on CTP, almost half required admission to intensive care unit in comparison to only one-fifth with negative CTPA. One-fourth died among the PE positive group with only 5% died among the PE negative group. There was a 33% reduction in the development of PE in the COVID-19 patients who had received low molecular weight heparin (LMWH) prior to their CTPA study versus those who had not. Conclusion. D-dimer correlates well with the incidence of pulmonary embolism among COVID-19 patients. Our data suggest that majority of our patients, developed pulmonary embolisms within 5 days into their hospital stay, accounting to almost two thirds of all positive cases diagnosed by CTPA. Those with PE among COVID-19 patients have high chances of ICU admission and mortality. Use of thromboprophylaxis early on might reduce the incidence of PE.

Sign in / Sign up

Export Citation Format

Share Document